CN111514287A - Influenza A universal DNA vaccine and preparation method and application thereof - Google Patents

Abstract

The invention provides an influenza A universal DNA vaccine and a preparation method and application thereof, and the research utilizes influenza virus HA protein, M2e protein and NP protein highly conserved sequences to construct three fusion protein genes, and clones the three fusion protein genes to pCDNA3.1(+) vector to construct three recombinant DNA vaccines pcDNA3.1-sHA, pcDNA3.1-mHA and pcDNA3.1-cHA. The DNA vaccine can be used for preventing wild mammals, such as tiger influenza homologous virus and heterologous virus; the DNA vaccine of the invention has simple preparation method, low cost, good immunogenicity and cross protection, can meet the preparation requirement of mass influenza vaccines, has biological safety and can stimulate the immunity of organisms to various influenza viruses.

Description

Influenza A universal DNA vaccine and preparation method and application thereof

Technical Field

The invention relates to the fields of genetic engineering, microorganisms and biopharmaceuticals, in particular to a universal influenza A DNA vaccine and a preparation method and application thereof.

Background

Influenza viruses can cause infections in humans and animals, and influenza pandemics are disasters that cause great losses to human health and socioeconomic performance. It has the characteristics of short incubation period, rapid onset of disease, high propagation speed, more complications and the like. Over the past century, four influenza epidemics have occurred, with hundreds of millions of people infected and tens of millions of people lost life. Since 1918 Spanish influenza pandemic, England scientists isolated the first H1N1 influenza virus strain in 1933, which greatly accelerated human understanding of influenza virus, and influenza vaccine was first presented in 1940, which made it possible for humans to prevent and control influenza virus pandemics.

Influenza viruses are classified into three types, i (a), B (B) and C (C), according to antigenic differences between an inner Nucleoprotein (NP) and an outer matrix protein (M), wherein influenza a viruses are further classified into four types, i.e., Hemagglutinin (HA), Neuraminidase (NA), 17 subtypes, and 9 subtypes, which can be combined with each other into 153 serotypes of influenza a viruses. Vaccination is the best means of controlling influenza epidemics. The existing vaccine can play a good role in preventing the same subtype influenza virus infection, but is almost ineffective in the different subtype influenza virus infections. Influenza viruses have high variability and need to be renewed every year to effectively prevent a large outbreak of influenza, and the World Health Organization (WHO) predicts candidate strains of influenza vaccine in the next year according to big data analysis, and generally predicts 3-4 candidate strains, including an H1N1 subtype, an H3N2 subtype, and 1 or 2 lineages of influenza B, so as to prepare a trivalent or quadrivalent inactivated influenza vaccine. Success can be predicted to directly affect the protection efficiency of the current season vaccine. The time from the determination of candidate strains to the marketing of commercial vaccines is long, if prediction fails, the influenza pandemic in the season can be directly caused, and effective influenza vaccines cannot be rapidly prepared again. Therefore, the development of a high-efficiency universal influenza vaccine with broad-spectrum protective activity has important significance for preventing influenza epidemics.

The vaccine on the market at present has good clinical manifestations in the aspects of controlling diffusion and clearing influenza epidemic situation by combining with other prevention and control measures, and the vaccination is still one of the conservative measures for preventing and controlling influenza. There are negative effects and potential threats. To solve these problems, the use of novel influenza vaccines has been continuously and intensively explored and developed.

Disclosure of Invention

In order to solve the problem that the immune protection power generated by the existing influenza vaccine is short-term and narrow-spectrum, the invention provides the influenza A universal DNA vaccine consisting of 3 fusion proteins and a eukaryotic expression vector. The vaccine can protect multi-season multi-subtype influenza A vaccines, reduce infection and has very important significance for influenza prevention and control.

The invention provides an influenza A universal DNA vaccine, which comprises hemagglutinin fusion protein overexpression plasmids.

Further, the hemagglutinin gene is from an influenza virus H5N 1.

The HA gene sequence used as a control in the present invention is shown in SEQ ID NO. 4.

Further, one fusion protein of the present invention is sHA, which comprises all or part of the antigenic epitopes of HA, M2e, NP. Preferably, the sHA further comprises the melittin signal peptide and the transmembrane region fragment of the HA protein.

Further, the sequence of the sHA from N-terminus to C-terminus is: bee venom signal peptide + two sections of conserved NP sequence +5 XM 2e (from different subtypes and different species) + HA2, and the sequences are connected by a connecting peptide.

In a specific embodiment of the invention, the coding gene sequence of the fusion protein sHA is shown in SEQ ID NO. 1.

Further, a fusion protein of the invention is mHA, which includes all or part of the epitope of HA. Preferably mHA further includes the melittin signal peptide and the transmembrane domain segment of the HA protein.

Further, mHA the sequence from N-terminus to C-terminus is: bee venom signal peptide + 3 conserved sequences of HA (E14-H37 of HA 1+ N286-N319 of HA 1+ T41-S113 of HA 2) are connected with each other by a connecting peptide.

In a specific embodiment of the invention, the gene sequence of the fusion protein mHA is shown as SEQ ID NO. 2.

Further, one fusion protein of the invention is cHA, which includes all or part of the epitopes of HA, M2e, NP. Preferably, the cHA further comprises the melittin signal peptide and the transmembrane region fragment of the HA protein.

Further, the sequence of cHA from N-terminus to C-terminus is: bee venom signal peptide + conserved sequence between E14-H37 of HA 1+ 2 conserved sequence of NP +5 XM 2E (from different subtypes and different species) + two conserved sequences of HA (N286-N319 of HA 1+ T41-S113 of HA 2) + HA transmembrane region, and the sequences are connected by a connecting peptide.

In a specific embodiment of the invention, the coding gene sequence of the fusion protein cHA is shown in SEQ ID NO. 3.

Further, the plasmids include, but are not limited to, pcDNA, pTT3, pEFBOS, pBV, pJV, pBJ.

In a specific embodiment of the invention, the plasmid is pcDNA3.1.

The present invention provides a method for preparing the aforementioned vaccine, which comprises linking the hemagglutinin fusion protein-encoding gene to a plasmid.

Specifically, the preparation method comprises the following steps:

(1) obtaining fusion protein sHA, mHA and cHA coding genes by a gene synthesis method, carrying out multiple cloning site analysis on the genes of a pCDNA3.1(+) vector, and selecting two restriction enzymes which are provided on the vector but are not contained in a target fragment: EcoRI-HF and NotI-HF, and the linear form of the target gene fragment and the eukaryotic expression vector is obtained by endonuclease treatment;

(2) recovering the target fragment and the vector fragment, connecting, transforming and screening positive bacteria, extracting the plasmid and carrying out enzyme digestion identification;

(3) expressing the positive plasmid obtained in the step (2) to obtain the influenza A universal DNA vaccine.

Further, the sequence of the sHA coding gene is shown in SEQ ID NO.1, the sequence of the mHA coding gene is shown in SEQ ID NO.2, and the sequence of the cHA coding gene is shown in SEQ ID NO. 3.

The invention provides the application of the DNA vaccine in preparing the medicine for preventing or treating influenza A. Preferably, the influenza a comprises influenza a caused by a homologous H5N1 virus and heterologous H1N1 and H3N2 viruses.

The invention provides the application of the hemagglutinin in the preparation of the general DNA vaccine for influenza A, preferably, the influenza A comprises influenza A caused by homologous H5N1 virus and heterologous H1N1 and H3N2 viruses.

The invention provides the application of the hemagglutinin fusion protein in preparing the general DNA vaccine of influenza A, preferably, the influenza A comprises influenza A caused by homologous H5N1 virus and heterologous H1N1 and H3N2 viruses.

The invention provides application of the hemagglutinin fusion protein overexpression plasmid in preparing an influenza A universal DNA vaccine, preferably, the influenza A comprises influenza A caused by homologous H5N1 virus and heterologous H1N1 and H3N2 viruses.

In a particular embodiment of the invention, the homologous virus is H5N1 and the heterologous viruses include H1N1, H3N 2.

The DNA vaccine of the present invention may further comprise an adjuvant in addition to the hemagglutinin fusion protein overexpression plasmid.

Further, adjuvants useful in the present invention include MF59, AS02, Montani-de ISA251 and ISA2720, polyglycolide, (PLG) microparticles, immunostimulatory complexes (ISCOMs) and the lipids DC-Chol, CpG-ODN, monophosphoryl lipid A (MPLA), OM2174, heat labile enterotoxin (LT) and mutants thereof.

Compared with the prior art, the DNA vaccine has the beneficial effects that the DNA vaccine is used as a vaccine production mode, the gene for coding the target antigen can be directly inoculated in a human body, and the DNA vaccine is mixed with the adjuvant for inoculation to induce stronger cellular immunity and humoral immunity, so that the DNA vaccine has the advantages of simplicity in operation, high safety, lasting immune response, easiness in storage and transportation and the like. Mouse experiments prove that the vaccine has good immune and prevention effects on homologous and heterologous viruses.

Drawings

FIG. 1 shows a schematic diagram of the composition of the fusion proteins mHA, sHA and cHA of the present invention;

FIG. 2 shows a double restriction enzyme identification electrophoresis of the recombinant plasmid of the present invention, wherein A: pcDNA3.1-HA; b: pcDNA3.1-mHA; c: pcDNA3.1-cHA; d: pcDNA3.1-sHA;

FIG. 3 shows an indirect immunofluorescence map identifying expression of a fusion protein of the invention, A: a Mock group; b: pcDNA3.1-HA; c: pcDNA3.1-mHA; d: pcDNA3.1-cHA; e: pcDNA3.1-sHA;

FIG. 4 shows an immunoblot using Werstern Blot to identify fusion protein expression;

FIG. 5 shows a statistical plot of specific IgG antibody production, where A: H1N1 counteracting toxic substance; b: H3N2 counteracting toxic substance; c: H5N1 counteracting toxic substance; d: detecting IgG subtype;

fig. 6 shows the graph of the change in body weight and survival rate of mice after challenge experiment, where a: H1N1 body weight of the group with toxin challenge; b: H1N1 challenge group weight survival rate; c: H3N2 challenge group body weight; d: survival rate of H3N2 challenge group; e: H5N1 challenge group body weight; f: survival rate of H5N1 challenge group;

fig. 7 shows a statistical chart of cytokine secretion from splenic lymphocytes of mice after challenge, wherein a: IFN-gamma; b: IL-4;

figure 8 shows a histogram of pulmonary virus titers after challenge.

Detailed Description

In the following, the technical scheme of the present invention will be described in further detail with reference to the accompanying drawings and the detailed description, unless otherwise specified, and the technical means used in the examples are conventional means well known to those skilled in the art, and all the raw materials are commercially available.

H1N1 influenza mouse adapted strain A/Changchun/01/2009(H1N1, group1), H3N2 influenza mouse adapted strain A/baikaleal/Shanghai/SH-89/2013 (H3N2, group 2), H5N1 avian influenza virus A/meerkat/Shanghai/SH-1/2012(H5N1, clade 2.3.2.1; group1) were provided by military veterinary institute virology, military medical institute of military medical academy of military medical sciences.

EXAMPLE 13 preparation and characterization of recombinant plasmids

1. Material

The main reagents are as follows: coli XL10-Gold competent cells were prepared and stored in the laboratory, gene synthesis was provided by Jinzhi corporation, and technical services such as recombinant plasmid gene sequencing and primer synthesis were provided by Jinzhi corporation. Endonucleases were purchased from Thermo, antibiotics and the like from solibao, HA rabbit polyclonal antibody from beijing yiqiao shenzhou bio, M2 murine monoclonal antibody, NP murine monoclonal antibody from abcam.

2. Method of producing a composite material

2.1 extracting RNA from H5N1 virus, reverse transcribing to cDNA, PCR amplifying with primers of HAF and HA R of H5N1 and cDNA as template and amplification primers of HA segment of SEQ ID NO.9 and SEQ ID NO.10 (30 cycles of 94 ℃ C. for 5min, 94 ℃ C. for 30s, 55 ℃ C. for 30s, and 72 ℃ C. for 1 min) to obtain HA segment, and synthesizing gene to obtain gene segments of sHA, mHA, cHA, and the structure diagram of sHA, mHA, and cHA gene segments is shown in FIG. 1.

2.2 construction of recombinant plasmids

Cloning the obtained HA gene into pCDNA3.1(+) plasmid according to HindIII-HF and NotI-HF enzyme cutting sites, transforming into E.coli XL10-Gold competent cells, plating overnight for culture, screening positive bacteria, improving plasmid PCR, sequencing and enzyme cutting identification to obtain correct pCDNA3.1-HA plasmid. Then the mHA, cHA and sHA genes are cloned into pCDNA3.1(+) plasmid according to EcoRI-HF and NotI-HF enzyme cutting sites to obtain three recombinant plasmids of pcDNA3.1-mHA, pcDNA3.1-cHA and pcDNA3.1-sHA. SEQ ID NO.5 and SEQ ID NO.6 are PCR upstream and downstream primers for identifying the sHA segment; SEQ ID NO.7 and SEQ ID NO.8 are PCR upstream and downstream primers for identifying mHA and cHA fragments.

2.3 Mass expression and purification of recombinant plasmids

15 mul of the identified correct pcDNA3.1-HA, pcDNA3.1-mHA, pcDNA3.1-cHA and pcDNA3.1-sHA positive bacteria liquid were added to 5ml of LB liquid medium for ampicillin resistance and tetracycline resistance, and cultured overnight at 37 ℃ and 220 rpm/min. According to the following steps of 1: the inoculation amount of 500 is that 1ml of fresh bacterial liquid is added into each 500ml of LB liquid culture medium containing antibiotics, and the mixture is subjected to shake culture at 37 ℃ and 220rpm/min for 16-20 h. The plasmid extraction procedure is described in QIAGEN for the bulk extraction of endotoxin-free plasmids.

2.4 Indirect immunofluorescence assay

Transferring the positive 4 recombinant plasmid Lipofectamine 3000 transfection reagents into 293T cells, culturing for two days at 37 ℃, fixing for 15min at room temperature by using 4% paraformaldehyde, washing the cells by PBS, and mixing the HA antibody according to the ratio of 1: 250 dilution, after 4 hours of room temperature incubation at 4 ℃, using FITC labeled secondary antibody to express and identify cells by indirect immunofluorescence, finding that 293T cells infected by 4 recombinant plasmids have strong green fluorescence expression, which indicates that the 4 recombinant plasmids have the expression of corresponding proteins.

2.5Western blot validation

The recombinant plasmid is detected by 10% SDS polyacrylamide gel electrophoresis, and subjected to western blot identification. Blocking with a blocking solution at room temperature for 2h, and performing primary antibody treatment at 4 ℃ overnight with HA (1: 500) rabbit polyclonal antibody, NP (1: 1000) mouse monoclonal antibody and M2 (1: 1000) mouse monoclonal antibody respectively. The cells were incubated with the corresponding secondary antibody at room temperature for 2h and developed.

3. Results

The enzyme digestion identification result of the screened positive clone is shown in figure 2, and a large amount of expression is carried out after the identification is correct. The expression identification is carried out by using indirect immunofluorescence, and strong green fluorescence expression is found in 293T cells infected by the 3 recombinant plasmids, which indicates that the 3 recombinant plasmids have the expression of corresponding proteins. Westernblot verification is carried out by using HA rabbit polyclonal antibody as primary antibody, and found that pcDNA3.1-HA HAs a band about 70KD, pcDNA3.1-mHA HAs a band about 23KD, and pcDNA3.1-cHA and pcDNA3.1-sHA have bands about 50KD, which indicates that the protein expression of 4 recombinant plasmids is correct.

Example 2 influenza A Universal DNA vaccine Experimental immunization study

1. Material

HPR-labeled goat anti-mouse IgG, IgG1, IgG2a were purchased from Southern Biotechnology, mouse IFN-. gamma.and IL-4 ELISApot detection kits were purchased from Mabtech, and TMB was purchased from Sigma. BALB/c female mice, 6-8 weeks old, were purchased from Beijing Wittingle.

2. Method of producing a composite material

2.1 immunization and challenge

For the design of immune toxicity attack, 180 healthy female Balb/c mice are randomly divided into 6 immune groups, each group comprises 30 mice, the experimental groups are respectively immunized with pcDNA3.1-HA + adjuvant (CpG + MPLA), pcDNA3.1-mHA + adjuvant (CpG + MPLA), pcDNA3.1-cHA + adjuvant (CpG + MPLA), pcDNA3.1-sHA + adjuvant (CpG + MPLA), control group is immunized with pcDNA3.1 + adjuvant group (CpG + MPLA), and the blank group is PBS group. The total immunization is 3 times, and the two-side injection method of the tibialis anterior muscle of the hind leg of the mouse is adopted. Each mouse was injected with 100. mu.g/mouse, and the immunization was performed every three weeks, with primary immunization at 0 week and booster immunization at 3 and 6 weeks. Blood was collected from the retro-orbital plexus of mice at 3, 6 and 9 weeks after the first immunization, at least 10 of each group were collected, and serum was separated and stored at-80 ℃ for future use. The mice were anesthetized with isoflurane at week 9 and challenge experiments were performed with 10-fold MLD 50-homologous viruses (A/meerkat/Shanghai/SH-1/2012, H5N1, clade 2.3.2.1; group1) and 2 heterologous viruses (mouse-adapted A/Changchun/01/2009, H1N1, group1), (mouse-adapted A/basic acid/Shanghai/SH-89/2013, H3N2, group 2), respectively. The weight and survival rate of each mouse were recorded by weighing at the same time each day. All animal test conditions and procedures were in compliance with the ethical guidelines of the international society for pain research, and were approved by the national release military animal care and utility committee, and all experiments were conducted in the military veterinary institute biosafety tertiary laboratory (BSL-3).

2.2 specific IgG antibody detection

Collecting blood from orbit at 0 week, 3 weeks, 6 weeks and 9 weeks after immunization of mouse, standing the collected blood at room temperature for 2 hr, centrifuging at 3000rpm for 10min, separating upper layer serum, and storing at-80 deg.C;

the sera were tested for influenza virus specific IgG, IgG1 and IgG2a using ELISA assays. Viruses of inactivated H1N1 influenza mouse adapted strain A/Changchun/01/2009(H1N1, group1), H3N2 influenza mouse adapted strain A/baikalteal/Shanghai/SH-89/2013(H3N2, group 2), H5N1 avian influenza A/meerkat/Shanghai/SH-1/2012(H5N1, clade 2.3.2.1; group1) were coated in 96 well plates at 5. mu.g/ml overnight at 4 ℃, blocked with 5% skim milk at room temperature for 2H, and diluted serum samples were added to the 96 well plates and incubated at 37 ℃ for 1.5H. After washing with PBST, incubation with HRP-labeled goat anti-mouse IgG, IgG1 and IgG2a was performed at 37 ℃ for 1 hour, washing with PBST, TMB was added at 25 ℃ for 30 minutes, and 50. mu.l of 0.5M H was added₂SO₄The reaction was terminated. The results were measured with a spectrophotometer at 450 nm.

2.3 challenge protection experiment: the weight change and survival rate change of each group of mice are observed within 15 days after the challenge

2.4 detection of cytokines by ELISAPOT

Detection of virus-activated antigen-specific T cells induced by Virus-like particles Using ELISApot 96-well plates precoated with IL-4 and IFN- γ monoclonal antibodies, plated at 1 × 10 per well⁶Splenocytes isolated on day 4 post challenge, 3 mice per group, 6 replicate wells per mouse (3 of which are spiked, and 3 of which are control wells)) The stimulus is inactivated H5N1 virus-like particles with a final stimulus concentration of 10 μ g/ml, and is cultured in 1640 medium containing 10% FBS at 37 deg.C and 5% CO₂Culturing for 48h, discarding cells in the wells, performing enzyme-linked spot detection according to the steps of an ELISApot detection kit, and finally calculating a spot forming unit by using an ELISApot reading system.

2.5 viral titration of Lung

Lung homogenate was measured as 1:10, 1:10²，…10¹⁰Inoculating chick embryos after dilution, inoculating 3 SPF (specific pathogen free) grade chick embryos of 9 days old at each dilution, inoculating 100 mu l of each egg, sealing the egg with a non-setting adhesive, incubating at 37 ℃ for 48h, detecting the hemagglutination result of allantoic fluid after 48h, mixing 50 mu l of allantoic fluid and 50 mu l of 1% chick red blood cell suspension of each egg, observing and recording the result after 15min, and calculating the half infection amount EID50 of the chick embryo of the lung grinding fluid of each mouse by using a Reed-Muench method.

3. Results

3.1 immune response elicited by influenza A Universal DNA vaccine in mice

The serum levels of specific antibodies against homologous and heterologous viruses were measured in mice immunized at weeks 0, 3, 5, and 9, respectively. Homologous viruses (A/meerkat/Shanghai/SH-1/2012, H5N1, clade, 3 heterologous viruses (mouse-adapted A/Changchun/01/2009, H1N1, group1), (mouse-adapted dA/baikalte/Shanghai/SH-89/2013, H3N2, group 2) the results are shown in FIG. 5A B, C, the increase in the level of specific IgG antibodies in each group with the increase in the number of immunizations indicates the production of specific antibodies, as shown in FIG. 5A, the CpG antibody titers in the pcDNA3.1-cHA + CpG + MPLA group are up to 1: CpG antibody titer and 1: 8000 in the H1N1 antigen after triple immunization, as shown in FIG. 5B, the CpG antibody titers in the pcDNA3.1-cHA + MPL + MPLA group are still significantly increased compared to the CpG antibody titers in the H3N2 pcDNA3.1-sHA + MPLA group, the CpG antibody titers in the pcDNA 3.1-mMPL + MPLA group, the pcMPL 3.1-mMPL 3.26, the pcDNA3.1-mHA + CpG + MPLA group was shown to stimulate host cell production of high levels of specific IgG antibodies against H3N 2. As shown in FIG. 5C, the pcDNA3.1-cHA + CpG + MPLA and pcDNA3.1-sHA + CpG + MPLA groups stimulated host cells to produce high levels of specific IgG antibodies against H5N1 after triple immunization, as compared to the control pcDNA3.1-HA + CpG + MPLA group, against the H5N1 antigen. In the three challenge groups, the independent adjuvant group pcDNA3.1 + CpG + MPLA can generate certain immune response, but the adjuvant group only generates slight antibody level increase along with the increase of the immunization frequency, which indicates that the host cells generate high-level specific IgG antibodies mainly generated by the immunized DNA vaccine. Compared with the four constructed DNA vaccines, pcDNA3.1-cHA + CpG + MPLA can generate higher serum IgG antibody titer against one homologous virus and two heterologous viruses. At week 9, we calculated titer levels of IgG1 versus IgG2a for all immunization groups, and then compared. As shown in FIG. 5D, the titer of IgG2a was higher than that of IgG1 in all immunization groups against H5N1 antigen, indicating that the antibody for virus specific immune response is mainly IgG2 a.

3.2 challenge protection study of influenza A Universal DNA vaccine

The body weight change and survival rate change of the mice were observed 15 days after challenge, and the results are shown in fig. 6. In the homologous H5N1 challenge group, the Mock group and the adjuvant group all die within 14 days, the survival rate of the control group pCDNA3.1-HA + CpG + MPLA is 40%, the survival rate of the experimental group pcDNA3.1-mHA + CpG + MPLA is 20%, the survival rate of the pcDNA3.1-cHA + CpG + MPLA and the survival rate of the pcDNA3.1-sHA + CpG + MPLA are 80%; in the heterogenous H1N1 challenge group, the survival rate of the control group pCDNA3.1-HA + CpG + MPLA is 60%, the survival rate of the experimental group pcDNA3.1-mHA + CpG + MPLA is 60%, the survival rates of the pcDNA3.1-cHA + CpG + MPLA and the pcDNA3.1-sHA + CpG + MPLA are 80%, the Mock group and the adjuvant group are not alive, and compared with the H5N1 group, each immune group presents better protection efficiency and weight loss. The survival rate of a control group pCDNA3.1-HA + CpG + MPLA is 40%, the survival rate of an experimental group pcDNA3.1-mHA + CpG + MPLA is 80%, the survival rate of pcDNA3.1-cHA + CpG + MPLA is 60%, and the survival rate of pcDNA3.1-sHA + CpG + MPLA is 20%, wherein the weight loss of the pcDNA3.1-mHA + CpG + MPLA group is less than 15%, and the heterologous H3N2 virus is better protected. The results show that the pcDNA3.1-cHA + CpG + MPLA group and the pcDNA3.1-sHA + CpG + MPLA group have better cross-protection activity against homologous and heterologous influenza viruses.

3.3 influenza A Universal DNA vaccine activates specific T lymphocytes

Four days after challenge, splenic lymphocytes from mice were stimulated with inactivated H5N1 antigen. The results showed that each immune group showed high levels of IFN-. gamma.and IL-4 secretion compared to the control group, with pcDNA3.1-sHA + CpG + MPLA group being the most obvious. As shown in FIG. 7, the number of SFCs produced by mouse splenocytes IFN-gamma is significantly better than that produced by IL-4 group, and the above results indicate that 6 immune groups can induce the generation of antigen-specific cellular immunity, mainly Th1 type immune response.

3.4 influenza A Universal DNA vaccines inhibit replication of influenza viruses

And (3) taking the lungs of the mice of each group four days after the challenge, inoculating the lung grinding fluid into SPF (specific pathogen free) chick embryos of 9 days old, and performing virus titration determination on the influenza viruses after 48 hours. As shown in FIG. 8, in the H1N1 virus group, although there is no statistical difference, the virus titer decreased to a different extent in the experimental group compared with the control group pcDNA3.1-HA + CpG + MPLA, which is consistent with the challenge protection experiment result. In the H3N2 virus group, the virus titer of the pcDNA3.1-cHA + CpG + MPLA group is obviously reduced compared with that of the control group. In the H5N1 virus group, the virus titer of the pcDNA3.1-sHA + CpG + MPLA group is obviously reduced compared with that of the control group. It was shown that the experimental group was able to inhibit the replication of influenza virus in the lungs of mice compared to the control group.

When the adjuvant is combined, the pcDNA3.1-cHA and the pcDNA3.1-sHA can induce stronger humoral immunity and cellular immunity and generate higher immune protective activity against different subtype influenza viruses.

The above description is only an embodiment of the present invention, but the scope of the present invention is not limited thereto, and any changes or substitutions that are not thought of through the inventive work should be included in the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope defined by the claims.

Sequence listing

<110> military veterinary institute of military medical institute of military science institute of university in Henan, university

<120> influenza A universal DNA vaccine and preparation method and application thereof

<160>10

<170>SIPOSequenceListing 1.0

<210>1

<211>1400

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ccggaattca tgaaattcct ggtcaacgtg gctctggtgt tcatggtcgt ctacatctcc 60

tatatctacg ccgctgctgg tggtggtggt tccgacctga tcttcctggc ccgcagcgct 120

ctgattctgc gtggttccgt ggctcacaag tcctgtgctg ccgctcctgg tatcgctgac 180

atcgaggacc tgaccctgct ggctcgctcc atggtggtgg tgcgtcctgc tgccgcttcc 240

ctgctgactg aagtcgaaac ccccatccgt aacgagtggg gcagccgctc caatgattcc 300

tccgatgctg ctgctagcct cctgactgag gtggaaaccc ccattcgcaa cgagtggggt 360

tgccgctgca acggttcctc cgatgctgct gctagcctgc tgaccgaagt ggaaacccct 420

actcgtagcg aatgggagtc ccgcagctcc gactccagcg atgccgctgc tagcctgctg 480

accgaagtcg agacccccac ccgcaacggt tgggagtgca agtgttccga cagcagcgat 540

gctgccgctt ccctgctgac cgaggtcgaa accctgaccc gcaatggttg gggttgccgt 600

tgcagcgact cctccgacgc tgccgctggc tgtaacaaca acaacgctgc tgccggttgt 660

aataataata acgctgccgc cggctgcaac aataacaacg gtggcggcgg ctccggtctg 720

ttcggtgcca ttgctggttt catcgaaggc ggctggcagg gtatggtgga cggctggtac 780

ggctatcacc actccaacga gcagggttcc ggctacgccg ctgacaagga gtccacccag 840

aaagctatcg acggcgtcac caacaaggtc aactccatca ttgacaagat gaacactcaa 900

ttcgaagccg tcggccgcga gttcaacaac ctggagcgcc gtatcgagaa cctgaacaag 960

aagatggagg atggcttcct cgatgtctgg acttacaacg ccgagctgct ggtgctgatg 1020

gagaatggtc gcaccctgga cttccacgac agcaacgtga agaacctgta cgataaggtc 1080

cgcctgcagc tgaaggacaa cgccaaagag ctgggtaacg gctgcttcga gttttaccac 1140

aagtgcaata acgagtgcat ggagtccgtc cgcaacggca cctatgacta tccccagtac 1200

tccgaagagg cccgcctgaa gcgcgaggaa atcagcggcg tgaagctgga gagcatcggc 1260

atctaccaga ttctgagcat ttactccact gtcgcctcca gcctggtcct ggccatcatg 1320

atggccggtc tgtccctgtg gatgtgctcc aacggcagcc tgcagtgccg catctgcatc 1380

taagcggccg ctaaactatt 1400

<210>2

<211>791

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ccggaattca tgaagttttt agtgaacgtg gctttagtgt tcatggtggt gtacatctcc 60

tacatctacg ccgctgctgg tggtggtggt tccatgggtt cctcctcctc cggtctggtg 120

cctcgcggtt cccacatgga gcaagttgac accatcatgg agaagaacgt gaccgtgacc 180

cacgctcaag atattttaga gaagacccac ggctccgcca acagcagcat gcccttccac 240

aacatccacc ctttaaccat cggtgagtgc cccaagtacg tgaagagcaa caagctggtg 300

ctggccaccg gcctccgtaa tggttccgct ggctccgcca cccagaaggc tatcgacggt 360

gtgaccaaca aggtgaactc catcatcgac aagatgaaca cccagttcga ggctgtgggc 420

cgcgagttca acaatttaga gcgtcgcatc gagaatttaa acaagaagat ggaggacggc 480

ttcctcgacg tgtggaccta caacgccgag ctgctggtgc tgatggagaa cggccgcact 540

ttagacttcc acgactccca aggtaccggc tacatccccg aagctcctcg cgacggtcaa 600

gcctatgtgc gcaaggacgg cgagtgggtg ctgctgtcca cctttttagg cggtggtggc 660

agcattttaa gcatctacag cactgtggct agctctttag tcctcgctat tatgatggct 720

ggtttatctt tatggatgtg ctccaacggt tctttacagt gccgcatctg catctaagcg 780

gccgctataa a 791

<210>3

<211>1442

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ccggaattca tgaagttttt agtgaacgtg gctttagtgt tcatggtggt gtacatctcc 60

tacatctacg ccgctgctgg tggtggtggt tccatgggtt cctcctcctc cggtctggtg 120

cctcgcggtt cccacatgga gcaagttgac accatcatgg agaagaacgt gaccgtgacc 180

cacgctcaag atattttaga gaagacccac ggcggtggcg gttctttact gatcgacggc 240

accgcttctt tatcccccgg tatgatgatg ggcatgttca acatgctgtc caccgtttta 300

ggtgtgtcca ttttaaattt aggtcaagct gctgccgatt taatcttttt agctcgttcc 360

gctctgattt tacgcggttc cgtggctcac aagtcttgtg ctgctgctcc cggtatcgct 420

gacatcgagg atttaacttt actggctcgc tccatggtgg tggtgcgtcc cgctgctgct 480

tctttattga ccgaggtgga gacccccatt cgcaacgagt ggggttcccg cagcaacgac 540

tcttccgacg ctgctgcctctttattgacc gaagtggaga cccctatccg caacgaatgg 600

ggttgccgct gcaacggttc ttctgacgct gccgcttccc tcttaaccga agttgaaacc 660

cctacccgtt ccgagtggga gtcccgctct tccgattcct ccgatgctgc tgcttcttta 720

ttaaccgagg tcgagacccc cacccgcaac ggctgggagt gcaagtgttc cgattcttct 780

gatgccgctg cctctttatt aactgaagtg gaaactttaa cccgtaacgg ctggggctgt 840

cgttgctccg attccagcga cgccgccgcc aacagcagca tgcccttcca caacatccac 900

cctttaacca tcggtgagtg ccccaagtac gtgaagagca acaagctggt gctggccacc 960

ggcctccgta atggttccgc tggctccgcc acccagaagg ctatcgacgg tgtgaccaac 1020

aaggtgaact ccatcatcga caagatgaac acccagttcg aggctgtggg ccgcgagttc 1080

aacaatttag agcgtcgcat cgagaattta aacaagaaga tggaggacgg cttcctcgac 1140

gtgtggacct acaacgccga gctgctggtg ctgatggaga acggccgcac tttagacttc 1200

cacgactccc aaggtaccgg ctacatcccc gaagctcctc gcgacggtca agcctatgtg 1260

cgcaaggacg gcgagtgggt gctgctgtcc acctttttag gcggtggtgg cagcatttta 1320

agcatctaca gcactgtggc tagctcttta gtcctcgcta ttatgatggc tggtttatct 1380

ttatggatgt gctccaacgg ttctttacag tgccgcatct gcatctaagc ggccgctata 1440

aa 1442

<210>4

<211>1704

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atggagaaaa tagttcttct ctttacaaca atcagccttg tcaaaagcga tcatatttgc 60

attggttatc atgcaaataa ctcgacagag caggttgaca caataatgga gaagaacgtt 120

actgttacac atgcccaaga catactggaa aagacacaca acgggaagct ctgcgatcta 180

aatggagtga agcctctgat tttaaaagat tgtagtgtag caggatggct cctcggaaat 240

ccattgtgtg acgaattcac caatgtgcca gaatggtctt acatagtaga gaaggccaat 300

ccagccaatg acctctgtta cccagggaat ttcaacgatt atgaggaatt gaaacaccta 360

ttgagcagga taaaccattt tgagaaaata cagatcatcc ccaaagattc ttggtcagat 420

catgaagcct cattgggggt gagcgcggca tgttcatacc agggaaattc ctccttcttc 480

agaaatgtgg tgtggcttat caaaaaggac aatgcatacc caacaataaa gaaaggctac 540

aataatacca accgagaaga tctcttgata ctgtggggga tccaccatcc taatgatgag 600

gcagagcaga caaggctcta tcaaaaccca actacctata tttccattgg gacttcaaca 660

ctaaaccaga gattggtacc aaaaatagcc actagatcca aaataaacgg gcaaagtggc 720

aggatagatt tcttctggac aattttaaaa ccgaatgacg caatccattt cgagagcaat 780

ggaaatttca ttgctccaga atatgcatac aaaattgtca agaaaggaga ctccacaatc 840

atgagaagtg aagtggaata tggtaactgc aacaccaggt gtcagactcc aataggggcg 900

ataaactcta gcatgccatt ccacaacata caccctctca ctatcggaga atgtcccaaa 960

tatgtgaaat caaacaaatt agtccttgca actgggctca gaaatagtcc tcaaagagag 1020

agaagaagaa aaagaggact gtttggagct atagcaggtt ttatagaggg aggatggcag 1080

ggaatggtag atggttggta tgggtaccac cacagcaatg aacaggggag tggttacgct 1140

gcagacaaag aatctactca aaaggcgata gacggagtca ccaataaggt caattcgatc 1200

attgacaaaa tgaacactca gtttgaggct gtaggaaggg aatttaataa cttagagagg 1260

agaatagaaa atttaaacaa gaagatggaa gacggattcc tagatgtctg gacttataat 1320

gctgaacttc tggttctcat ggagaatggg agaactctag acttccatga ctcaaatgtc 1380

aagaaccttt acgataaggt ccgactacag cttaaggata atgcaaaaga gctgggaaac 1440

ggttgtttcg agttctatca caaatgtaat aatgaatgta tggaaagtgt aagaaacggg 1500

acgtatgact acccgcagta ttcagaagaa gcaagattaa aaagagagga aataagtgga 1560

gtaaaactgg aatcaatagg aatctaccaa atactgtcaa tttattcaac agtggcgagt 1620

tccctagtgc tggcaatcat gatggctggt ctatctttat ggatgtgttc caacgggtcg 1680

ttacagtgca gaatttgcat ttaa 1704

<210>5

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ccggaattca tgaaattcct ggtcaacgtg gctc 34

<210>6

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

aaatatgcgg ccgcttagat gcagatgcgg cactgcagg 39

<210>7

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

cgcggatcca tgaagttttt agtcaacgtc gctc 34

<210>8

<211>57

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

aaatatgcgg ccgcttagtg atgatggtgg tgatggatgc agatgcggca ctgtaaa 57

<210>9

<211>34

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cccaagctta tggagaaaat agttcttctc ttta 34

<210>10

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

aaatatgcgg ccgcttaaat gcaaattctg cactgtaac 39

Claims (10)

1. A universal influenza A DNA vaccine comprising a hemagglutinin fusion protein overexpression plasmid.

2. The vaccine of claim 1, wherein the hemagglutinin fusion protein-encoding gene sequence is selected from the group consisting of SEQ ID No. 1-3.

3. The vaccine of claim 1, wherein the plasmid comprises pcDNA, pTT3, pEFBOS, pBV, pJV, pBJ.

4. The vaccine of claim 3, wherein the plasmid is pcDNA3.1.

5. The method of producing the vaccine of any one of claims 1-4, wherein the method comprises ligating a hemagglutinin fusion protein-encoding gene to a plasmid.

6. Use of hemagglutinin in the preparation of a universal DNA vaccine for influenza a, preferably influenza a comprising a homologous H5N1 virus and heterologous H1N1 and H3N2 viruses.

7. Use of the hemagglutinin fusion protein of any one of claims 1 to 4, for the preparation of a universal DNA vaccine for influenza A, preferably, said influenza A comprises influenza A caused by the homologous H5N1 virus and the heterologous H1N1 and H3N2 viruses.

8. Use of the hemagglutinin fusion protein overexpression plasmid of any one of claims 1 to 4, for the preparation of a universal DNA vaccine for influenza A, preferably, influenza A comprising influenza A caused by the homologous H5N1 virus and the heterologous H1N1 and H3N2 viruses.

9. Use of a vaccine according to any one of claims 1 to 4 in the manufacture of a medicament for the prophylaxis or treatment of influenza a.

10. The use according to claim 9, wherein the influenza a comprises influenza a caused by a homologous H5N1 virus and heterologous H1N1 and H3N2 viruses.

Images