CN117402879A

CN117402879A - Construction method of SUV39H1 gene conditional knockout mouse

Info

Publication number: CN117402879A
Application number: CN202311564613.3A
Authority: CN
Inventors: 王伟财; 周晨; 李若雨; 任剑寒
Original assignee: ORAL SUBSIDIARY SUN YAT-SEN UNIVERSITY HOSPITAL
Current assignee: ORAL SUBSIDIARY SUN YAT-SEN UNIVERSITY HOSPITAL
Priority date: 2023-11-22
Filing date: 2023-11-22
Publication date: 2024-01-16

Abstract

The invention discloses a construction method of an SUV39H1 gene conditional knockout mouse, and relates to the technical field of animal model construction. The invention provides a sgRNA targeting the mouse SUV39H1 gene, the sgRNA comprising a 5'guide sequence and a 3' guide sequence; the 5' guide sequence comprises any one sequence shown in SEQ ID NO. 1-SEQ ID NO. 7; the 3' guide sequence comprises any one sequence shown in SEQ ID NO. 8-SEQ ID NO. 14. The invention is based on CRISPR/Cas9 technology, and the SUV39H1 gene conditional knockout mouse is constructed through screening and hybridizing the sgRNA. The construction method of the SUV39H1 gene conditional knockout mouse is efficient, quick and simple, and the obtained SUV39H1 gene conditional knockout mouse has good stability, thereby providing an economic and reliable animal model for researching the functions of the SUV39H1 gene and the actions under different physiological and pathological situations.

Description

Construction method of SUV39H1 gene conditional knockout mouse

Technical Field

The invention relates to the technical field of animal model construction, in particular to a construction method of an SUV39H1 gene conditional knockout mouse.

Background

When referring to the construction context of transgenic mice, the CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats Cas) technology is certainly an exciting and revolutionary tool. This technology derives from an adaptive immune defense mechanism formed by bacteria and archaea during long-term evolution, for combating invasive viruses and foreign DNA. It is a bright pearl in the field of gene editing and is known as "scissors" in genetic engineering. CRISPR-Cas9 has become the third generation in gene editing technology, replacing the previous ZFN and TALENs technologies. It is popular because of its high efficiency, simplicity, low cost, and ease of handling. This technique enables scientists to accurately edit the genes of organisms, opening up unprecedented research and therapeutic approaches.

In the CRISPR-Cas9 gene editing technique, one of the key elements is sgRNA (guide RNA). sgrnas are artificially designed RNA molecules whose function is to recognize and target specific sequences in the genome of interest. Once the sgRNA matches the target sequence, it will guide the Cas9 protease to precisely cleave the DNA double strand, causing a double strand break. This break can be repaired by natural repair mechanisms of the cell, including non-homologous end joining (NHEJ) and homologous recombination directed repair (HDR). This repair process allows scientists to modify the genome to achieve a variety of research and therapeutic objectives. Notably, the target recognition capacity of sgrnas depends on their specific sequence. In general, when the interval between genes is large, misidentification of the target sequence by sgrnas does not lead to serious consequences. However, in the case where the genes are located nearer upstream and downstream of the target site, the structure of other genes may be disturbed, which may adversely affect the transgene result.

In conclusion, the CRISPR-Cas9 technology provides unprecedented tools and opportunities for the construction of transgenic mice, and opens up broad prospects for scientists in gene research and treatment.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a construction method of an SUV39H1 gene conditional knockout mouse.

In order to achieve the above purpose, the technical scheme adopted by the invention is as follows: an sgRNA targeting the mouse SUV39H1 gene, said sgRNA comprising a 5'guide sequence and a 3' guide sequence; the 5' guide sequence comprises any one sequence shown in SEQ ID NO. 1-SEQ ID NO. 7; the 3' guide sequence comprises any one sequence shown in SEQ ID NO. 8-SEQ ID NO. 14.

The SUV39H1 gene plays a vital role in cell and biological research, and is a gene encoding histone transferase, and the structure and function of a coloring body are regulated by catalyzing histone modification. The function of the SUV39H1 gene affects key biological processes such as normal differentiation, development and cell cycle of cells. Furthermore, SUV39H1 abnormal expression is closely related to the occurrence and progression of a variety of diseases. The present invention designs sgRNAs for the exon2-3 region of the SUV39H1 gene, which play a key role in SUV39H1 function. The present invention places sgRNAs in non-conserved regions of intron1 and intron3, respectively, to ensure accurate targeting. The sgRNA of the targeted mouse SUV39H1 gene of the invention can selectively knock out the exon2-3 region of the SUV39H1 locally or systemically under specific conditions, so that the exact role of the sgRNA in gene expression and chromosome structure regulation is studied.

As a preferred embodiment of the sgRNA of the targeted mouse SUV39H1 gene, the 5' guide sequence is shown in SEQ ID NO. 4; the 3' guide sequence is shown as SEQ ID NO. 10.

As a preferred embodiment of the sgRNA targeting the mouse SUV39H1 gene according to the invention, the recognition sites of the sgRNA flank exons 2 to 3 of the SUV39H1 gene.

The invention also provides a construction method of the SUV39H1 gene conditional knockout mouse, which comprises the following steps:

(1) Designing and screening sgRNA of a targeted mouse SUV39H1 gene;

(2) Injecting sgRNA, cas9 protein and targeting vector into fertilized ovum of mouse by microinjection, transplanting fertilized ovum into pseudopregnant mouse, and carrying out genotype identification to mice born by pseudopregnant mouse to obtain F0 generation mouse;

(3) Mating the F0 generation mice with wild mice to obtain F1 generation mice;

(4) And mating the F1 generation heterozygote mice with Cre tool mice through genotype identification and screening to obtain the SUV39H1 gene conditional knockout mice.

As a preferred embodiment of the construction method of the SUV39H1 gene conditional knockout mouse, the nucleotide sequence of the sgRNA in the step (1) is shown as SEQ ID NO.4 and SEQ ID NO. 10.

As a preferred embodiment of the construction method of the SUV39H1 gene conditional knockout mice, 5 '-end identification primers used for genotyping of the F0-generation and F1-generation mice are shown as SEQ ID NO.15 and SEQ ID NO.16, and 3' -end identification primers are shown as SEQ ID NO.17 and SEQ ID NO. 18.

As a preferred embodiment of the construction method of the SUV39H1 gene conditional knockout mouse, the genotype of the F0-generation and F1-generation mice is identified, and the PCR amplification procedure is that the mice are pre-denatured for 5min at 94 ℃; denaturation at 98℃for 30s, annealing at 67℃for 30s, elongation at 68℃for 1kb/min, annealing temperature decrease of 0.7℃per cycle for 15 cycles; denaturation at 98℃for 30s, annealing at 57℃for 30s, extension at 68℃for 1kb/min,25 cycles; extending at 68℃for 10min.

The invention also provides the SUV39H1 gene conditional knockout mouse constructed by the construction method of the SUV39H1 gene conditional knockout mouse.

The invention also provides application of the SUV39H1 gene conditional knockout mouse in researching related functions and action mechanisms of the SUV39H1 gene. By comparing survival rates and health conditions of SUV39H1 gene conditional knockout mice and wild-type mice, the role of SUV39H1 in overall health can be studied; the effects of SUV39H1 on fertility and reproduction can be appreciated by studying the reproductive capacity of conditional knockout mice.

The invention also provides application of the SUV39H1 gene conditional knockout mice in screening or preparing medicaments for treating diseases related to the SUV39H1 gene.

The invention has the beneficial effects that: the invention provides a sgRNA of a targeted mouse SUV39H1 gene, which targets and recognizes the two sides of exons 2 to 3 of the SUV39H1 gene. Based on CRISPR/Cas9 technology, SUV39H1 gene conditional knockout mice are constructed through screening and hybridization of the sgRNA. The construction method of the SUV39H1 gene conditional knockout mouse is efficient, quick and simple, and the obtained SUV39H1 gene conditional knockout mouse has good stability and low off-target rate, thereby providing an economic and reliable animal model for researching the functions of the SUV39H1 gene and the actions under different physiological and pathological situations.

Drawings

FIG. 1 is a schematic diagram of a targeting vector region in a construction method of a SUV39H1 gene conditional knockout mouse;

FIG. 2 shows the results of the activity assay of sgRNA;

FIG. 3 is an electrophoretogram of sgRNA-4 and sgRNA-10;

FIG. 4 shows a map of pCS plasmids.

FIG. 5 shows the primer design principle for genotyping F0 mice;

FIG. 6 is a schematic representation of a mating regimen of SUV39H1 gene conditional knockout mice;

FIG. 7 is a schematic representation of a homozygous mating scheme of SUV39H1 gene conditional knockout mice;

FIG. 8 is a graph showing the PCR results of conditional knockout mice of the SUV39H1 gene constructed in example 1;

FIG. 9 is a Western blot analysis chart of SUV39H1 gene conditional knockout mice constructed in example 1;

FIG. 10 is a graph of immunohistochemical analysis of the SUV39H1 gene conditional knockout mice constructed in example 1;

FIG. 11 shows proliferation and migration rates of SUV39H1 gene conditional knockout mouse adipose stem cells constructed in example 1;

FIG. 12 shows the change of secretory phenotype associated with aging of adipose stem cells of a conditional knockout mouse of SUV39H1 gene constructed in example 1.

Detailed Description

The above-described aspects of the present invention will be described in further detail below with reference to specific embodiments in the form of examples. It should not be understood that the scope of the above subject matter of the present invention is limited to the following examples only. All techniques implemented based on the above description of the invention are within the scope of the invention.

EXAMPLE 1 construction of SUV39H1 Gene conditional knockout mice

The embodiment provides a construction method of an SUV39H1 gene conditional knockout mouse, which specifically comprises the following steps:

1. design of sgRNA

The mouse SUV39H1 gene is positioned on an X chromosome antisense strand, the whole length of the gene is 13.6kb, the gene ID at NCBI is 20937, the design principle based on CRISPR SgRNA is based, meanwhile, the structure of the mouse SUV39H1 gene is considered, 5 transcripts are found, SUV39H1-203 is finally selected for design, and exon2-3 can be conditionally knocked out. The 5 'and 3' LoxP sites are inserted in the non-conserved regions in intron1 and intron3, respectively; the homology arms at the 5 'and 3' ends are approximately 1.5kb. In this example, 14 different targeting sites were designed, the schematic representation of the knockdown region is shown in FIG. 1, and the specific sgRNA sequences are shown in Table 1.

TABLE 1 sequence of sgRNA

The activity detection of the sgrnas of table 1, specifically, construction of the sgrnas and Cas9 expression plasmids and transfection of cells, screening of positive mixed clones, selection and cultivation of monoclonal, detection of editing efficiency using PCR experiments, identification of knockout type. The results of the detection are shown in FIG. 2, and preferably the sgRNA-4 and the sgRNA-10 are subjected to the next experiment.

RNA preparation of sgRNA: the sgRNA-4 and sgRNA-10 were ligated into a T7 promoter-carrying plasmid vector and transcribed in vitro to give RNA for microinjection, and PCR was performed for verification, and electrophoresis was performed in 2% agarose gel at 65℃for 5min, and the results are shown in FIG. 3.

2. Construction of targeting vector

The targeting vector is purchased from Shanghai ze Biotechnology Co.

3. Positive mice were obtained by transplantation injection:

the sgRNA sequence was synthesized as oligos and ligated into the pCS vector by annealing polymerization to give the pCS plasmid, whose map is shown in fig. 4. The pCS plasmid and the targeting vector are microinjected into fertilized eggs of mice, and the fertilized eggs are transplanted into oviducts of pseudopregnant female mice. F0 generation mice grown by pseudopregnant female mice grow to a week old, tail is sheared about 2mm, and genome of the tail is extracted for genotyping.

Primers were designed according to two sites inserted into Floxed, and the primer design principle is shown in FIG. 5. Primer information is shown in Table 2, and PCR conditions and reaction systems are shown in Table 3 below.

TABLE 2 identification of primer information

TABLE 3PCR reaction conditions

4. And (3) screening positive F0 mice to mate with wild mice to obtain F1 mice, and screening positive heterozygotes from the F1 mice through identification, wherein the identification scheme is the same as that of the F0 mice.

5. The F1 generation positive heterozygote mice were mated with Cre-delete mice as shown in FIG. 6 to obtain heterozygote mice (SUV 39H1 gene conditional knockout mice, genotype was Delta/+, cre/+), and mated with each other as shown in FIG. 7 to obtain homozygous mice (genotype was +/+, cre/+). The genotyping strategy of the SUV39H1 conditional knockout mice is shown in Table 4, and the genotyping strategy of the homozygous mice is shown in Table 5.

TABLE 4 Table 4

TABLE 5

Example 2

In this example, the SUV39H1 gene conditional knockout mice constructed in example 1 were verified, and the specific experimental method is as follows:

the CAG-Cre mice were crossed with SUV39H1-Flox mice to obtain CAG-SUV39H1 conditional knockout mice, and the identification method was as described in step 5 of example 1. The comparison shows that the survival status, the health degree and the reproduction rate of the CAG-SUV39H1 conditional knockout mice are not different from those of the control mice.

And selecting adipose tissue and adipose-derived stem cells which are easy to obtain, and carrying out subsequent experiments to verify the knockout efficiency of the CAG-SUV39H1 conditional knockout mouse, wherein the method comprises the following steps of:

1. and (3) PCR verification: the CAG-SUV39H1 conditional knockout mice were PCR-verified using the following primers and conditions, and the results are shown in FIG. 8. Wherein the PCR procedure is: 95 ℃ for 5min;95℃for 10s,60℃for 20s,72℃for 20s,40cycles;95 ℃ for 5s;65 ℃ for 1min;4 ℃ is infinity. The PCR primer is specifically as follows: forward: GCAGTGTGTGCTGTAAATCT; reverse: ATACCCACGCCACTTAACCA.

As can be seen from fig. 7, SUV39H1 expression efficiency in adipose mesenchymal stem cells of CAG-SUV39H1 conditional knockout mice was reduced.

2. Western blot analysis: the DNA of the CAG-SUV39H1 conditional knockout mouse was extracted and Western blot detection was performed, and the results are shown in FIG. 9.,

3. immunohistochemical analysis: the expression level of SUV39H1 protein in CAG-SUV39H1 conditional knockout mice was analyzed using immunohistochemical techniques, and the results are shown in FIG. 10.

4. The proliferation and migration rates of adipose stem cells of the CAG-SUV39H1 conditional knockout mice and the control mice were examined, and the results are shown in FIG. 11. The control mice are littermates of CAG-SUV39H1 mice. As can be seen from fig. 11, knocking out SUV39H1 can reduce proliferation and migration ability of adipose mesenchymal stem cells.

5. The results of detecting the secretory phenotype changes associated with the aging of the adipose stem cells of the SUV39H1 gene conditional knockout mice constructed in example 1 and the control mice are shown in FIG. 12. As can be seen from FIG. 12, the constructed CAG-SUV39H1 mice can change SASP expression levels of adipose-derived mesenchymal stem cells.

Finally, it should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. An sgRNA targeting the mouse SUV39H1 gene, wherein the sgRNA comprises a 5'guide sequence and a 3' guide sequence; the 5' guide sequence comprises any one sequence shown in SEQ ID NO. 1-SEQ ID NO. 7; the 3' guide sequence comprises any one sequence shown in SEQ ID NO. 8-SEQ ID NO. 14.

2. The sgRNA of the targeted mouse SUV39H1 gene of claim 1, wherein the 5' guide sequence is set forth in SEQ ID No. 4; the 3' guide sequence is shown as SEQ ID NO. 10.

3. The sgRNA of claim 1 that targets the mouse SUV39H1 gene, wherein the recognition site of the sgRNA is flanking exons 2 to 3 of the SUV39H1 gene.

4. A construction method of a SUV39H1 gene conditional knockout mouse, which is characterized by comprising the following steps:

(1) Designing and screening sgRNA of a targeted mouse SUV39H1 gene;

(3) Mating the F0 generation mice with wild mice to obtain F1 generation mice;

5. The construction method of SUV39H1 conditional knockout mice according to claim 4, wherein the nucleotide sequence of sgRNA in the step (1) is shown as SEQ ID NO.4 and SEQ ID NO. 10.

6. The construction method of SUV39H1 conditional knockout mice according to claim 4, wherein the 5 '-terminal identification primers used for genotyping of the F0-generation and F1-generation mice are shown in SEQ ID NO.15 and SEQ ID NO.16, and the 3' -terminal identification primers are shown in SEQ ID NO.17 and SEQ ID NO. 18.

7. The construction method of SUV39H1 gene conditional knockout mice according to claim 4, wherein the genotype of F0-and F1-generation mice is identified by PCR amplification procedure of pre-denaturation at 94℃for 5min; denaturation at 98℃for 30s, annealing at 67℃for 30s, elongation at 68℃for 1kb/min, annealing temperature decrease of 0.7℃per cycle for 15 cycles; denaturation at 98℃for 30s, annealing at 57℃for 30s, extension at 68℃for 1kb/min,25 cycles; extending at 68℃for 10min.

8. The SUV39H1 gene conditional knockout mouse constructed by the construction method of the SUV39H1 gene conditional knockout mouse according to any one of claims 4 to 7.

9. Use of the SUV39H1 gene conditional knockout mouse of claim 8 for studying SUV39H1 gene related functions and mechanisms of action.

10. Use of the SUV39H1 gene conditional knockout mouse of claim 8 in screening or in the manufacture of a medicament for treating a disease associated with the SUV39H1 gene.