CN115838733A

CN115838733A - Specific site on rabbit alpha-S1 casein gene seat and application thereof

Info

Publication number: CN115838733A
Application number: CN202211378122.5A
Authority: CN
Inventors: 陈海楠; 何太平; 李金铃
Original assignee: Chengdu Biaojing Biotechnology Co ltd
Current assignee: Chengdu Biaojing Biotechnology Co ltd
Priority date: 2022-11-04
Filing date: 2022-11-04
Publication date: 2023-03-24

Abstract

The invention provides two specific sites allowing exogenous genes to be integrated and inserted in a first intron and a second intron of a rabbit mammary gland alpha-S1 casein gene. The site or the region allows the inserted exogenous gene to be directly regulated and controlled by an alpha-S1 casein gene endogenous promoter, so that high-efficiency expression in rabbit mammary gland cells is realized, and the alpha-S1 casein gene of the rabbit can be normally transcribed and expressed, so that the original function of the alpha-S1 casein gene is reserved. The invention effectively solves a series of problems of low foreign gene expression efficiency, uncertain insertion position, unstable heredity, gene silence and the like caused by random insertion in the traditional transgenic technology, ensures that the fixed-point integration of the foreign gene of the rabbit mammary gland gene becomes reliable and safe, lays a foundation for the further development and industrialization of the rabbit mammary gland bioreactor, and has important significance for promoting the bio-pharmaceuticals based on the mammary gland bioreactor.

Description

Specific site on rabbit alpha-S1 casein gene seat and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to a specific site on a rabbit alpha-S1 casein gene locus and application thereof.

Background

Animal mammary gland bioreactor is the generic term for transgenic mammals capable of expressing and secreting recombinant proteins from the mammary gland. The basic principle is that the gene engineering technology is adopted to integrate the exogenous gene of the coding protein into the genome of animal cells, and the specific expression and secretion of the exogenous gene in mammary epithelial cells are guided by utilizing the regulation and control element of the specific promoter of the mammary gland of the animal, and then the recombinant protein is separated and purified from the milk. The animal mammary gland bioreactor is a new biological pharmacy method, and compared with the traditional gene engineering cell reactor, the animal mammary gland bioreactor has the advantages of high benefit, low cost, high yield, high quality, environmental protection and the like. The research on animal mammary gland bioreactors has progressed considerably in the past decades, but its industrialization and commercialization have been relatively delayed. To date, only three animal mammary gland bioreactor-produced drugs are on the market, including those produced from goat milk

And produced from rabbit milk->

And &>

The success of animal mammary gland bioreactor depends on whether the exogenous gene can be expressed in mammary gland epithelial cell of transgenic animal efficiently and stably. In the past, in mammary gland bioreactors, random integration was generally used to integrate foreign genes into the host animal genome. The method for producing the transgenic animal has low efficiency and complex process, the integration position of the exogenous gene is unpredictable, so the expression quantity of the transgenic recombinant protein is unstable, the genetic stability is poor, a large amount of screening is needed, generally, a long time is needed to obtain strain animals, and meanwhile, the continuous expression of the target recombinant protein is lost because the epigenetic modification is easy to generate the silencing of the transgene. Therefore, in order to solve these problems, a site-specific gene editing technique can be used to precisely integrate the exogenous gene into the mammary gland-specific gene site, and the endogenous promoter of milk protein is used to directly drive the exogenous gene, thereby realizing the efficient and stable expression of the exogenous gene.

In recent years, with the development of gene editing techniques, such as Zinc Finger Nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), sgRNA-guided CRISPR/Cas9 nucleases, and site-specific recombination techniques, such as Cre, FLP recombinase, targat-integrase, transposon-transposase system, the site-specific knock-in of foreign genes has become relatively simple and efficient, and has been successful in experiments of multiple species. These techniques can also be used to insert exogenous genes directly and accurately into mammary gland-specific genomes for the construction of animal mammary gland bioreactors. However, it is a problem to be solved to select a specific mammary gland gene and select a gene region as a knock-in site of a foreign gene, because the protein expression levels of different mammary gland genes are different and some milk proteins have important physiological functions, the selection of foreign gene knock-in at different sites or regions of different milk protein genes and genes can not only cause differences in the expression efficiency of the foreign gene, but also affect the function and stability of the host genome.

Casein is the major protein produced and secreted by the mammary glands of female mammals and includes α -S1 casein, α -S2 casein, β casein and κ casein. Each casein gene is a completely independent expression unit and is controlled by a respective specific promoter sequence. According to the known gene sequencing result, the total length of the rabbit alpha-S1 casein gene is about 7.8kb, the rabbit alpha-S1 casein gene contains 10 exons accounting for 487bp, and the rabbit alpha-S1 casein gene has the size of 21-165 bp; and 9 introns account for 7317bp, and the lengths are respectively between 82 and 1719 bp. The important regulatory elements of the promoter of the rabbit α -S1 casein gene are located in the-400 to-10 bp region upstream of the first exon. The initial 12bp of the first and second exons of 49bp are 5' -untranslated regions, and the second exon of the subsequent 51bp sequence encodes the signal peptide and the first 2 amino acids of mature alpha-S1 casein. The stop codon is the last triplet codon of exon 10. The 3' untranslated region immediately downstream of this stop codon contains the polyA stop signal gene sequence. In addition, the third to 10 th exons of the rabbit α -S1 casein gene are all multiples of three base pairs, and thus the triplet codon encoding α -S1 casein is not affected by mRNA splicing.

Previous transgenic experiments have proved that the promoter of bovine alpha-S1 casein can efficiently guide the high-level expression of exogenous genes in animal mammary gland, so the promoter is often used for preparing expression vectors for generating randomly integrated animal mammary gland bioreactors, such as transgenic dairy goats capable of producing recombinant human antithrombin III. In rabbit milk, the content of alpha-S1 casein can be as high as 28g/L, and the expression level is the second highest milk protein. Therefore, if a foreign gene is integrated into the α -S1 casein genome, for example, into the first intron, the foreign gene can be directly regulated by the endogenous promoter of the α -S1 casein gene, and the expression of the foreign gene can be stabilized as efficiently as α -S1 casein. On the other hand, the alpha-casein gene knockout experiment of the mouse proves that the alpha-casein can regulate mRNA transcription and protein expression of other casein, and the deletion of the alpha-casein can influence the development of a baby mouse. Therefore, in order to avoid interfering with the normal physiological functions of the female rabbit without affecting the transcription splicing and protein expression of the casein gene, it is necessary to consider that when the exogenous gene is integrated into the intron region of the rabbit α -S1 casein gene locus, some regulatory element sequences are jointly used, so that the α -S1 casein gene can be normally transcribed and translated, the original functions of the rabbit α -S1 casein gene are retained to the maximum extent, and the normal operation of the rabbit mammary gland bioreactor is realized.

Therefore, how to properly select the site suitable for the integration of the exogenous gene on the rabbit alpha-S1 casein gene locus and reasonably design the exogenous gene homologous recombination vector can effectively realize the integration of the exogenous gene on the rabbit alpha-S1 casein gene locus and simultaneously keep the original functions of the rabbit alpha-S1 casein gene, and is an important link for preparing and developing a rabbit mammary gland bioreactor based on the alpha-S1 casein gene.

Disclosure of Invention

The invention aims to provide a site suitable for exogenous gene integration in a rabbit alpha-S1 casein gene locus and a method for integrating exogenous genes in a rabbit alpha-S1 casein genome at fixed points, so as to greatly improve the high-efficiency expression of the exogenous genes in rabbit mammary glands, thereby improving the success rate and the safety and the reliability of a mammary gland bioreactor.

The invention provides a specific locus on a rabbit alpha-S1 casein locus, which is characterized in that the specific locus is positioned in a first intron and a second intron of the rabbit alpha-S1 casein locus, in particular a 79920635-79920664bp region and a 79920325-79920365bp region on a rabbit chromosome 15.

The invention also provides the application of the specific site as the rabbit alpha-S1 casein gene editing site.

The invention also provides an sgRNA for assisting in identifying the specific site, which is characterized in that the sgRNA targets a 79920635-79920664bp region and a 79920325-79920365bp region on the rabbit chromosome 15.

Furthermore, the sgRNA is a combination of any one of sgRNAs with sequences shown in SEQ ID No. 1-3 and any one of sgRNAs with sequences shown in SEQ ID No. 4-6.

Further, the sgRNA described above is a combination of the sgRNA having a sequence shown in SEQ ID No.1 and the sgRNA having a sequence shown in SEQ ID No. 4.

The invention also provides a gene editing system comprising reagents for identifying, aiding in the identification and/or cleavage of the specific sites described above.

Further, the above reagent comprises Cas9 protein, or a plasmid expressing Cas9 protein, or a virus expressing Cas9 protein.

Further, the reagent also comprises sgRNA, or a plasmid expressing the sgRNA, or a virus expressing the sgRNA; the sgRNA according to any one of claims 3 to 5.

The invention also provides a homologous recombination vector, which comprises a gene box formed by connecting the following fragments in sequence: a homologous left arm, an RNA splicing acceptor sequence, a signal peptide sequence, a target gene segment, a self-splicing peptide sequence, a rabbit alpha-S1 casein gene second exon encoding protein sequence, an RNA splicing donor sequence and a homologous right arm.

Further, the homologous recombinant vector is ssODN; the sequence of the homologous left arm is shown as SEQ ID NO. 7; the sequence of the RNA shearing receptor is shown as SEQ ID NO. 8; the sequence of the signal peptide is shown as SEQ ID NO. 9; the self-cutting peptide sequence is shown in SEQ ID NO. 10; the sequence of a second exon coding protein of the rabbit alpha-S1 casein gene is shown in SEQ ID NO. 11; the RNA shearing donor sequence is shown as SEQ ID NO. 12; the homologous right arm sequence is shown in SEQ ID NO. 13.

Further, the above-mentioned target gene fragment is a sequence encoding a human LL-37 polypeptide.

Furthermore, the sequence of the human LL-37 polypeptide is shown as SEQ ID NO. 14.

Furthermore, the sequence of the homologous recombination vector is shown as SEQ ID NO. 15.

The invention also provides a method for integrating the target gene into the rabbit alpha-S1 casein genome without influencing the normal transcription expression of the rabbit alpha-S1 casein gene, which inserts the target gene into the site.

Further, the method comprises the step of co-transfecting the gene editing system and the homologous recombinant vector into a fertilized rabbit egg cell.

The invention also provides a transgenic rabbit cell, which is the rabbit cell prepared by the method.

The invention has the beneficial effects that: the invention provides specific sites and regions suitable for integration and insertion of foreign genes in a first intron and a second intron of a rabbit mammary gland alpha-S1 casein gene. The site or the region allows the inserted exogenous gene to be directly regulated and controlled by an alpha-S1 casein gene endogenous promoter, so that high-efficiency stable expression in rabbit mammary gland cells is realized, and the original functions of the rabbit alpha-S1 casein gene are retained. The invention effectively solves a series of problems of low foreign gene expression efficiency, uncertain insertion position, unstable heredity, gene silence and the like caused by random insertion in the traditional transgenic technology, ensures that the fixed-point integration of the foreign gene of the rabbit mammary gland gene becomes reliable and safe, lays a foundation for the further development and industrialization of the rabbit mammary gland bioreactor, and has important significance for promoting the bio-pharmaceuticals based on the mammary gland bioreactor.

The terms of the invention are explained: "Gene cassette": gene cassette, refers to the ordered arrangement of individual functional DNA fragments or sequences during the construction of a gene expression assembly (e.g., a plasmid).

Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.

The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.

Drawings

FIG. 1 is a schematic diagram showing the relative positions of the

gene sites

1 and 2 suitable for the integration and insertion of foreign genes in the rabbit alpha-S1 casein gene, and the sequence and position of sgRNA targeting the region of the gene sites.

Fig. 2 is an electrophoresis chart for evaluating the efficiency of cleaving target DNA by different sgrnas in the present invention.

FIG. 3 is a schematic diagram of the gene flow of human LL-37 transgenic site-specific knock-in rabbit α -S1 casein.

FIG. 4 shows the PCR validation result of the site-specific knock-in rabbit α -S1 casein gene for the human LL-37 transgene.

Detailed Description

The experimental procedures used in the following examples are all conventional ones unless otherwise specified. The materials, reagents and the like used in the examples were obtained from commercial sources unless otherwise specified.

New Zealand female rabbits at 12-16 weeks were euthanized 16-20 hours after superovulation and successful mating, and euthanized under Euthasol (150 mg/kg) anesthesia. Separating oviduct and partial uterus of female rabbit, collecting fertilized egg from the oviduct, and culturing with M199 culture solution (containing 3% of FBS,5mM HEPES,5mM NaHCO) ₃ ) After washing, the cells were incubated in a medium maintained at 38.5 ℃ until microinjection.

Example 1 CRISPR/Cas9 Gene editing System targeting specific sites of the invention

The 6 sgrnas targeting the integration site 1 of the foreign gene in the first intron region and the integration site 2 of the foreign gene in the second intron region of the rabbit α -S1 casein gene were synthesized directly from GenScript, with the sequences shown in table 1, and the relative positions of the

integration sites

1 and 2 of the foreign genes in the rabbit α -S1 casein gene are shown in fig. 1. Wherein, the site 1 is positioned in the 79,920, 635-79, 920,664bp region (sgRNA 1-3 targeted region) on the rabbit No.15 chromosome, and the site 2 is positioned in the 79,920, 325-79, 920,365bp region (sgRNA 4-6 targeted region). (ENSOCUG 00000009486.4, based on the rabbit genomic sequence information version number OryCun2.0 (GCA _ 000003625.1)).

TABLE 1

Numbering

Sequence ID

Tag name of sgRNA

Target area

Targeting DNA strands

sgRNA sequence

PAM

sgRNA1

SEQ ID No.1

CSN1S1-ex2-5g1

A first intron

Positive chain

UUAUUAUCGCUCUACAACAC

AGG

SgRNA2

SEQ ID No.2

CSN1S1-ex2-5g2

A first intron

Negative chain

AGCGAUAAUAAGUCACAACU

TGG

SgRNA3

SEQ ID No.3

CSN1S1-ex2-5g3

A first intron

Negative chain

GCGAUAAUAAGUCACAACUU

GGG

SgRNA4

SEQ ID No.4

CSN1S1-ex2-3g1

Second intron

Negative chain

UUGAAGCUAAGGGUUUCAAU

GGG

SgRNA5

SEQ ID No.5

CSN1S1-ex2-3g2

Second intron

Negative chain

GGGCCAAAUAGUGCUGAAAA

CGG

SgRNA6

SEQ ID No.6

CSN1S1-ex2-3g3

Second intron

Negative chain

GGCCAAAUAGUGCUGAAAAC

GGG

Each sgRNA was dissolved in 20. Mu.l of mitE (0.1 XTE) buffer at a final concentration of 55 ng/. Mu.l each and stored at-20 ℃. Cas9 enzyme was purchased from GenScript (Z03389-50, 1mg/mL) in 2. Mu.l/vial and stored at-20 ℃. Diluted at the time of use, 6 sgrnas were mixed with Cas9 enzyme at 1:1 weight ratio of the Cas9/sgRNA to prepare a Ribonucleoprotein (RNP) mixed solution.

Cas9/sgRNA RNP mixed liquor is respectively numbered as Cas9/sgRNA-1, cas9/sgRNA-2, cas9/sgRNA-3, cas9/sgRNA-4, cas9/sgRNA-5 and Cas9/sgRNA-6 according to the sequence ID of the sgRNA.

Example 2 integration of the ssODN homologous recombination vector within the rabbit α -S1 casein gene the exogenous gene ssODN was synthesized directly from GenScript and its sequence was composed: consisting of, in order from the 5 '-end to the 3' -end, a homologous left arm (5 '-arm), an RNA cleavage acceptor Sequence (SA), a signal peptide sequence, a human LL-37 polypeptide gene sequence, a self-cleavage peptide 2A sequence, a protein coding sequence for the second exon of the alpha-S1 casein gene, an RNA donor Sequence (SD), and a homologous right arm (3' -arm) sequence, respectively. The specific sequences of the components are as follows:

homologous left arm sequence (SEQ ID NO. 7):

CAAGTGGGTAGCAAAACCCAAGTTATTGAGCCACCTCTTGTTGCCTTCACAGGTAGGAAGCTGGATCAGAAGCAGAGTAGCTGGGTCTTAAACCAGGCACTCCAATATGGGATAAAGGTGTCCCAAGTTGTGACTTATTATCGCTCTACAA

RNA cleavage receptor sequence (SEQ ID NO. 8):

ACTTCTTTACTTTTTTACGGTGAAGTGCAAGCATTTTTACTGCATTATCTTGGATGTCTTTTAAAGGAACACTAGCCCTACTCAAGTAAAAACATTGACCTGATTGACTAATTGATTGACTGATTAATTCCCTTGTCTCTCCATTCACAG

signal peptide sequence (SEQ ID No. 9):

Atgaaggtgctgatcctcgcctgcctggttgcgctcgctttggcc

self-cleaving peptide sequence (SEQ ID NO. 10):

GAGGGCAGGGGAAGTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCC

rabbit α -S1 casein gene second exon encoding protein sequence (SEQ ID No. 11): ATGAAGCTTCTCATCCTCACTTGCCTTGGCATCTTGGCTACTGCTGCTCTTGCCAGGCAT

RNA cleavage donor sequence (SEQ ID NO. 12):

GTATGTGCAAAAGAAAGTTCTCAATAACGAAAATACAGGAACTATGTACCCGCTTACAAACCACATCGCCAACAGTAGCATACAAGCAACGGAGGTTTTCTGTAGAACTTGCTTGGTTTCCATGAAAGTCAATTATGTTCAACCATTGTC

homologous right arm sequence (SEQ ID NO. 13):

GAAACCCTTAGCTTCAAGGAAAATGTTTGACCTGAAATACAAGAATTACTCACACATACACACACACACACACACACATAAATTTAAAAGTAAGCAAAAAAACAAGAAATGAGATATTGC

human LL-37 polypeptide gene sequence (SEQ ID NO. 14):

ctgctgggcgacttcttcagaaagagcaaggagaagatcggcaaggagttcaagagaatcgtgcagagaatcaaggacttcctgagaaacctggtgcccagaaccgagagc

the specific sequence of ssODN is (SEQ ID No. 15):

CAAGTGGGTAGCAAAACCCAAGTTATTGAGCCACCTCTTGTTGCCTTCACAGGTAGGAAGCTGGATCAGAAGCAGAGTAGCTGGGTCTTAAACCAGGCACTCCAATATGGGATAAAGGTGTCCCAAGTTGTGACTTATTATCGCTCTACAAACTTCTTTACTTTTTTACGGTGAAGTGCAAGCATTTTTACTGCATTATCTTGGATGTCTTTTAAAGGAACACTAGCCCTACTCAAGTAAAAACATTGACCTGATTGACTAATTGATTGACTGATTAATTCCCTTGTCTCTCCATTCACAGATGAAGGTGCTGATCCTCGCCTGCCTGGTTGCGCTCGCTTTGGCCCTGCTGGGCGACTTCTTCAGAAAGAGCAAGGAGAAGATCGGCAAGGAGTTCAAGAGAATCGTGCAGAGAATCAAGGACTTCCTGAGAAACCTGGTGCCCAGAACCGAGAGCGAGGGCAGGGGAAGTCTTCTAACATGCGGGGACGTGGAGGAAAATCCCGGCCCCATGAAGCTTCTCATCCTCACTTGCCTTGTGGCTACTGCTCTTGCCAGGCATGTATGTGCAAAAGAAAGTTCTCAATAACGAAAATACAGGAACTATGTACCCGCTTACAAACCACATCGCCAACAGTAGCATACAAGCAACGGAGGTTTTCTGTAGAACTTGCTTGGTTTCCATGAAAGTCAATTATGTTCAACCATTGTCGAAACCCTTAGCTTCAAGGAAAATGTTTGACCTGAAATACAAGAATTACTCACACATACACACACACACACACACACATAAATTTAAAAGTAAGCAAAAAAACAAGAAATGAGATATTGC

the synthesized ssODN was coded with a 1:1 mass ratio with the RNP complex of Cas9/sgRNA-1 and Cas9/sgRNA-4 of example 1, followed by microinjection into rabbit zygotes and in vitro culture to morula or blastocyst stage. Then, the embryos were placed in 10. Mu.l NP40 LYSIS buffer, incubated at 55 ℃ for 0.5-1 hour, incubated at 95 ℃ for 10 minutes, and then maintained at 4 ℃.

The following experimental examples prove the beneficial effects of the invention:

example 1 in vitro validation of the biological Activity of different sequence sgRNAs to cleave target DNA sequences

1. Experimental methods

Microinjection of rabbit fertilized eggs: fertilized eggs were injected with Ribonucleoprotein (RNP) mixtures of Cas9/sgRNA of different sgRNA sequences (Cas 9/sgRNA-1, cas9/sgRNA-2, cas9/sgRNA-3, cas9/sgRNA-4, cas9/sgRNA-5, cas 9/sgRNA-6) prepared in example 1, respectively, and cultured in vitro to morula or blastocyst stage. For each sgRNA to be validated, 5-10 morula or blastocyst stage embryos were collected, placed into 10. Mu.l of NP40 LYSIS buffer, incubated at 55 ℃ for 0.5-1 hour, incubated at 95 ℃ for 10 minutes, and then maintained at 4 ℃. The solution contains DNA of rabbit fertilized eggs, and can be used as a PCR template to carry out PCR reaction to detect the cutting condition of a target DNA sequence after the action of Cas 9/sgRNA. The reaction conditions for PCR amplification of the target sequence are as follows: the process comprises the steps of starting at 95 ℃ for 5min, then performing 35 cycles, wherein each cycle comprises denaturation at 95 ℃ for 45s, renaturation at 60 ℃ for 45s, and extension at 72 ℃ for 1min, and finally extension at 72 ℃ for 8min. The sequence of the upstream primer of the PCR reaction is as follows: 5 'AGCCCATTTGGGGTCAAATTA-3'; the downstream primer sequence is 5. After amplification, the PCR product was visualized by 0.8% agarose electrophoresis.

2. Results of the experiment

As shown in fig. 3. It can be seen that the 6 sgRNA sequences are all capable of effectively cleaving the target gene with cleavage efficiencies of sgRNA-1, sgRNA-2, 70%, sgRNA-3, 62%, sgRNA-4, 66%, sgRNA-5: 14 percent. Wherein the cleavage activity of sgRNA1 and sgRNA4 is relatively higher, therefore, it is preferable that the combination of sgRNA1 and sgRNA4 is used in a rabbit α -casein gene editing reagent.

Experimental example 2 in vitro validation of integration of the ssODN homologous recombination vector in the rabbit α -S1 casein gene

1. Experimental methods

The solutions of embryos nos. 1 to 12 prepared in example 2, which contained embryonic DNA as PCR template, were subjected to PCR reaction to determine whether ssODN could integrate into the specific site of the α -S1 casein gene. The reaction conditions for PCR amplification of the target sequence are as follows: the process comprises the steps of starting at 95 ℃ for 5min, then performing 35 cycles, wherein each cycle comprises denaturation at 95 ℃ for 45s, renaturation at 60 ℃ for 45s, and extension at 72 ℃ for 1min, and finally extension at 72 ℃ for 8min. The upstream primer sequence of the PCR reaction is 5 'CAGTCCAGGTCTCCCAAGTG-3'; the sequence of the downstream primer is 5-.

2. Results of the experiment

As shown in FIG. 4, in 12 embryos injected with the mixture of Cas9/sgRNA-1, cas9/sgRNA-4 and ssODN, 3 embryos (embryos numbered 7, 8 and 9) of DNA amplified a fragment of about 1kb, demonstrating homologous recombination of the recombinant vector gene at the target gene site. If no recombination occurs, this fragment cannot be amplified, and the target gene either remains wild-type or is knocked out. This PCR identification across homology arms demonstrated that the sequence-specific sgRNA-guided CRISPR-Cas9 had accurately integrated the exogenous gene contained in ssODN into the rabbit α -S1 casein gene.

In conclusion, the invention provides a specific site and a specific region which are suitable for the integration and insertion of a foreign gene on a rabbit mammary gland alpha-S1 casein gene. The site or the region allows the inserted exogenous gene to be directly regulated and controlled by an alpha-S1 casein gene endogenous promoter, so that high-efficiency stable expression in rabbit mammary gland cells is realized, and the original functions of the rabbit alpha-S1 casein gene are kept. The invention effectively solves a series of problems of low foreign gene expression efficiency, uncertain insertion position, unstable heredity, gene silence and the like caused by random insertion in the traditional transgenic technology, ensures that the fixed-point integration of the foreign gene of the rabbit mammary gland gene becomes reliable and safe, lays a foundation for the further development and industrialization of the rabbit mammary gland bioreactor, and has important significance for promoting the bio-pharmaceuticals based on the mammary gland bioreactor.

Claims

1. Specific sites on the rabbit α -S1 casein locus, characterized in that said specific sites are located within the first and second introns of the rabbit α -S1 casein locus, in particular within the 79920635-79920664bp and 79920325-79920365bp regions on the rabbit chromosome 15.

2. Use of the specific site of claim 1 as a rabbit α -S1 casein gene editing site.

3. An sgRNA that assists in identifying the specific site of claim 1, which is a sgRNA that targets the 79920635-79920664bp and 79920325-79920365bp regions on rabbit chromosome 15.

4. The sgRNA of claim 3, which is a combination of any one of the sgRNAs having sequences shown in SEQ ID nos. 1 to 3 and any one of the sgRNAs having sequences shown in SEQ ID nos. 4 to 6.

5. The sgRNA of claim 4, which is a combination of a sgRNA having the sequence shown in SEQ ID No.1 and a sgRNA having the sequence shown in SEQ ID No. 4.

6. A gene editing system comprising an agent that recognizes, aids in the recognition and/or cleavage of the specific site of claim 1.

7. The system of claim 6, wherein the agent comprises a Cas9 protein, or a plasmid expressing a Cas9 protein, or a virus expressing a Cas9 protein.

8. The system of claim 7, wherein the reagents further comprise sgrnas, or plasmids expressing sgrnas, or viruses expressing sgrnas; the sgRNA is the sgRNA according to any one of claims 3 to 5.

9. A homologous recombinant vector, which is characterized by comprising a gene cassette formed by connecting the following fragments in sequence: a homologous left arm, an RNA shearing acceptor sequence, a signal peptide sequence, a target gene segment, a self-shearing peptide sequence, a rabbit alpha-S1 casein gene second exon encoding protein sequence, an RNA shearing donor sequence and a homologous right arm.

10. The homologous recombination vector of claim 9, wherein said homologous recombination vector is ssODN; the sequence of the homologous left arm is shown as SEQ ID NO. 7; the sequence of the RNA shearing receptor is shown as SEQ ID NO. 8; the sequence of the signal peptide is shown as SEQ ID NO. 9; the self-cutting peptide sequence is shown in SEQ ID NO. 10; the sequence of the second exon coding protein of the rabbit alpha-S1 casein gene is shown in SEQ ID NO. 11; the RNA shearing donor sequence is shown as SEQ ID NO. 12; the homologous right arm sequence is shown in SEQ ID NO. 13.

11. The homologous recombinant vector of claim 9 or 10, wherein said gene segment of interest is a sequence encoding a human LL-37 polypeptide.

12. The homologous recombination vector of claim 11, wherein the sequence encoding human LL-37 polypeptide is the sequence of SEQ ID No. 14.

13. The homologous recombinant vector according to claim 12, wherein the sequence is as shown in SEQ ID No. 15.

14. A method for integrating a target gene into a rabbit α -S1 casein genome without affecting normal transcriptional expression of the rabbit α -S1 casein gene, comprising inserting the target gene into the site of claim 1.

15. The method according to claim 14, comprising the step of co-transfecting the gene editing system of any one of claims 6 to 8 and the homologous recombinant vector of any one of claims 9 to 13 into a fertilized rabbit egg cell.

16. A transgenic rabbit cell produced according to the method of claim 14 or 15.