CN115838709A - Method for expressing and preparing recombinant human iduronidase by genetic engineering rice - Google Patents

Abstract

The present invention provides a method for expressing and preparing recombinant human iduronidase (OsrhIDUA) by using gene engineering rice. The invention discloses an OsrhIDUA gene optimized by rice codon, a related carrier, a method for preparing OsrhIDUA gene engineering rice seeds and separating and purifying OsrhIDUA. The OsrhIDUA transgenic engineering rice is obtained by construction, a crude extract containing OsrhIDUA is extracted from OsrhIDUA transgenic engineering rice seeds, and the OsrhIDUA is further separated and purified to obtain OsrhIDUA with RP-HPLC purity of more than 99%. The method has the advantages of high OsrhIDUA yield, high safety and easy realization of scale production.

Description

Method for expressing and preparing recombinant human iduronidase by genetic engineering rice

Technical Field

The invention relates to the field of biotechnology, in particular to a method for expressing, separating and purifying recombinant human iduronidase by taking genetically engineered rice as a bioreactor.

Background

Mucopolysaccharides are a class of proteoglycans including Hyaluronic Acid (HA), chondroitin Sulfate (CS), dermatan Sulfate (DS), heparan Sulfate (HS) and Keratan Sulfate (KS). The in vivo catabolic processes of mucopolysaccharides are: the peptide chain of the proteoglycan complex is separated and hydrolyzed by cathepsin, then gradually degraded by glucosidase or galactosidase, etc., and finally proteoglycan is released.

Mucopolysaccharidosis type I (MPS-I) is an autosomal recessive genetic disorder caused by mutations in the a-L-Iduronidase (IDUA) gene. Various mutations may result in defects in a-L-iduronidase. a-L-Iduronidase (IDUA) is an essential enzyme in HS and DS degradation processes. A functional defect of this enzyme results in the accumulation of its natural substrates in various tissue lysosomes, eventually leading to clinical symptoms. The clinical manifestations of mucopolysaccharidosis type I have wide variability and are now divided into 3 subtypes: heavy Hurler syndrome (incidence about 1/100,000); intermediate form Hurler/Scheie syndrome (incidence about 1/115,000); mild Scheie syndrome (incidence of about 1/500,000).

Enzyme replacement therapy is a newly developed approach to the treatment of MPS in recent years. One rare drug (orphan) approved by the U.S. FDA in 2003 for the treatment of mucopolysaccharidosis type I (MPS-I): alpha-iduronidase (alpha-Liduronidase, common name Laronidase, trade name Aldurazyme) is expressed by CHO cells. Natural IDUA has 653 amino acids, of which the first 26 amino acids are signal peptides. The commercial drug Laronidase has 626 amino acids, the first amino acid E is removed, the molecular weight is 83kD, and the isoelectric point is 8.99. Laronidase, which is approved in China in 6 months in 2020, is the first enzyme replacement therapy approved for treating mucopolysaccharidosis type I worldwide and is the only specific therapeutic drug for treating MPS-I in China.

IDUA expressed by CHO cells has 6N glycosylation sites, namely N110, N190, N336, N372, N415, N451, N372 and N415, and is highly mannose modified; n110 and N190 are complex glycosylation modifications, and N336 and N451 are M6P modifications, which have important functions for targeting IDUA to enter lysosomes. However, the disadvantages of using CHO cells to express IDUA are mainly that recombinant cells are expensive to culture, high in cost, low in production efficiency and generally low in product concentration.

Disclosure of Invention

Based on this, there is a need to provide a method for expressing and preparing recombinant human iduronidase (OsrhIDUA) by genetically engineered rice, particularly, osrhIDUA with RP-HPLC purity of more than 99% is obtained by extracting, separating and purifying from genetically engineered rice seeds, and the method has high yield, high safety and easy realization of large-scale production.

The invention adopts the following technical scheme:

the invention aims to provide a method for efficiently expressing recombinant human iduronidase (OsrhIDUA) by using a rice endosperm cell bioreactor, and particularly provides a method for extracting, separating and purifying OsrhIDUA from transgenic engineering rice seeds.

The invention provides the following technical scheme:

(1) Synthesizing a rice codon-optimized humanized IDUA gene sequence shown as SED ID NO. 1;

(2) Constructing an expression vector for specifically expressing the human IDUA in the rice endosperm cells, wherein the expression vector preferably has a spectrogram structure shown in figure 2;

(3) Transforming the expression vector obtained in the step (2) into rice callus, and obtaining an OsrhIDUA transgenic engineering rice plant through culture, screening and induction.

The invention also aims to provide a method for extracting, separating and purifying OsrhIDUA from OsrhIDUA genetically engineered rice, which comprises the following steps:

s1, extracting a crude extract containing OsrhIDUA from OsrhIDUA genetic engineering rice seeds;

s2, subjecting the crude extract containing OsrhIDUA to cation exchange chromatography to obtain a primary product containing OsrhIDUA;

s3, carrying out intermediate purification on the primary product containing OsrhIDUA by utilizing hydrophobic chromatography to obtain an intermediate product containing OsrhIDUA;

s4, carrying out final-stage purification on the intermediate-stage product containing OsrhIDUA by using anion chromatography to obtain purified OsrhIDUA;

and S5, dialyzing and replacing the purified OsrhIDUA to obtain an OsrhIDUA preparation.

In some of these embodiments, the preferred process parameters are as follows:

in step S1, osrhIDUA transgenic engineering rice is used as a raw material, rice is dried in the sun and husked, processed into semi-polished rice and ground into rice flour of 80-100 meshes, and the rice flour and an extraction buffer solution are mixed in a ratio of 1:5 (weight/volume, kg/L) and extracting for 3-4 hours at 24-26 ℃ to obtain an extract containing OsrhIDUA; 2% -5% of perlite is added into the extract containing OsrhIDUA for filter pressing, the filtrate is filtered by a filter membrane to obtain a crude extract containing OsrhIDUA, and the components of the extraction buffer solution are preferably as follows: 15-30mM phosphate buffer, 0.3-0.5M sodium chloride, pH 7.0-8.0.

In step S2, the primary separation and purification is carried out by using cation exchange chromatography media, and the ion exchange chromatography packing comprises Diamond MMC Mustang, uniMMC 50S, unigel50SP, nanoSP30L and Nanogel 50SP (Suzhou Nami micro technology Co., ltd.), and the primary separation and purification is preferably carried out by using Unigel50SP packing. Equilibrating the Unigel50SP chromatography column with 5-10 Column Volumes (CV) of 20mM sodium acetate buffer, pH6.5, at a linear flow rate of 220-250 cm/h; mixing the OsrhIDUA crude extract with 20mM sodium acetate buffer solution with the pH value of 6.5 according to the volume ratio of 1:1 to 1:2, uniformly mixing and diluting, filtering by a filter membrane to obtain a sample loading solution, wherein the optimum sample loading solution conductivity is 12-14 mS/cm, the pH value of the sample loading solution is 6.4-6.6, and the sample loading volume is not more than 65CV; eluting the impurity protein by using 20mM sodium acetate with pH of 6.5 and 0.16-0.175M sodium chloride buffer solution at the flow rate of 220-250 cm/h, wherein the electrical conductance of the optimal impurity-washing buffer solution is 15-19 mS/cm; eluting with 20mM sodium acetate with pH of 6.5 and 0.4-0.6M sodium chloride buffer solution at flow rate of 220-250 cm/h, wherein the optimum elution buffer solution conductance is 37-50 mS/cm, and collecting eluent rich in OsrhIDUA to obtain primary product containing OsrhIDUA.

In step S3, the medium-grade separation and purification is carried out by using a hydrophobic chromatography medium, and the hydrophobic chromatography packing comprises UniHR Phenyl 30L or NanoHR Phenyl 15L (Suzhou Nami micro science and technology Co., ltd.), preferably a chromatography column using UniHR Phenyl 30L packing. Balancing a UniHR Phenyl 30L chromatographic column by using 3-5 CV of 20mM sodium acetate with pH of 6.5 and 1.2M ammonium sulfate buffer solution at the flow rate of 300-350 cm/h; adjusting the conductance of the OsrhIDUA primary product by using 3M ammonium sulfate, wherein the optimal sample loading conductance is 155-158 mS/cm, the pH value is adjusted to 6.5, and all samples are loaded at the flow rate of 300-350 cm/h; eluting the impurity protein by using a buffer solution of 20mM sodium acetate with the pH value of 6.5 and 1.1 +/-0.1M ammonium sulfate at the flow rate of 300-350 cm/h, wherein the electrical conductivity of the optimal impurity-washing buffer solution is 140-148 mS/cm; eluting with 20mM sodium acetate with pH of 6.5 and 0.15-0.10M ammonium sulfate buffer solution at flow rate of 300-350 cm/h, optimally eluting with 25-30 mS/cm buffer solution conductance, and collecting eluate rich in OsrhIDUA to obtain intermediate product containing OsrhIDUA.

In step S4, the final separation and purification is carried out using an anion chromatography packing comprising DEAE HP (Bogelon Biotechnology, inc.) or Unigel80DEAE (Suzhou Na micro technology, inc.), preferably Unigel80DEAE packing. 5-10 CV of 20mM sodium acetate buffer solution with pH of 6.5 is used for balancing the nano-micro Unigel80DEAE chromatographic column at the flow rate of 300-320 cm/h; and dialyzing the intermediate product with 20mM sodium acetate buffer solution with the pH value of 6.5 for 4-5 times, adjusting the pH value to 6.5 after the electric conductance is reduced to be below 3mS/cm, filtering by using a filter membrane to be used as sample loading liquid, completely loading, and collecting penetrating liquid rich in OsrhIDUA to be used as purified OsrhIDUA. And (3) eluting the impurity protein by adopting 2M NaCl buffer solution at the flow rate of 300-320 cm/h.

Compared with the prior art, the invention has the beneficial effects that:

the invention obtains the OsrhIDUA with RP-HPLC purity of more than 99 percent by optimizing the gene sequence screening of the OsrhIDUA and utilizing a rice endosperm cell bioreactor to efficiently express and purify, and the yield of the OsrhIDUA is as high as 0.4g/kg rice flour. The rice source OsrhIDUA has high safety and is easy to realize scale production.

Drawings

FIG. 1 is a schematic diagram of the plasmid structure of pOsPMP840 in example 1.

FIG. 2 is a PCR detection chart of the target gene of the rice plant of the genetic engineering of example 1; wherein, M corresponds to a DNA standard molecular weight Marker; 001-030 respectively correspond to different plants of T0 generation transgenic material.

FIG. 3 is a WB detection result of the genetically engineered rice plant of example 1; wherein 840 (IDUA) corresponds to a seed batch number, and M corresponds to a protein standard molecular weight Marker; 5-44 respectively correspond to different plants of the T0 generation transgenic material.

FIG. 4 is SDS-PAGE (A) and WB (B) of crude extract containing OsrhIDUA under different extraction process conditions in example 2; wherein 1-15 correspond to extraction process conditions numbered 1-15 in Table 1, pH4.0 corresponds to extraction conditions numbered 16, pH7.0 corresponds to extraction conditions numbered 17, and pH10.0 corresponds to extraction conditions numbered 18, respectively.

FIG. 5 is a graph of an optimized screening test for primary purified cationic filler Unigel50SP chromatography in example 3; wherein, 1-8 in A picture correspond to different sample loading conductance numbers; in B, load represents the loading liquid; FT indicates permeate, 16% indicates 0.16M NaCl, TW indicates tailing, 17% indicates 0.17M NaCl,18% indicates 0.18M NaCl,25% indicates 0.25M NaCl,28% indicates 0.28M NaCl,40% indicates 0.4M NaCl, and 100% indicates 1.0M NaCl.

FIG. 6 is a statistical chart of the screening results of medium-grade purified hydrophobic filler UniHR Phenyl 30L chromatographic condition optimization in example 4; wherein, 1 to 46 in the graphs A to D represent the number of samples collected by gradient elution, load represents a sample loading solution, FT represents a permeate solution, W represents an impurity washing solution, and Elu represents an eluent; in panel E, 10% represents 10% of the B-eluent, 50% represents 50% of the B-eluent, 70% represents 70% of the B-eluent, 100% represents 20mM of sodium acetate eluent, water represents water washing, alkali/CIP represents 0.5M NaOH regeneration, and M represents a standard molecular weight Marker.

FIG. 7 is a statistical chart showing the results of the final stage of screening of purified anion fillers and the optimum screening of chromatographic conditions in example 5; wherein, in the A picture, M is a standard molecular weight Marker, L represents a sample loading liquid, SP represents Unigel50SP chromatographic eluent, HIC represents hydrophobic chromatography UniHR Phenyl 30L chromatographic eluent, G25 represents a desalted sample, and C picture represents a chromatography Unigel80DEAE penetration liquid in the third step; in the B and C diagrams, M is a standard molecular weight Marker, load represents a sample application liquid, FT represents a penetration liquid, and CIP represents a regeneration sample.

Detailed Description

The present invention is further described in detail below with reference to specific examples so that those skilled in the art can more clearly understand the present invention.

The following examples are provided only for illustrating the present invention and are not intended to limit the scope of the present invention. All other embodiments obtained by a person skilled in the art based on the specific embodiments of the present invention without any inventive step are within the scope of the present invention.

In the examples of the present invention, all the raw material components are commercially available products well known to those skilled in the art, unless otherwise specified; in the examples of the present invention, unless otherwise specified, all technical means used are conventional means well known to those skilled in the art.

[ example 1 ]

The embodiment provides a construction method of a rice specific expression OsrhIDUA vector and an obtaining method of genetically engineered rice, which specifically comprise the following steps:

construction of OsrhIDUA expression vector:

as shown in FIG. 1, the rice-specific promoter Gt13a and its signal peptide are used in this example to mediate the expression of IDUA gene in rice endosperm cells.

According to the sequence of the humanized iduronidase gene (Genbank accession No.: AAA 81589.1), nanjing King-Smiry Biotech Ltd was entrusted to synthesize the following nucleotide sequence according to the preferred genetic codons of rice:

GAGGCCCCGCACCTCGTGCACGTGGACGCCGCCCGCGCCCTCTGGCCGCTCCGCCGCTTCTGGC

GCAGCACCGGCTTCTGCCCGCCGCTCCCGCACAGCCAGGCCGACCAGTACGTGCTCAGCTGGG

ACCAGCAGCTCAACCTCGCCTACGTGGGCGCCGTGCCGCACCGCGGCATCAAGCAGGTGCGCA

CCCACTGGCTCCTAGAGCTCGTGACCACCCGCGGCAGCACCGGCCGCGGCCTCAGCTACAACTT

CACCCACCTCGACGGCTACCTCGACCTCCTCCGCGAGAACCAGCTCCTCCCGGGCTTCGAGCTC

ATGGGCAGCGCCAGCGGCCACTTCACCGACTTCGAGGACAAGCAGCAGGTGTTCGAGTGGAAG

GACCTCGTGAGCAGCCTCGCCCGCCGCTACATCGGCCGCTACGGCCTCGCCCACGTGAGCAAGT

GGAACTTCGAGACCTGGAACGAGCCGGACCACCACGACTTCGACAACGTGAGCATGACCATGC

AGGGCTTCCTCAACTACTACGACGCCTGCAGCGAGGGCCTCCGCGCCGCCAGCCCGGCCCTCCG

CCTCGGCGGCCCGGGCGACAGCTTCCACACCCCGCCGCGCAGCCCGCTCAGCTGGGGCCTCCTC

CGCCACTGCCACGACGGCACCAACTTCTTCACCGGCGAGGCCGGCGTGCGCCTCGACTACATCA

GCCTCCACCGCAAGGGCGCCCGCAGCAGCATCAGCATCCTAGAGCAGGAGAAGGTGGTGGCCC

AGCAGATCCGCCAGCTCTTCCCGAAGTTCGCCGACACCCCGATCTACAACGACGAGGCCGACCC

GCTCGTGGGCTGGAGCCTCCCGCAGCCGTGGCGCGCCGACGTGACCTACGCCGCCATGGTGGTG

AAGGTGATCGCCCAGCACCAGAACCTCCTCCTCGCCAACACCACCAGCGCCTTCCCGTACGCCC

TCCTCAGCAACGACAACGCCTTCCTCAGCTACCACCCGCACCCGTTCGCCCAGCGCACCCTCAC

CGCCCGCTTCCAGGTGAACAACACCCGCCCGCCGCACGTGCAGCTCCTCCGCAAGCCGGTGCTC

ACCGCCATGGGCCTCCTCGCCCTCCTCGACGAGGAGCAGCTCTGGGCCGAGGTGAGCCAGGCC

GGCACCGTGCTCGACAGCAACCACACCGTGGGCGTGCTCGCCAGCGCCCACCGCCCGCAGGGC

CCGGCCGACGCCTGGCGCGCCGCCGTGCTCATCTACGCCAGCGACGACACCCGCGCCCACCCGA

ACCGCAGCGTGGCCGTGACCCTCCGCCTCCGCGGCGTGCCGCCGGGCCCGGGCCTCGTGTACGT

GACCCGCTACCTCGACAACGGCCTCTGCAGCCCGGACGGCGAGTGGCGCCGCCTCGGCCGCCC

GGTGTTCCCGACCGCCGAGCAGTTCCGCCGCATGCGCGCCGCCGAGGACCCGGTGGCCGCCGC

CCCGCGCCCGCTCCCGGCCGGCGGCCGCCTCACCCTCCGCCCGGCCCTCCGCCTCCCGAGCCTC

CTCCTCGTGCACGTGTGCGCCCGCCCGGAGAAGCCGCCGGGCCAGGTGACCCGCCTCCGCGCC

CTCCCGCTCACCCAGGGCCAGCTCGTGCTCGTGTGGAGCGACGAGCACGTGGGCAGCAAGTGC

CTCTGGACCTACGAGATCCAGTTCAGCCAGGACGGCAAGGCCTACACCCCGGTGAGCCGCAAG

CCGAGCACCTTCAACCTCTTCGTGTTCAGCCCGGACACCGGCGCCGTGAGCGGCAGCTACCGCG

TGCGCGCCCTCGACTACTGGGCCCGCCCGGGCCCGTTCAGCGACCCGGTGCCGTACCTAGAGGTGCCGGTGCCGCGCGGCCCGCCGAGCCCGGGCAACCCGTGA(SEQ ID NO.1)。

compared with the conventional human iduronidase gene sequence, the optimized nucleotide sequence is changed by 15.65%, the codon is changed by 21.25%, but the corresponding amino acid sequence (natural IDUA,627 AA) is not changed, and the constructed plasmid is pOsPMP838.

The synthesized optimized nucleotide sequence (SEQ ID NO. 1) of the anthropogenic iduronidase is cut by MlyI and XhoI, then cloned into NaeI and XhoI cut pOsPMP003, and an intermediate vector plasmid pOsPMP839 is constructed by T4 ligase.

The entire 3392bp expression cassette containing the Gt13a promoter, signal peptide sequence, codon-optimized humanized iduronidase gene and Nos terminator was inserted into HindIII and EcoRI digested binary expression vector pc1300 (CAMBIA Co.) to construct an Agrobacterium-mediated bacterium plasmid named pOsPMP840 (FIG. 1).

2. Transformation and positive identification of genetically engineered rice:

the pOsPMP840 plasmid is transformed into Agrobacterium tumefaciens EHA105 (Invitrogen corporation, USA), the pOsPMP840 plasmid is transformed into the callus of rice variety LGC through the mediation of Agrobacterium tumefaciens, and a complete plant is formed after the culture, the screening and the induction.

The method with the steps of induction culture comprises the following steps:

(1) Callus induction: after the rice seeds soaked in 70% ethanol and matured are unshelled and sterilized for 1 minute, the rice seeds are treated for 30 minutes again by 20% sodium hypochlorite; after washing with sterile water for 5-7 times, the seeds are inoculated onto an induction medium (N6 medium), 6-8 seeds are inoculated per dish, and the seeds are irradiated with light at 32 ℃ for about 5-7 days.

(2) Preparing agrobacterium: carrying out amplification culture on agrobacterium containing an expression vector pOsPMP840, coating bacteria on a kanamycin resistant plate, and culturing for 2-3 days in an incubator at 28 ℃; a single colony of the agrobacterium tumefaciens is inoculated into a suspension medium (AAM liquid medium) by using an inoculating loop, and is shake-cultured at 28 ℃.

(3) Agrobacterium infection (co-culture): transferring the callus to a sterilized Erlenmeyer flask, and adjusting the OD of the Agrobacterium suspension ₆₀₀ The value is 0.05 to 0.1; suspending the seeds in AAM medium, infecting for 1.5 minutes, and continuously shaking; discarding the bacterial liquid, sucking the redundant bacterial liquid by using sterile filter paper, taking out the callus, placing the callus on the sterile filter paper, and draining for 30-45 minutes; sterile filter paper was placed on 2N6-AS medium, 500. Mu.L of AAM containing AS (acetosyringone, 250 mg/ml) was dropped on sterile filter paper with a diameter of 9cm, and the infected callus was placed on filter paper and cultured in the dark at 25 ℃ for 3 days.

(4) Washing and screening: transferring the co-cultured callus into a sterilized triangular flask, and cleaning the callus with sterile water for 5-7 times; soaking the infected callus in sterilized water containing 0.5g/L concentration of cefuroxime axetil for about 30 minutes, and then shaking at the temperature of 28 ℃ and the speed of 180-200 rpm for 20-30 minutes; pouring out the sterilized water containing the antibiotic, pouring the triangular flask into a sterilized culture medium containing filter paper for about 15 minutes, airing, and transferring the callus to a screening culture medium containing the HPT antibiotic for 20-30 days.

(5) Callus differentiation: the callus with HPT resistance after 20-30 days of selection is transferred to a differentiation medium (N6 medium) and cultured for 20-30 days at 26 ℃ under illumination.

(6) Rooting: selecting differentiated plantlets from the differentiation culture medium, transferring the plantlets to an MS culture medium containing 1/2 of the plantlets for rooting culture, performing illumination culture at 28 ℃ for 30 days, and transferring the plantlets to a field for growth.

Get T ₀ Replacing the leaves of the HPT positive regenerated seedlings, extracting DNA, taking the rice genome DNA as a template, and setting positive (plasmid DNA) and negative (sterile water) controls; PCR amplification was carried out using recombinant human iduronidase forward primer GT13a-F (SED ID NO.2: 5-: 10 × Buffer,2.5 μ L; LAase (5U/. Mu.l), 0.15. Mu.L; dNTP (2.5 mM), 4. Mu.L; primer and method for producing the same0.5. Mu.L each; add ddH ₂ O to 25. Mu.L. Amplification conditions: pre-denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30 sec, annealing at 54 ℃ for 30 sec, extension at 72 ℃ for 40 sec, 35 cycles, and final extension at 72 ℃ for 10 min), and the theoretical size of the product is 750bp; the amplification product was stained with 1% agar, followed by 150V,200mA electrophoresis for 15 minutes after EB staining, and the results were observed in a gel imager.

The identification result shows that 44 strains of positive recombinant human iduronidase transgenic rice is obtained through agrobacterium tumefaciens mediated transformation, and the PCR identification result of the target gene of part of the genetically engineered rice is shown in figure 2.

3. Screening of high-expression OsrhIDUA single plant

Transplanting the obtained recombinant human iduronidase positive seedling to room temperature to grow to be mature, and harvesting single plants capable of normally fructifying. The relative expression of the samples was determined by WB, 10% SDS-PAGE followed by membrane transfer, 5% skim milk blocking for 1h, primary antibody (Mouse anti-IDUAmAb) following 1:1000 h incubation, secondary antibody (AP-horse anti mouse) at 1: color development was achieved after 5000 incubation for 1h.

As shown in fig. 3, the identification results show that: the recombinant human iduronidase positive transgenic rice has 10 individual high-expression OsrhIDUA, and the serial numbers are 840-5, 30, 31, 33, 37, 38, 39, 41, 42 and 44 respectively.

[ example 2 ]

The embodiment provides a method for extracting OsrhIDUA from genetically engineered rice, which specifically comprises the following steps:

the genetically engineered rice with high expression OsrhIDUA obtained in example 1 is hulled and processed into semi-polished rice, ground into OsrhIDUA-containing rice flour of 80-100 meshes, and subjected to crude extraction according to the extraction conditions shown in the following Table 1:

TABLE 1 different extraction conditions

Experiment number	pH of the extract	Concentration of salt in the extract (mM)	Extraction temperature (. Degree. C.)
				1	10	250	7.6
2	7	250	27
				3	4	250	37
4	10	500	27
				5	4	0	27
6	7	0	37
				7	7	250	27
8	4	500	27
				9	7	0	7.6
10	10	0	27
				11	4	250	7.6
12	7	500	7.6
				13	10	250	37
14	7	500	37
				15	7	250	27

The specific process steps are as follows: accurately weighing 18 parts of 1g of OsrhIDUA-containing rice flour into a10 mL centrifuge tube, sequentially adding the extracting solution (phosphoric acid buffer system, salt is NaCl) shown in the table 1 into 15 tubes according to the material-liquid ratio of 1 to 5 (mass/volume ratio), vibrating and uniformly mixing, fixing each centrifuge tube on a rotary mixer, placing according to the conditions shown in the table 1, and carrying out rotary extraction for 1h.

In addition, acetate buffer extract (5 ml of 20mM NaAc,150mM NaCl, pH 4.0), phosphate extract (20mM PB,150mM NaCl, pH 7.0) at pH7.0, tris buffer extract (20mM Tris,150mM NaCl, pH 10.0) at pH10.0 were added to 3 tubes of test Nos. 16, 17, and 18, respectively, in the feed liquid mass/volume ratio of 1; after shaking and mixing, fixing each centrifuge tube on a rotary mixer, placing at room temperature (25 +/-2 ℃) and extracting for 1 hour in a rotating way.

After extraction, taking out the centrifugal tube, centrifuging for 5min at 10000g, and keeping the supernatant for later use.

Separately, 1g of LGC rice flour (control) was taken, 5mL of an extract (20mM PB,500mM NaCl, pH 7.0) was added, and the mixture was subjected to rotary extraction for 1 hour, and the other treatment was performed as described above.

The supernatant of each sample was subjected to SDS-PAGE/WB detection, and the results are shown in FIG. 4. The results show that, among the influencing factors for the extraction process, pH > NaCl > temperature; extraction pH7.0 >; extracting NaCl salt concentration: 500mM 250mM 0; extraction temperature: 37 ℃ is more than 27 ℃ and more than 7.6 ℃, but as the temperature rises, the impurity protein increases, and the total protein extraction amount at 37 ℃ and 25 ℃ is not greatly different.

Therefore, in combination with experimental and software analysis optimization, it is preferred to determine the composition of the extract as: 15-30mM phosphate buffer, 0.3-0.5M sodium chloride, pH 6.5-8.5.

[ example 3 ] A method for producing a polycarbonate

In the embodiment, the cation exchange chromatography medium is adopted to primarily purify the supernatant containing OsrhIDUA, and the specific method comprises the following steps:

1. screening of cation exchange chromatography media for primary purification

A crude extract containing OsrhIDUA was prepared according to the preferred extraction conditions (extract: 20mM phosphate buffer, 0.3M to 0.5M sodium chloride, pH7.0 to 8.0, feed-to-liquid ratio 1.

The cation exchange chromatography packing used for the tests included: diamond S, diamond CM, diamond SP Mustang, diamond MMC Mustang, SP BB, SP FF, CM FF from Bogelong (Shanghai) Biotechnology Ltd and Unigel 80SP, unigel80CM, uniMMC 50s-N, uniMMC-50s, unigel50SP, nano SP-30L from Suzhou Nami micro technology Ltd.

The conductivity was measured by loading with different phosphate buffer solutions and eluted with a gradient of NaCl salt concentration. The experimental statistics for the cation exchange chromatography media used for primary purification are shown in Table 2 below:

TABLE 2 statistical table of cationic filler screening test conditions for OsrhIDUA primary purification

/>

The results show that the 4# (Diamond MMC Mustang) and 10# (UniMMC 50S-N) filler samples were loaded directly with little sample flow through, and samples were diluted 2 and 4 times with essentially no flow through, eluting in 1M NaCl. The 12# (Unigel 50 SP) and 13# (NanoSP-30L) have certain degree of miscellaneous band separation, and are included in the filler at the later stage for exploration.

2. Primary purified cation exchange packing Unigel50SP chromatography process screening

Crude extracts containing OsrhIDUA were prepared according to the preferred extraction conditions (extract: 20mM phosphate buffer, 0.3M to 0.5M sodium chloride, pH7.0 to 8.0, feed-to-liquid ratio 1.

Ep tube centrifugation capture assay was performed using different fold (1.25X, 1.5X,1.75X,2.0X,2.25X,2.5X,2.75X, 3X) dilutions in 20mM acetate buffer, using different loading conductances of 13-25mS/cm (point values: 22.29,20.96,19.35,18.12,16.75 (16.8), 15.76,14.90, 13.83mS/cm) at pH 6.5.

As in panel a of fig. 5, the results show that: when the Unigel50SP loading conductance is below 14mS/cm, the crude extract containing OsrhIDUA does not obviously penetrate, which indicates that the loading conductance needs to be controlled below 14 mS/cm; further performing gradient impurity washing and elution by adopting 0.16M, 0.17M, 0.18M, 0.25M, 0.28M and 0.4M NaCl, wherein the detection result shows that when the concentration of impurity washing salt is increased from 0.16M to 0.17M NaCl, the impurity washing liquid detects a very small amount of OsrhIDUA, and when the concentration of impurity washing salt is increased to 0.18M NaCl, most of OsrhIDUA is eluted, which indicates that the concentration of impurity washing salt is temporarily 0.16-0.17M NaCl; osrhIDUA was substantially completely eluted at 0.4M NaCl (see B in FIG. 5).

Thus, this example preferably determines that the Unigel50SP chromatography process parameters using the cation exchange packing are: the sample loading conductance is lower than 14mS/cm, the concentration of the impurity washing salt is 0.16-0.17M NaCl, and the concentration of the elution salt is 0.4-0.6M NaCl.

[ example 4 ]

This example provides intermediate purification of OsrhIDUA hydrophobic chromatography media

1. Selection of Medium purification hydrophobic chromatography Medium

The OsrhIDUA-containing primary product was prepared according to the extraction process conditions and the cation chromatography process conditions determined in examples 2 and 3.

NaCl is added into the primary product, so that the NaCl concentration of the sample solution is 0.4M and 1.0M respectively, 12 kinds of hydrophobic fillers are screened respectively, and the statistics of test conditions are shown in the following table 3:

TABLE 3 statistical table of screening tests with hydrophobic packings for purification of OsrhIDUA primary products

The results show that: uniHR Phenyl-30L (# 2) flowed less at 0.4M NaCl and not at 1M NaCl; nano HR Phenyl-15L (7 #) has no flow-through in 0.4M NaCl and 1M NaCl, hetero protein has stronger hydrophobicity than that of the target protein, and UniHR Phenyl-30L has better separation effect on the hetero protein and the target protein in 0.4M NaCl; nano HR Phenyl-15L has stronger hydrophobicity than UniHR Phenyl-30L, and the UniHR Phenyl-30L is selected for subsequent chromatographic condition optimization.

2. Medium-grade purified hydrophobic filler UniHR Phenyl-30L chromatographic condition optimization and loading capacity confirmation

The primary product containing OsrhIDUA was prepared according to the extraction process conditions and the cation chromatography process conditions determined in examples 2 and 3.

Ammonium sulfate was added to the primary product containing OsrhIDUA to give a sample solution so that the concentration of ammonium sulfate in the sample solution was 0.9M.

The loading solution was continuously loaded until an inflection point appeared in the flow-through, which indicated that the UniHR Phenyl-30L loading was 13.37mg/mL (FIG. 6A); according to the above loading amounts, the loading was confirmed by using concentration gradients of 0.9M, 1.2M and 1.5M ammonium sulfate loading, respectively, and gradient elution was performed using 20mM sodium acetate buffer solution of pH 6.5.

The results show that: under high loading, the binding capacity of the target protein in the loading solution with the salt concentration of 0.9M ammonium sulfate is not strong, the target protein is eluted during rebalancing (figure 6B), the loading salt concentration (1.2M and 1.5M ammonium sulfate) is improved, and the chromatographic purity of the loading solution with 1.2M ammonium sulfate is better than that of 1.5M (C and D in figure 6); after loading the 1.2M ammonium sulfate loading solution, the elution was carried out using 10% B, 50% B, 70% B and 100% B. Wherein A is an equilibrium solution, and B is a 20mM sodium acetate buffer solution with pH of 6.5.

And finally determining: washing conditions were 10. + -.1% by weight, elution conditions were 70% to 80% by weight (FIG. 6E), and elution yielded a OsrhIDUA-containing intermediate product.

[ example 5 ]

The embodiment provides a final-stage purification method of an anion chromatographic medium containing a OsrhIDUA intermediate-stage product, which specifically comprises the following steps:

1. screening of final-stage anion purification chromatography media

The intermediate products containing OsrhIDUA were prepared according to the preferred conditions of extraction, cation exchange chromatography and hydrophobic chromatography as determined in examples 2, 3 and 4.

Desalting the intermediate-grade product containing OsrhIDUA by using a G25 desalting column, adjusting the pH to 7.5, and respectively carrying out chromatographic purification by using BGL DEAE HP packing and Unigel80DEAE packing:

column volume 5mL, flow rate 2mL/min, equilibrium: after equilibration at pH7.5 for 5CV of column at 20mM PB, osrhIDUA desalted sample was loaded and the permeate was collected on a 2M NaCl regeneration column.

The results of chromatography using BGL DEAE HP packing and Unigel80DEAE are shown in a and B in fig. 7, respectively, and show that: the Unigel80DEAE chromatographic result shows that the base lines of the penetration peak and the impurity peak are separated, the BGL DEAE HP chromatographic result can be repeated, and the electrophoretic purity is more than 95 percent, so that the Unigel80DEAE is preferably used as a final-stage purification filler.

2. Optimization of chromatographic conditions of final-stage anion purification Unigel80DEAE

The intermediate product containing OsrhIDUA was dialyzed against 20mM sodium acetate buffer solution at pH7.5 and pH6.5, respectively, and then subjected to Unigel80DEAE chromatography:

column volume 5mL, flow rate 2mL/min, equilibrium: 20mM PB at pH 7.5/6.5 (2 pH settings were investigated), column 5CV was equilibrated, and OsrhIDUA desalted sample was loaded and collected through a permeate, 2M NaCl regeneration column.

The detection results are shown in graph C in fig. 7, and the results show that: neither the buffered final protein purity nor the activity recovery was significantly changed at pH6.5 and pH7.5 (fig. 7C).

However, the protein recovery rate and the sample stability of the OsrhIDUA after dialysis are reflected as follows: the pH of 6.5 is superior to the pH of 7.5, so dialysis to determine the final purification of Unigel80DEAE chromatography is preferably with a pH of 6.5 in the buffered equilibrium.

It should be noted that the above examples are only for further illustration and description of the technical solution of the present invention, and are not intended to further limit the technical solution of the present invention, and the method of the present invention is only a preferred embodiment and is not intended to limit the protection scope of the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (12)

1. A nucleotide sequence capable of adopting rice to specifically express OsrhIDUA is shown in SEQ ID NO. 1.

2. An expression vector is characterized by comprising a nucleotide sequence shown as SEQ ID NO.1, a promoter Gt13a and a signal peptide thereof.

3. A method for expressing and preparing OsrhIDUA by genetic engineering rice is characterized by comprising the following steps:

constructing an expression vector according to claim 2, transforming to obtain OsrhIDUA transgenic engineering rice;

extracting a crude extract containing OsrhIDUA from OsrhIDUA transgenic engineering rice seeds;

subjecting the crude extract containing OsrhIDUA to cation exchange chromatography to obtain primary product containing OsrhIDUA;

carrying out hydrophobic chromatography on the primary product containing OsrhIDUA to obtain a secondary product containing OsrhIDUA;

and (3) carrying out anion chromatography on the intermediate product containing the OsrhIDUA to obtain the purified OsrhIDUA.

4. The method for expressing and preparing OsrhIDUA from genetically engineered rice as claimed in claim 3, further comprising the step of subjecting the purified OsrhIDUA to dialysis displacement to obtain a preparation of OsrhIDUA.

5. The method for expressing and preparing OsrhIDUA from genetically engineered rice as claimed in claim 3, wherein the expression vector is pOsPMP840.

6. The method for expressing and preparing OsrhIDUA from genetically engineered rice as claimed in claim 3, wherein the process for preparing the crude extract containing OsrhIDUA comprises:

1) Drying and shelling OsrhIDUA transgenic engineering rice, processing into semi-polished rice, and grinding into OsrhIDUA-containing rice flour of 80-100 meshes;

2) Mixing OsrhIDUA-containing rice flour with an extracting solution with the pH value of 7.0-8.0 uniformly, wherein the extracting solution contains 15-30mM phosphate buffer solution and 0.3-0.5M sodium chloride to obtain an extract solution containing OsrhIDUA;

3) Adding 2-5% of perlite into the extract solution containing OsrhIDUA, performing filter pressing, and filtering the filtrate by a filter membrane to obtain a crude extract containing OsrhIDUA.

7. The method for expressing and producing OsrhIDUA in genetically engineered rice according to claim 3, wherein the ion exchange chromatography medium used for producing the primary product containing OsrhIDUA is selected from at least one of Diamond MMC Mustang, uniMMC 50s-N, unigel50SP, nanoSP30L, preferably the cation exchange medium Unigel50 SP.

8. The method for expressing and preparing OsrhIDUA in genetically engineered rice as claimed in claim 7, wherein the process steps for preparing said OsrhIDUA-containing primary product comprise:

1) A Unigel50SP chromatographic column is balanced by adopting a 20mM sodium acetate buffer solution with pH of 6.5 and the volume (CV) of the column being 5-10 times of the volume (CV) of the column at a linear flow rate of 220-250 cm/h;

2) Mixing the crude extract containing OsrhIDUA with 20mM sodium acetate buffer solution with the pH value of 6.5 according to the volume ratio of 1:1 to 1:2, uniformly mixing and diluting, filtering by using a filter membrane to obtain a sample loading solution, controlling the conductance of the sample loading solution at 12-14 mS/cm, and controlling the pH of the sample loading solution at 6.4-6.6;

3) Eluting the impurity protein by adopting 20mM sodium acetate with pH of 6.5 and 0.16-0.175M sodium chloride buffer solution at the flow rate of 220-250 cm/h, and controlling the conductance of the impurity-washing buffer solution to be 15-19 mS/cm;

4) Eluting with 20mM sodium acetate with pH of 6.5 and 0.4-0.6M sodium chloride buffer solution at flow rate of 220-250 cm/h, controlling the conductivity of the elution buffer solution to be 37-50 mS/cm, collecting eluent rich in OsrhIDUA, and obtaining primary product containing OsrhIDUA.

9. The method for expressing and preparing OsrhIDUA from genetically engineered rice as claimed in claim 3, wherein the medium-grade product hydrophobic chromatography medium containing OsrhIDUA is selected from one of UniHR Phenyl 30L and NanoHR Phenyl 15L, preferably UniHR Phenyl 30L.

10. The method for expressing and preparing OsrhIDUA from genetically engineered rice as claimed in claim 9, wherein the process step of preparing the intermediate product containing OsrhIDUA comprises:

1) Adopting 3-5 CV buffer solution with pH value of 6.5 and containing 20mM sodium acetate and 1.2M ammonium sulfate to balance a UniHR Phenyl 30L chromatographic column at the flow rate of 300-350 cm/h;

2) Regulating the conductance of the OsrhIDUA primary product by using ammonium sulfate, controlling the sample loading conductance to be 155-158 mS/cm, adjusting the pH value to be 6.5, and completely loading at the flow rate of 300-350 cm/h;

3) Eluting impurity protein by using a buffer solution with pH of 6.5 and containing 20mM sodium acetate and 1.1 +/-0.1M ammonium sulfate at the flow rate of 300-350 cm/h, and controlling the conductivity of the impurity-washing buffer solution to be 140-148 mS/cm;

4) Eluting with a buffer solution containing 20mM sodium acetate and 0.15-0.10M ammonium sulfate at pH6.5 at a flow rate of 300-350 cm/h, controlling the conductivity of the elution buffer solution to be 25-30 mS/cm, and collecting the eluent rich in OsrhIDUA to obtain a middle-grade product containing OsrhIDUA.

11. The method for expressing and preparing OsrhIDUA from genetically engineered rice as claimed in claim 3, wherein the purified OsrhIDUA is prepared using an anionic chromatography medium selected from the group consisting of Bogelung DEAE HP or Nanmu Unigel80DEAE, preferably Nanmu Unigel80 DEAE.

12. The method of claim 11, wherein the step of preparing the purified OsrhIDUA comprises:

1) 5-10 CV of 20mM sodium acetate buffer solution with pH of 6.5 is adopted to balance the nano-micro Unigel80DEAE chromatographic column at the flow rate of 300-320 cm/h;

2) And dialyzing the intermediate product containing OsrhIDUA for 4-5 times by using 20mM sodium acetate buffer solution with the pH value of 6.5, adjusting the pH value to 6.5 after the electric conductance is reduced to be below 3mS/cm, filtering by using a filter membrane to be used as sample loading liquid, completely loading the sample, and collecting penetrating fluid rich in OsrhIDUA to obtain the purified OsrhIDUA.

Images