CN115838652B - Lactobacillus reuteri LR21 and application thereof - Google Patents

Abstract

The application relates to lactobacillus reuteri, which is lactobacillus reuteri Limosilactobacillus reuteri (LR 21); the strain is preserved in China Center for Type Culture Collection (CCTCC) No. M2022464 at 22 days of 2022, and the preservation address is No. 299 of Wuchang district of Wuhan, hubei province. The lactobacillus reuteri provided by the application has higher tolerance to high temperature, artificial gastric juice, intestinal juice and the like, has good adhesion to intestinal epithelial cells of the strain, also has outstanding reuterin synthesis capability, also has antagonism to clostridium perfringens, and has the potential of being developed into a novel microbial additive for preventing clostridium perfringens infection.

Description

Lactobacillus reuteri LR21 and application thereof

Technical Field

The application belongs to the technical field of microorganisms, and particularly relates to lactobacillus reuteri and application thereof.

Background

Clostridium perfringens is an anaerobic gram-positive bacillus, and is classified into 7 serotypes a-G according to the exotoxins secreted by the bacillus, and poultry is mainly infected with clostridium perfringens type a and C. After clostridium perfringens infects poultry, the clostridium perfringens causes a great deal of proliferation and secretion of toxins in intestinal tracts under various environmental causes, and finally necrotic enteritis of chickens is caused, the main symptoms of the disease are that the chickens are listlessness, loose feathers, burnt kerosene-like or bloody stool is discharged, appetite is reduced, production performance is seriously reduced, small intestine intestinal walls are thinned and filled with gas after the section inspection, and diffuse or large-area hemorrhagic necrosis of intestinal mucous membranes is caused. For a long time, the prevention and control of necrotic enteritis mainly depends on the addition of antibiotics in feed, but along with the forbidden of the feed antibiotics, the disease is in frequent situation worldwide, and huge economic loss is brought to the global poultry farming industry every year. Therefore, the search for new antibiotic alternatives for the prevention and control of necrotic enteritis is currently a problem in the poultry farming industry.

Probiotics are a group of living microorganisms that, when ingested in certain amounts, produce beneficial effects on the health of the host. Probiotics have various biological activities, and can reduce the number of harmful bacteria in the intestinal tract, such as clostridium perfringens, inhibit the toxin synthesis of the harmful bacteria by changing the acid-base environment of the intestinal tract, synthesizing antibacterial substances, competitively adhering to intestinal epithelial cells and the like. More and more research results indicate that probiotics are an effective way to prevent clostridium perfringens infection. Lactobacillus reuteri is one of a few of the home bacteria in the animal intestinal tract, and has good gastrointestinal fluid tolerance and intestinal mucosa adhesion capability. Under anaerobic conditions, lactobacillus reuteri can also use glycerol as a substrate, and a class of bacteriocins named reuterin are produced under the catalysis of intracellular glycerol dehydratase. The bacteriocin is a non-protein broad-spectrum antibacterial agent which mainly comprises 3-hydroxy-propionaldehyde and simultaneously contains 3-hydroxy-propionaldehyde dimer and 3-hydroxy-propionaldehyde hydrate, has obvious antibacterial and bactericidal effects on various intestinal pathogens such as salmonella, escherichia coli, campylobacter jejuni, clostridium difficile and the like, has the advantages of low toxicity, wide safety range, no bacterial drug resistance and the like, and is a natural antibiotic substitute. In conclusion, lactobacillus reuteri is an ideal source for probiotic screening and development. However, in the presently disclosed patent, there is no report on screening of Guan Yisheng lactobacillus reuteri and related studies on application of the same to antagonize clostridium perfringens.

Disclosure of Invention

The inventor screens lactobacillus reuteri with remarkable probiotics potential from cecal contents of healthy broilers. The inventors of the present application have confirmed through a large number of experiments that lactobacillus reuteri has high tolerance to high temperature, artificial gastric juice, intestinal juice and the like, and that the strain intestinal epithelial cells have good adhesion, and also has outstanding reuterin synthesis ability, and also has antagonism to clostridium perfringens, and thus have completed the present application.

Accordingly, in a first aspect, the present application provides lactobacillus reuteri, designated lactobacillus reuteri (Limosilactobacillus reuteri) LR21, which is deposited at the China Center for Type Culture Collection (CCTCC) at 2022, month 4 and day 22, with the accession number cctccc No. M2022464 and the accession address of eight ways 299 in the armed forces sector of wuhan, hubei province.

In the present application, the lactobacillus reuteri LR21 has the following characteristics: (1) colony morphology: the bacterial colony is round, milky white, opaque, neat in edge, raised in surface and moist; (2) fungus morphology: gram positive bacillus, blunt ends, short rod and long rod without producing spores; (3) growth characteristics: the culture medium is facultative anaerobic, liquid MRS culture medium is cultured for 4 hours and then enters the logarithmic growth phase, and 10 hours enter the stationary phase; lactic acid and carbon dioxide are produced during growth; (4) The 16S rDNA sequence of the lactobacillus reuteri is shown as SEQ ID No. 1. The 16S rDNA sequence was identified as Lactobacillus reuteri by BLAST alignment (Limosilactobacillus reuteri).

In the present application, the lactobacillus reuteri LR21 has at least the following probiotic properties: (1) The survival rate of the product is 97.75 percent after 3 hours of treatment in artificial gastric juice with pH of 2.5; (2) Treating in artificial intestinal juice at pH7.8 for 3 hrThe survival rate is 98.72%; (3) After being treated at the high temperature of 75 ℃ for 5min, the viable count is maintained at 10 ⁶ CFU/mL; (4) In the in vitro epithelial cell model, the number of viable bacteria adhered to the surface of the epithelial cells after the lactobacillus treatment for 3 hours was about 10 ⁷ CFU/mL, adhesion was 77.19%.

In a second aspect, a microbial agent is provided comprising the lactobacillus reuteri.

In a third aspect, a starter comprising the lactobacillus reuteri is provided.

In certain embodiments, the starter comprises a reuterin.

In certain embodiments, the starter is obtained by fermenting a composition comprising glycerol with the lactobacillus reuteri.

In certain embodiments, solid or liquid media providing nutrients are also included in the composition.

In certain embodiments, the use of the lactobacillus reuteri or the microbial agent or the fermenting agent in the manufacture of a microbial additive for inhibiting clostridium perfringens (Clostridium perfringens) growth, biofilm formation and virulence gene expression.

In certain embodiments, the lactobacillus reuteri or the microbial agent or the starter agent is used in the preparation of a feed additive.

In summary, the application has the following beneficial effects:

the lactobacillus reuteri LR21 provided by the application has higher tolerance to high temperature, artificial gastric juice, intestinal juice and the like, and has good adhesion of intestinal epithelial cells of the strain and stronger stress resistance.

The lactobacillus reuteri LR21 provided by the application has outstanding reuterin synthesis capability, and various active ingredients generated in the fermentation process have obvious inhibition effects on clostridium perfringens growth, toxin synthesis and the like, and has the potential of being developed into a novel microbial additive for preventing clostridium perfringens infection.

Drawings

FIG. 1 is a colony morphology of Lactobacillus reuteri.

FIG. 2 is a graph showing the in vitro bacteriostatic effect of Lactobacillus reuteri LR21 fermentation supernatant on Clostridium perfringens.

FIG. 3 shows high performance liquid chromatograms of 3-hydroxypropionaldehyde and LR21 glycerol fermentation supernatants. Fig. 3A: 3-hydroxy propanal standard substance high performance liquid chromatogram; fig. 3B: chromatograms of glycerol fermentation supernatants of LR21 strains; fig. 3C: chromatograms of LR21 strain glycerol fermentation supernatants after silica gel column chromatography.

Fig. 4 is a graph showing the in vitro bacteriostatic effect of LR21 glycerol fermentation supernatant on clostridium perfringens.

FIG. 5 is the effect of Lactobacillus reuteri LR21 glycerol fermentation supernatant on Clostridium perfringens cell morphology. Fig. 5A: untreated clostridium perfringens Cp13124 cell morphology; fig. 5B: morphology of 1×mic LR 21-derived reuterin-treated Cp13124 cells; fig. 5C: morphology of 2×mic LR 21-derived reuterin-treated Cp13124 cells.

FIG. 6 shows the results of a test of the formation of a clostridium perfringens biofilm by lactobacillus reuteri LR21 glycerol fermentation supernatant.

FIG. 7 shows the results of a test of the expression of clostridium perfringens virulence genes by lactobacillus reuteri LR21 glycerol fermentation supernatant.

FIG. 8 shows the results of an experiment of growth of Lactobacillus reuteri LR21 on Clostridium perfringens under in vitro culture conditions. Cp in the legend is Cp alone 13124 culture control; co is LR21 and Cp13124 bacterial liquid mixed culture group; CG was LR21 and Cp13124 mixed culture and medium was additionally supplemented with 250mM Gan Youzu.

Detailed Description

Example 1 isolation and identification of strains

The strain of the application is separated from cecum contents of healthy broilers, and the specific separation and screening method is as follows:

0.1g of the contents was added to 1mL of 0.01M sterilized phosphate buffer (pH=7.84), mixed well, diluted 10-fold gradient, and 100. Mu.L of 10 was aspirated ^-4 、10 ^-5 Dilution ofThe liquid is coated on an MRS solid agar plate containing 4% calcium carbonate, after culturing for 48 hours at 37 ℃, single colony with obvious calcium dissolving ring is selected, after culturing for 24 hours in MRS liquid culture medium, bacterial liquid is dipped for secondary streaking, and thus, the purification is considered to be completed after repeated streaking and purifying culture for 3 times.

The culture of the fermentation medium in the application is as follows: 1000mL of double distilled water, 10g of tryptone, 5g of yeast powder, 10g of beef powder, 5g of anhydrous sodium acetate, 2g of dipotassium hydrogen phosphate, 2g of triammonium citrate, 0.41g of magnesium sulfate heptahydrate, 0.05g of manganese sulfate, 1mL of Tween 80 and 20g of glucose are independently sterilized, the pH is adjusted to 5.5-6.5, the high temperature and high pressure sterilization is carried out for 20min at 121 ℃, 2% of agar powder is added into a solid MRS culture medium, and 4% (W/V) of calcium carbonate is additionally added into the solid MRS culture medium containing calcium carbonate.

Further, after amplification of the selected target strain, genomic DNA was extracted using universal primer 27F: agagttttgatcctggcttag and 1492R: GGTTACCTTGTTACGACTT, 16S rDNA fragment thereof was amplified, and specificity of PCR amplified product was detected by agarose gel electrophoresis. The obtained specific target fragment sequence information was uploaded to NCBI database for alignment analysis, and was identified as Lactobacillus reuteri (Limosilactobacillus reuteri).

EXAMPLE 2 stress resistance and probiotic Property study of Lactobacillus reuteri

1. Test for resistance to gastric juice

The preparation method of the artificial gastric juice comprises the following steps: 1g of 3000U/g pepsin is weighed and dissolved in 90mL of 0.9% physiological saline, after the pepsin is fully dissolved, the pH of the liquid is regulated to 2.5, the volume is regulated to 100mL, and the liquid is filtered and sterilized by a 0.22 mu m filter membrane and stored at 4 ℃ for standby.

The strain was allowed to stand in MRS broth at 37℃overnight. 0.5mL of bacterial liquid was transferred to simulated gastric fluid containing 4.5mL, and incubated at 37℃for 0h, 1h and 3h, and the total viable count (CFU/mL) was measured in each time period by a dilution plate coating method, and the survival rate was calculated using the measured value of 0h as a blank. The calculation formula is as follows: survival = T ₁ Number of live bacteria (lg CFU/mL)/T ₀ The number of viable bacteria (lg CFU/mL) was 100%. Wherein T is ₀ Represent 0h, T ₁ Represents 1h or3h. The results are shown in Table 1:

table 1: tolerance of lactobacillus reuteri LR21 to artificial gastric juice

2. Test of artificial intestinal juice tolerance

The preparation method of the artificial intestinal juice comprises the following steps: weighing 0.1g 2500U/L trypsin and 0.15g pig bile salt, dissolving in 90mL 0.9% physiological saline, adjusting the pH of the liquid to 7.8 after the solution is fully dissolved, then fixing the volume to 100mL, filtering and sterilizing by using a 0.22 mu m filter membrane, and preserving at 4 ℃ for later use.

The strain was allowed to stand in MRS broth at 37℃overnight. 0.5mL of the bacterial liquid was transferred to a simulated intestinal liquid containing 4.5mL, and incubated at 37℃for 0h, 1h and 3h, and the total viable count (CFU/mL) was measured in each time period by a dilution plate coating method, and the survival rate was calculated using the measured value of 0h as a blank. The calculation formula is as follows: survival = T ₁ Number of live bacteria (lg CFU/mL)/T ₀ The number of viable bacteria (lg CFU/mL) was 100%. Wherein T is ₀ Represent 0h, T ₁ Representing 1h or 3h. The results are shown in Table 2:

table 2: tolerance of lactobacillus reuteri LR21 to artificial intestinal juice

3. Intestinal epithelial cell adhesion ability

The recovered Caco-2 cells were cultured at a rate of 5X 10 ⁵ The density of individual/wells was seeded into 12-well plates and fresh complete medium was changed every 24h until cells grew to confluence at the bottom of the wells. The cell complete culture medium had the following composition: 10% fetal bovine serum, 1% 100% penicillin streptomycin and 89% DMEM/F12 basal medium. Meanwhile, the activated LR21 bacterial liquid is centrifuged and then the sediment is collected, and after the bacterial sediment is washed by sterilized PBS, the OD of the bacteria is regulated _600nm The value is about 1.0 (1.0.+ -. 0.05). After removing the cell culture supernatant, 500. Mu.L LR21-PBS suspension is added, and incubation is continued for 1h and 3h, and each time period is performed3 organisms were treated repeatedly. After the incubation was completed, the bacterial suspension was discarded, and after 3 careful washes of the cells with sterilized PBS, 200. Mu.L of sterile 1% Triton X-100 was added and the lysed cells were blown down. After 10-fold gradient dilution of the collected cell lysate, the cell lysate was uniformly spread on an MRS plate, incubated at 37℃for 24 hours, the number of bacteria adhering to the cell surface in different incubation periods was counted, and the adhesion rate was calculated. The calculation formula is as follows: adhesion rate=t ₁ Number of live bacteria (lg CFU/mL)/T ₀ The number of viable bacteria (lg CFU/mL) was 100%. Wherein T is ₀ Represents 0h, and T1 represents 1h or 3h. The results are shown in Table 3:

table 3: adhesion of lactobacillus reuteri LR21 to intestinal epithelial cells

4. High temperature tolerance test

200. Mu.L of the activated LR21 bacterial liquid was aspirated, and the mixture was re-inoculated into 10mL of clean MRS medium, and subjected to stationary culture at 37℃overnight. And then inoculating the activated bacterial liquid into a 1.5mL sterile centrifuge tube by using a 1 mL/tube, respectively placing the 1.5mL centrifuge tube into a water bath at 37 ℃ and 65 ℃ and 70 ℃, setting 3 repetitions for each treatment temperature, setting the treatment time to be 5min, and finally respectively counting the viable count after the treatment at different temperatures for 5min by using a flat plate dilution coating method. The calculation formula is as follows: t (T) ₁ Viable count (lg CFU/mL)/T after 5min treatment at temperature ₀ Viable count (lg CFU/mL) x 100% after 5min treatment at temperature. Wherein T is ₀ T1 represents 37℃or 65℃or 70℃and the results are shown in FIG. 4:

table 4: results of high temperature tolerance of lactobacillus reuteri LR21

5. Bacteriostasis experiment

After activation of clostridium perfringens ATCC 13124 (Cp 13124) strain, 200 μl of the bacterial suspension was pipetted into 50mL of warm TSC agar medium, wherein each 20mL of the bacterial mixture was poured into a clean petri dish containing oxford cups for preparation of a bacterial agar plate. After the 24h fermentation supernatant of LR21 strain was filtered through 0.22 μm, a partial volume was taken and the pH was neutralized to 6.8 with 1mol/L NaOH, 200 μl of the differently treated LR21 fermentation supernatant was placed into different wells and each treatment was repeated three times. After 24h incubation at 37℃the zone diameters of inhibition of different concentrations of reuterin were determined and compared to a positive control (100. Mu.g/mL ampicillin), sterile MRS medium was used as a negative control.

As can be seen from fig. 2: the LR21 strain 24h fermentation supernatant has obvious antibacterial effect on Cp13124, and the diameter of the antibacterial circle is equivalent to that of a positive control treatment result. In addition, the fermentation supernatant after neutralization of the pH has no obvious antibacterial effect on Cp13124, which indicates that the main antibacterial substance of the fermentation supernatant of the LR21 strain MRS culture medium (without glycerol) is organic acid.

EXAMPLE 3 Leucothrin Synthesis

The bacterial strain was allowed to stand in MRS liquid medium at 37℃overnight, and then the pellet was collected, washed 3 times with sterile PBS, and centrifuged again to weigh the fresh weight of the pellet. A250 mM glycerol-PBS suspension was prepared, and after the bacterial pellet was sufficiently resuspended in 40mg/mL glycerol-PBS suspension, the culture was allowed to continue to stand at 37℃for 4 hours, and the supernatant was collected by centrifugation.

EXAMPLE 4 identification and purification of Lewy elements

And (3) identifying whether the strain glycerol fermentation supernatant contains the reuterin by using a high performance liquid chromatography method. And (3) adopting an Agilent-1200 detection device, taking 10mM dilute sulfuric acid as an eluent, simultaneously utilizing a light-indicating differential detector to collect chromatographic peak signals, and comparing a 3-hydroxy propanal standard chromatogram with a known concentration to judge whether the sample contains the reuterin. In addition, the strain glycerol fermentation broth was purified by silica gel column chromatography. First, a mixture of ethyl acetate and acetone at a ratio of 1:2 is used as an eluent, and 200 mesh silica gel is used as a filler. After the preparation and inspection of the silica gel column are finished, a proper amount of eluent is taken to be mixed with glycerol fermentation liquor containing the reuterin, the mixture is slowly added into the silica gel column, liquid components flowing through the silica gel column are collected under normal pressure, and a new centrifuge tube is replaced after 5mL of liquid is collected. The chromatograms of the 1 mol/L3-hydroxy propanal standard, the glycerol fermentation supernatant before and after purification are shown in figure 3.

As can be seen from fig. 3: the chromatogram of the 3-hydroxypropanal standard solution contains two main peaks, and the elution time is 16.5min and 19.5min respectively, which means that the standard solution contains another 3-hydroxypropanal monomer, such as 3-hydroxypropanal in the forms of hydrate and dimer. In addition, the glycerol fermentation broth of the LR21 strain before and after purification has elution peaks at 16.5min and 19.5min, and the chromatographic peak of the glycerol fermentation broth after purification is more obvious. The results demonstrate that the presence of reuterin in glycerol fermentation broth of LR21 strain and its composition was similar to the standard; meanwhile, the glycerol fermentation liquid after silica gel column chromatography contains the higher-purity reuterin.

EXAMPLE 5 Leucomycin assay

The method for measuring the content of the reuterin in the strain glycerol fermentation supernatant is as follows: an appropriate amount of DL-tryptophan was weighed and dissolved in 5mM dilute hydrochloric acid to obtain a 10mM DL-tryptophan solution. Using the principle that tryptophan reacts with aldehydes under strong acid conditions, 225. Mu.L of tryptophan solution and 300. Mu.L of the reuterin solution obtained in example 3 are respectively absorbed into 900. Mu.L of concentrated hydrochloric acid (37% HCL), the reaction is carried out for 20min in a 37 ℃ water bath, and then 200. Mu.L of reaction solution is taken out to determine the optical density value at 560 nm. By establishing different known concentrations of 3-hydroxypropionaldehyde and OD _560nm Standard curves between the values, calculated the yield of the strain synthesized reuterin. The LR21 strain was calculated to have a concentration of about 138.5mM of reuterin in the 4h glycerol fermentation broth.

Example 6 influence of Leucothrin on Clostridium perfringens growth

1. Minimum inhibitory concentration determination

The minimal inhibitory concentration of reuterin on Cp13124 was determined using a microburst dilution method. Cp13124 cultures were suspended in sterile PBS and brought to 0.5 McAlt turbidity. The purified solution of reuterin obtained in example 5 was cultured with sterile MRS broth and added to 96-well plates in a volume of 190. Mu.L at each concentration. Subsequently, 10. Mu.L of fine was added to each wellAfter the bacterial suspension was allowed to stand for 12h, the Optical Density (OD) of each well at 600nm was measured. MRS culture medium additive well without reuterin is used as negative control group, OD _600nm The corresponding concentration of reuterin without a significant increase in value was defined as the minimum inhibitory concentration and the specific results are shown in table 5:

table 5: optical Density values of Cp13124 after incubation for 12h with different concentrations of reuterin

The results in Table 5 show that the minimum inhibitory concentration of the reuterin obtained in example 4 on Cp13124 is 8.7. 8.7 mM.

2. Agar diffusion test

After activation of clostridium perfringens ATCC 13124 (Cp 13124) strain, 200 μl of the bacterial suspension was pipetted into 50mL of warm TSC agar medium, wherein each 20mL of the bacterial mixture was poured into a clean petri dish containing oxford cups for preparation of a bacterial agar plate. The purified solution of reuterin obtained in example 4 was diluted with MRS medium and 200. Mu.L of different concentrations of reuterin were placed in different wells, each concentration being repeated three times. After 24h incubation at 37℃the zone diameters of inhibition of different concentrations of reuterin were determined and compared to a positive control (100. Mu.g/mL ampicillin), sterile MRS medium was used as a negative control.

As can be seen from fig. 4: the reuterin has obvious antibacterial effect on Cp13124 at the concentration of 8.7mM, and the antibacterial effect of the reuterin at the concentration of 17.3 and mM is better than that of 100 mug/mL ampicillin.

3. Effect of Leucothrin on Clostridium perfringens cell membrane integrity

After activation of clostridium perfringens ATCC 13124 (Cp 13124) strain, 1mL of bacterial liquid was pipetted into 10mL of MRS liquid medium containing 1×mic and 2×mic reuterin purified liquid, after incubation for 12h at 37 ℃, centrifuged at 8000rpm for 5min, washed 3 times with sterilized PBS, and the washed bacterial pellet was fixed in 2.5% glutaraldehyde for subsequent transmission electron microscopy sample preparation.

As can be seen from fig. 5: after 12h of culture in 1×mic or 2×mic reuterin-containing medium, cp13124 cell morphology was significantly altered. Compared with the normal MRS culture medium, the addition of the reuterin can lead to perforation and rupture of bacterial cell membranes, leakage of cytoplasmic contents and outflow, so that the whole bacteria are in a cavitation state.

Example 7 in vitro inhibition assay of biofilm formation by Lewy elements

The minimum biofilm inhibition concentration of the reuterin on Cp13124 was determined using crystal violet staining. Cp13124 was cultured overnight at 37℃and ready for use. The purified reuterin solution from example 4 was diluted 2-fold in fresh MRS broth, 200. Mu.L of each dilution was added to 96-well plates, and each concentration was replicated 4 times. Adjusting the concentration of Cp13124 bacteria solution, and sucking 20. Mu.L of the bacteria solution into each well to obtain a final concentration of bacteria of about 10 ⁶ CFU/mL. The non-inoculated MRS broth without the reuterin was used as a negative control, and the broth with Cp13124 alone was used as a positive control. After anaerobic incubation for 24h, planktonic bacteria were removed by washing 2 times with sterile PBS and stained with 200. Mu.L of 1% crystal violet for 10 min at room temperature. After washing again 2 times, the stained biofilm was extracted with 200 μl of 100% ethanol and the bacterial biofilm mass was reflected in absorbance of the extract at 595nm, see fig. 6 for specific results.

As can be seen from fig. 6: when the concentration of the reuterin is higher than the minimum inhibitory concentration, the formation of bacterial biofilms is obviously inhibited; when the concentration of the reuterin is lower than the minimum inhibitory concentration, the formation of Cp13124 biological film is obviously inhibited after the treatment of the concentration of the reuterin is only 4.3mM, and no obvious inhibition effect is generated after the treatment of the lower concentration of the reuterin.

Example 8 influence of Leucothrin on clostridium perfringens virulence Gene expression

After overnight incubation of clostridium perfringens ATCC 13124 (Cp 13124) strain, centrifugation was washed 3 times, followed by resuspension of bacterial pellet with sterilized PBS and 2×mic-containing reuterin PBS buffer, respectively, after incubation at 37 ℃ for 2h, centrifugation was performed and Cp13124 bacterial RNA was extracted with bacterial RNA extraction kit from nanking norbizan company for subsequent inversion and detection of gene quantitative expression, see fig. 7 for specific results.

As can be seen from fig. 7: 2 XMIC reuterin treatment significantly reduced the expression levels of Cp13124 alpha toxin (clostridium perfringens alpha toxin, cpa), cytolysin (pfo), agrB gene, luxS gene.

Example 9 influence of Lactobacillus reuteri LR21 on Clostridium perfringens growth

Simultaneously inoculating activated LR21 and Cp13124 bacterial solutions into fresh MRS liquid culture medium according to the volume ratio of 2%, and marking the treatment as a Co-culture group (Co group); in addition, both strains were inoculated into MRS liquid medium containing 250mM glycerol, and this treatment was labeled co-culture plus Gan Youzu (CG group). Meanwhile, the control group (Cp group) was treated as a single inoculation with 2% Cp13124 bacteria solution. Each group was set up with 3 biological replicates. After each group is put into a 37 ℃ incubator to be respectively incubated for 2, 6 and 10 hours, a proper amount of bacterial liquid is absorbed for flat plate coating, and the Cp13124 bacterial numbers under different treatment conditions of different incubation times are counted. The specific results are shown in figure 8.

As can be seen from fig. 8: co-cultivation for 2 hours in the presence of LR21 alone resulted in a decrease in the number of Cp13124 bacteria in the broth; in the case of the additional addition of glycerol to the culture broth, the LR21 co-culture again resulted in a greater reduction in the number of Cp13124 bacteria. When glycerol was co-cultured and added, the number of Cp13124 bacteria was reduced to around 10 CFU/mL at 6 h, and after 10h bacteria was reduced to below 10 CFU/mL. The above results indicate that glycerol greatly enhances the inhibitory effect of lactobacillus reuteri LR21 on clostridium perfringens growth, as LR21 converts part of the glycerol to reuterin during fermentation.

The specific embodiments described herein are offered by way of example only to illustrate the spirit of the application. Those skilled in the art may make various modifications or additions to the described embodiments or substitutions thereof without departing from the spirit of the application or exceeding the scope of the application as defined in the accompanying claims.

Claims (8)

1. The lactobacillus reuteri is characterized in that the lactobacillus reuteri is lactobacillus reuteri (Limosilactobacillus reuteri) LR21, and the strain is preserved in China Center for Type Culture Collection (CCTCC) No. M2022464 in 4-month 22 of 2022, and the preservation address is eight paths 299 of Wuchang district in Wuhan, hubei province.

2. A microbial inoculum comprising the Lactobacillus reuteri according to claim 1.

3. A starter culture comprising the Lactobacillus reuteri of claim 1.

4. A starter according to claim 3, wherein the starter comprises reuterin.

5. A starter according to claim 3, wherein the starter is obtained by fermentation of a composition comprising glycerol with the lactobacillus reuteri.

6. A starter according to claim 5, wherein the composition further comprises a solid or liquid medium providing nutrients.

7. Use of lactobacillus reuteri according to claim 1 or the microbial agent of claim 2 or the starter culture of claim 3 for the preparation of a microbial additive for inhibiting clostridium perfringens (Clostridium perfringens) growth, biofilm formation and virulence gene expression.

8. Use of lactobacillus reuteri according to claim 1 or a microbial agent according to claim 2 or a starter according to claim 3 for the preparation of a feed additive.