CN115838652A - Lactobacillus reuteri LR21 and application thereof - Google Patents

Abstract

The invention relates to a Lactobacillus reuteri, which is Lactobacillus reuteri 21 (LR 21); the strain is preserved in China Center for Type Culture Collection (CCTCC) at 22.22.4.2022, with the preservation number of M2022464, and the preservation address of Wuhan city, hubei, is No. 299 in Bayi. The lactobacillus reuteri has high tolerance to high temperature, artificial gastric juice, intestinal juice and the like, has good adhesion of intestinal epithelial cells of strains, has outstanding synthesis capacity of reuterin, has antagonistic action on clostridium perfringens, and has the potential of being developed into a novel microbial additive for preventing clostridium perfringens infection.

Description

Lactobacillus reuteri LR21 and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to lactobacillus reuteri and application thereof.

Background

Clostridium perfringens is an anaerobic gram-positive bacillus, classified into 7 serotypes a-G, depending on the exotoxin secreted, and poultry are mainly infected with clostridium perfringens type a and type C. After the clostridium perfringens infects poultry, a large amount of clostridium perfringens proliferates in intestinal tracts under the promotion of various environmental inducements and secretes toxins, and finally causes necrotic enteritis in chickens, wherein main symptoms of the necrotic enteritis are manifested by cachexia, disordered feathers, burnt coal oil or bloody stool, appetite reduction and serious reduction of production performance, and after a reckoning examination, the intestinal wall of a small intestine becomes thin and is full of gas, and the intestinal mucosa has dispersive or large-area hemorrhagic necrosis. The prevention and control of necrotic enteritis for a long time mainly depends on the addition of antibiotics in feed, but with the prohibition of feed antibiotics, the disease is frequently seen all over the world, and huge economic losses are brought to the poultry industry all over the world each year. Therefore, the search for new antibiotic alternatives for the control of necrotic enteritis is a current problem to be solved by poultry farming.

Probiotics are a class of living microorganisms that, when ingested in certain quantities, produce beneficial effects on the health of the host. The probiotics have various biological activities, and can reduce the number of harmful bacteria in the intestinal tract, such as clostridium perfringens, and inhibit the synthesis of toxins of the harmful bacteria in the intestinal tract by changing the acid-base environment of the intestinal tract, synthesizing antibacterial substances, competitively adhering epithelial cells of the intestinal tract and the like. Increasing research results indicate that probiotics are an effective way to prevent clostridium perfringens infection. Lactobacillus reuteri is one of few kinds of original bacteria in the intestinal tract of animals, and has good gastrointestinal fluid tolerance and intestinal mucosa adhesion capability. Under anaerobic conditions, lactobacillus reuteri can also take glycerol as a substrate, and a bacteriocin named reuterin is generated under the catalysis of intracellular glycerol dehydratase. The bacteriocin is a non-protein broad-spectrum antibacterial agent which mainly comprises 3-hydroxypropionaldehyde, and simultaneously contains 3-hydroxypropionaldehyde dimer and 3-hydroxypropionaldehyde hydrate, has obvious bacteriostatic and bactericidal effects on various intestinal pathogenic bacteria such as salmonella, colibacillus, campylobacter jejuni, clostridium difficile and the like, has the advantages of low toxicity, wide safety range, no generation of bacterial drug resistance and the like, and is a natural antibiotic substitute. In conclusion, lactobacillus reuteri is an ideal probiotic screening and development source. However, in the presently published patents, no studies have been reported on the screening and application of probiotic lactobacillus reuteri to antagonize clostridium perfringens.

Disclosure of Invention

The inventor of the application screens out a strain of lactobacillus reuteri with remarkable probiotic potential from the caecum content of healthy broiler chickens. The inventor proves through a large number of experiments that the lactobacillus reuteri has higher tolerance to high temperature, artificial gastric juice, intestinal juice and the like, has good adhesion of intestinal epithelial cells of strains, has outstanding synthesis capacity of reuterin, and has antagonistic action on clostridium perfringens, and thus the invention is completed.

Therefore, in the first aspect, the invention provides a Lactobacillus reuteri strain named Lactobacillus reuteri LR21, which is preserved in China Center for Type Culture Collection (CCTCC) at 22 months 4 and 2022, with the preservation number of CCTCC NO: M2022464 and the preservation address of No. 299 of eight paths in Wuchang region of Wuhan city, hubei province.

In the present invention, the lactobacillus reuteri LR21 has the following characteristics: (1) colony morphology: the bacterial colony is round, milky white and opaque, the edge is neat, and the surface is raised and wet; (2) cell morphology: gram-positive bacilli, blunt round two ends, short rod, long rod shape, no spore production; (3) growth characteristics: performing facultative anaerobic culture, wherein the liquid MRS culture medium enters a logarithmic growth phase after being cultured for 4 hours, and the liquid MRS culture medium enters a stationary phase after 10 hours; lactic acid and carbon dioxide are produced during the growth process; (4) The 16S rDNA sequence of the Lactobacillus reuteri is shown in SEQ ID No. 1. The 16S rDNA sequences were aligned by BLAST and identified as Lactobacillus reuteri (Lactobacillus reuteri).

In the present invention, the lactobacillus reuteri LR21 has at least the following probiotic properties: (1) After being treated in artificial gastric juice with the pH value of 2.5 for 3 hours, the survival rate is 97.75 percent; (2) The survival rate of the treated intestinal juice is 98.72 percent after being treated in the artificial intestinal juice with the pH value of 7.8 for 3 hours; (3) After being treated at 75 ℃ for 5min, the viable count is maintained at 10 ⁶ CFU/mL; (4) In the in vitro epithelial cell model, the number of viable bacteria adhered to the surface of the epithelial cell after 3 hours of lactobacillus treatment is about 10 ⁷ CFU/mL, adhesion 77.19%.

In a second aspect, there is provided a bacterial agent comprising said lactobacillus reuteri.

In a third aspect, there is provided a starter culture comprising said lactobacillus reuteri.

In certain embodiments, the fermentation agent comprises reuterin.

In certain embodiments, the starter is obtained by fermenting a composition comprising glycerol with the lactobacillus reuteri.

In certain embodiments, solid or liquid media providing nutrients are also included in the compositions.

In certain embodiments, the use of said lactobacillus reuteri or said microbial agent or said fermentation agent in the manufacture of a microbial additive for inhibiting clostridium perfringens growth, biofilm formation and expression of virulence genes.

In certain embodiments, the use of said lactobacillus reuteri or said microbial or said fermentation agent in the preparation of a feed additive.

In conclusion, the invention has the following beneficial effects:

the Lactobacillus reuteri LR21 provided by the invention has higher tolerance to high temperature, artificial gastric juice, intestinal juice and the like, and the strain has good intestinal epithelial cell adhesion and stronger stress resistance.

The lactobacillus reuteri LR21 provided by the invention has outstanding synthesis capacity of reuterin, has obvious inhibition effects on growth, toxin synthesis and the like of clostridium perfringens by various active ingredients generated in the fermentation process, and has the potential of being developed into a novel microbial additive for preventing clostridium perfringens infection.

Drawings

FIG. 1 is a morphological diagram of a Lactobacillus reuteri colony.

FIG. 2 is a diagram showing the in vitro bacteriostatic effect of Lactobacillus reuteri LR21 fermented supernatant on Clostridium perfringens.

FIG. 3 is a high performance liquid chromatogram of the supernatant from the fermentation of 3-hydroxypropanal and LR21 glycerol. FIG. 3A: high performance liquid chromatogram of 3-hydroxy propionaldehyde standard substance; FIG. 3B: chromatogram of glycerol fermentation supernatant of LR21 strain; FIG. 3C: chromatogram of glycerol fermentation supernatant of LR21 strain after silica gel column chromatography.

FIG. 4 is a graph showing the in vitro bacteriostatic effect of LR21 glycerol fermentation supernatant on Clostridium perfringens.

FIG. 5 shows the effect of Lactobacillus reuteri LR21 glycerol fermentation supernatant on Clostridium perfringens cell morphology. FIG. 5A: a cell morphology of untreated clostridium perfringens Cp 13124; FIG. 5B: LR 21-derived reuterin-treated Cp13124 cell morphology at 1 × MIC; FIG. 5C: LR21 derived reuterin treated Cp13124 cell morphology at 2 × MIC.

FIG. 6 shows the results of the test of Clostridium perfringens biofilm formation by Lactobacillus reuteri LR21 glycerol fermentation supernatant.

FIG. 7 shows the results of the experiment of the expression of virulence genes of Clostridium perfringens by the supernatant of Lactobacillus reuteri LR21 glycerol fermentation.

FIG. 8 shows the results of the in vitro culture of Lactobacillus reuteri LR21 against Clostridium perfringens growth. In the legend, cp is Cp13124 alone culture control group; co is LR21 and Cp13124 bacteria liquid mixed culture group; CG was LR21 and Cp13124 mixed culture and the medium was supplemented with an additional 250mM glycerol group.

Detailed Description

Example 1 isolation and characterization of strains

The strain is separated from the caecum content of healthy broiler chickens, and the specific separation and screening method comprises the following steps:

adding 0.1g of the content to 1mL of 0.01M sterile phosphate buffer (pH = 7.84), mixing, diluting with 10-fold gradient, and sucking 100. Mu.L of 10 ^-4 、10 ^-5 Coating the diluent on an MRS solid agar plate containing 4% calcium carbonate, culturing at 37 ℃ for 48h, selecting a single colony with an obvious calcium-dissolving ring, culturing in an MRS liquid culture medium for 24h, dipping bacterial liquid, streaking again, and repeatedly streaking, purifying and culturing for 3 times to determine that the purification is finished.

The culture of the fermentation medium comprises the following steps: 1000mL of double distilled water, 10g of tryptone, 5g of yeast powder, 10g of beef powder, 5g of anhydrous sodium acetate, 2g of dipotassium phosphate, 2g of triammonium citrate, 0.41g of magnesium sulfate heptahydrate, 0.05g of manganese sulfate, 1mL of Tween 80, 20g of glucose, independent sterilization, pH adjustment to 5.5-6.5, high-temperature and high-pressure sterilization at 121 ℃ for 20min, 2% of agar powder added into a solid MRS culture medium, and 4% (W/V) of calcium carbonate added into a solid MRS culture medium.

Further, after the screened target strains are amplified, genome DNA is extracted, and a universal primer 27F: AGAGTTTGATCCTGGCTCAG and 1492R: GGTTACCTTGTTACGACTT, 16S rDNA segment is amplified, and agarose gel electrophoresis is used for detecting the specificity of PCR amplification products. And uploading the obtained sequence information of the specific target fragment to an NCBI database for comparison and analysis, and identifying the specific target fragment as Lactobacillus reuteri (Lactobacillus reuteri).

Example 2 study of stress resistance and probiotic Properties of Lactobacillus reuteri

1. Simulated gastric fluid resistance test

The preparation method of the artificial gastric juice comprises the following steps: weighing 1g 3000U/g pepsin, dissolving in 90mL 0.9% physiological saline, fully dissolving, adjusting pH of the liquid to 2.5, metering volume to 100mL, filtering with 0.22 μm filter membrane for sterilization, and storing at 4 ℃ for later use.

The strain is statically cultured in MRS liquid medium at 37 ℃ overnight. Transferring 0.5mL of bacterial solution into 4.5mL of simulated gastric juice, culturing at 37 deg.C for 0h, 1h, and 3h, measuring total viable bacteria (CFU/mL) at each time period by dilution plate coating method, and calculating survival rate by using 0h measured value as blank control. The calculation formula is as follows: survival = T ₁ Number of viable hour (lg CFU/mL)/T ₀ The viable count (lg CFU/mL) is multiplied by 100 percent. Wherein, T ₀ Represents 0h, T ₁ Represents 1h or 3h. The results are shown in table 1:

table 1: tolerance of Lactobacillus reuteri LR21 to artificial gastric juice

2. Test for tolerance to Artificial intestinal juice

The preparation method of the artificial intestinal juice comprises the following steps: 0.1g of 2500U/L trypsin and 0.15g of fel Sus Domestica salt are weighed and dissolved in 90mL of 0.9% physiological saline, after the trypsin and the fel Sus Domestica salt are fully dissolved, the pH of the liquid is adjusted to 7.8, then the volume is determined to be 100mL, the liquid is filtered and sterilized by a 0.22 mu m filter membrane, and the liquid is stored for standby at 4 ℃.

The strain is statically cultured in MRS liquid medium at 37 ℃ overnight. Transferring 0.5mL of the bacterial liquid into 4.5mL of simulated intestinal liquid, culturing at 37 deg.C for 0h, 1h, and 3h, measuring total viable bacteria (CFU/mL) at each time period by dilution plate coating method, and calculating survival rate by using the measured value of 0h as blank control. The calculation formula is as follows: survival = T ₁ Number of viable hour (lg CFU/mL)/T ₀ The viable count (lg CFU/mL) is multiplied by 100 percent. Wherein，T ₀ Represents 0h, T ₁ Represents 1h or 3h. The results are shown in table 2:

table 2: tolerance of Lactobacillus reuteri LR21 to artificial intestinal fluids

3. Intestinal epithelial cell adhesion capacity

The recovered Caco-2 cells are expressed as 5X 10 ⁵ The density of cells/well was plated in 12-well plates and fresh complete medium was changed every 24h until the cells grew to cover the entire well bottom. The complete cell culture solution comprises the following components: 10% fetal bovine serum, 1% 100 × streptomycin and 89% DMEM/F12 basal medium. Meanwhile, centrifuging activated LR21 bacterial liquid, collecting precipitate, washing the bacterial precipitate with sterilized PBS, and adjusting OD of bacteria _600nm The value is about 1.0 (1.0 +/-0.05). After removing the cell culture supernatant, adding 500. Mu.L of LR21-PBS suspension, continuing incubation for 1h and 3h, and repeating the treatment for 3 organisms in each time period. After incubation, the bacterial suspension was discarded, the cells were carefully washed 3 times with sterile PBS, 200. Mu.L of sterile 1% TritonX-100 was added, and the lysed cells were blown up. After being diluted by 10 times of gradient, the collected cell lysate is evenly coated on an MRS plate and incubated for 24h at 37 ℃, the number of bacteria adhered to the surface of the cell in different incubation periods is counted, and the adhesion rate is calculated. The calculation formula is as follows: adhesion ratio = T ₁ Number of viable hour (lg CFU/mL)/T ₀ The viable count (lg CFU/mL) is multiplied by 100 percent. Wherein, T ₀ Denoted 0h, T1 1h or 3h. The results are shown in table 3:

table 3: adherence of lactobacillus reuteri LR21 to intestinal epithelial cells

4. High temperature resistance test

Sucking 200. Mu.L of activated LR21 bacterial liquid, inoculating into 10mL of clean MRS culture medium again, and standing and culturing overnight at 37 ℃. Then the activated bacteria liquid is connected to 1.5 by 1 mL/pipePutting 1.5mL of the centrifuge tube into water baths with the temperature of 37 ℃, 65 ℃ and 70 ℃ respectively in mL of sterile centrifuge tubes, setting 3 times of treatment at each treatment temperature for 5min, and finally counting the viable count of 5min treated at different temperatures respectively by using a flat plate dilution coating method. The calculation formula is as follows: t is ₁ Viable count (lg CFU/mL)/T after treatment for 5min at temperature ₀ Viable count (lg CFU/mL) multiplied by 100% after 5min treatment at temperature. Wherein T is ₀ Expressed at 37 ℃ and T1 at 65 ℃ or 70 ℃ and the results are shown in FIG. 4:

table 4: LR21 high temperature tolerance results for Lactobacillus reuteri

5. Experiment for inhibiting bacteria

After the clostridium perfringens strain ATCC 13124 (Cp 13124) was activated, 200 μ L of the bacterial suspension was aspirated and inoculated into 50mL of warm TSC agar medium, wherein each 20mL of the bacteria-containing mixed solution was poured into a clean petri dish with an oxford cup for preparing bacteria-containing agar plates. After filtration of the LR21 strain 24h fermentation supernatant at 0.22 μm, a portion of the volume was neutralized to pH 6.8 with 1mol/L NaOH, and 200 μ L of the LR21 fermentation supernatant from different treatments were placed in different wells, each treatment being repeated three times. After incubation for 24h at 37 ℃, the diameter of the zone of inhibition for different concentrations of reuterin was determined and compared to a positive control (100 μ g/mL ampicillin) with sterile MRS medium as a negative control.

As can be seen from fig. 2: the LR21 strain 24h fermentation supernatant has obvious bacteriostatic effect on Cp13124, and the diameter of the bacteriostatic circle of the LR21 strain is equivalent to that of a positive control treatment result. In addition, the fermentation supernatant after pH neutralization has no obvious bacteriostatic effect on Cp13124, which indicates that the main bacteriostatic substance of the LR21 strain MRS culture medium (without glycerol) fermentation supernatant is organic acid.

Example 3 Roisein Synthesis

The strain is statically cultured in MRS liquid culture medium at 37 ℃ overnight, then the precipitate is collected, washed for 3 times by sterile PBS, and then the fresh weight of the bacterial precipitate is centrifugally weighed again. After preparing 250mM glycerol-PBS suspension and then fully suspending the bacterial pellet with 40mg/mL glycerol-PBS suspension, the supernatant was collected by centrifugation after further standing at 37 ℃ for 4 hours.

Example 4 identification and purification of Roxiella

And identifying whether the strain glycerol fermentation supernatant contains the reuterin by using a high performance liquid chromatography. And (3) adopting Agilent-1200 detection equipment, taking 10mM dilute sulfuric acid as an eluent, simultaneously collecting a chromatographic peak signal by using a refraction difference detector, and comparing a chromatogram map of a 3-hydroxypropionaldehyde standard with a known concentration to judge whether the sample contains the reuterin. In addition, the reuterin in the strain glycerol fermentation liquor is purified by a silica gel column chromatography method. First, a mixture of ethyl acetate and acetone 1:2 was used as an eluent, and 200 mesh silica gel was used as a filler. After the silica gel column preparation inspection is finished, mixing a proper amount of eluent with the glycerol fermentation liquor containing the reuterin, slowly adding the mixture into the silica gel column, collecting liquid components flowing through the silica gel column under normal pressure, and replacing a centrifugal tube after every 5mL of liquid is collected. Chromatogram of 1 mol/L3-hydroxypropionaldehyde standard, and glycerol fermentation supernatant before and after purification are shown in figure 3.

As can be seen from FIG. 3: the chromatogram of the 3-hydroxypropanal standard solution contains two main peaks, and the elution time is 16.5min and 19.5min, which means that the standard solution contains 3-hydroxypropanal monomer and other 3-hydroxypropanal in the form of hydrate and dimer. In addition, the glycerol fermentation liquid of the LR21 strain before purification and after purification has elution peaks at 16.5min and 19.5min, and the chromatographic peak of the glycerol fermentation liquid after purification is more obvious. The result shows that the LR21 strain has the Roiximab in the glycerol fermentation liquor, and the components of the Roiximab are similar to those of the standard substance; meanwhile, the glycerol fermentation liquor subjected to silica gel column chromatography contains the Roixin with higher purity.

Example 5 Roy Yi bacteriocin content determination

The method for measuring the content of the roxburghin in the strain glycerol fermentation supernatant comprises the following steps: an appropriate amount of DL-tryptophan was weighed and dissolved in 5mM diluted hydrochloric acid to obtain a 10mM DL-tryptophan solution. By means of reactions of tryptophan with aldehydes under strongly acidic conditionsIn principle, 225. Mu.L of tryptophan solution and 300. Mu.L of the Roiximab solution obtained in example 3 were each pipetted into 900. Mu.L of concentrated hydrochloric acid (37% HCl) and reacted in a water bath at 37 ℃ for 20 minutes, and then 200. Mu.L of the reaction solution was taken out and the optical density at 560nm was measured. By establishing different known concentrations of 3-hydroxypropanal and OD _560nm The yield of reuterin synthesized by the strain was calculated from a standard curve between the values. The concentration of reuterin in LR21 strain 4h glycerol fermentation broth was calculated to be about 138.5mM.

Example 6 Effect of Roisella on growth of Clostridium perfringens

1. Determination of minimum inhibitory concentration

The minimal inhibitory concentration of reuterin against Cp13124 was determined by the microtissues dilution method. The Cp13124 culture was suspended in sterile PBS and adjusted to 0.5 mcirometry. The purified liquid of reuterin obtained in example 5 was cultured in sterile MRS broth and added to a 96-well plate in a volume of 190. Mu.L at each concentration. Subsequently, 10. Mu.L of the bacterial suspension was added to each well, and after standing culture for 12h, the optical density value (OD value) at a wavelength of 600nm was measured for each well. MRS medium without Roxiella was used as a negative control group, OD _600nm The corresponding concentration of reuterin without a significant increase in value was defined as the minimum inhibitory concentration, and the specific results are shown in table 5:

table 5: optical density value of Cp13124 after incubation of different concentrations of Roiximab for 12h

The results in Table 5 show that the minimum inhibitory concentration of Roiximab to Cp13124 obtained in example 4 is 8.7 mM.

2. Agar diffusion test

After the clostridium perfringens strain ATCC 13124 (Cp 13124) was activated, 200 μ L of the bacterial suspension was aspirated and inoculated into 50mL of warm TSC agar medium, wherein each 20mL of the bacteria-containing mixed solution was poured into a clean petri dish with an oxford cup for preparing bacteria-containing agar plates. The purified reuterin solution obtained in example 4 was diluted with MRS medium, and 200 μ L of different concentrations of reuterin were put into different wells, each concentration being repeated three times. After incubation at 37 ℃ for 24h, the zone diameters of inhibition were determined for different concentrations of reuterin and compared to a positive control (100. Mu.g/mL ampicillin) with sterile MRS medium as a negative control.

As can be seen in FIG. 4: the Roisella has obvious bacteriostatic effect on Cp13124 at the concentration of 8.7mM, and the bacteriostatic effect of the Roisella is better than that of 100 mug/mL ampicillin at the concentration of 17.3 mM.

3. Effect of Roiximab on the integrity of the cell membranes of Clostridium perfringens

Activating a clostridium perfringens ATCC 13124 (Cp 13124) strain, sucking 1mL of bacterial liquid, inoculating the bacterial liquid into 10mL of MRS liquid culture medium containing 1 × MIC and 2 × MIC Rouyveromycetin purified liquid, culturing at 37 ℃ for 12h, centrifuging at 8000rpm for 5min, washing 3 times by using sterilized PBS, and fixing the washed bacterial precipitate in 2.5% glutaraldehyde for subsequent transmission electron microscope sample preparation.

As can be seen from FIG. 5: after 12h of culture in 1 × MIC or 2 × MIC reuterin-containing medium, cp13124 cell morphology changed significantly. Compared with the normal MRS culture medium, the addition of the reuterin can cause perforation and rupture of bacterial cell membranes, and leakage and outflow of cytoplasmic contents, so that the whole bacteria is in a vacuolated state.

Example 7 in vitro inhibition assay of biofilm formation by Rouyveromycetin

The minimum biofilm inhibitory concentration of reuterin on Cp13124 was determined by crystal violet staining. Cp13124 was incubated overnight at 37 ℃ until use. The purified reuterin from example 4 was diluted in fresh MRS broth in 2-fold gradients, and 200. Mu.L of each dilution gradient was added to a 96-well plate in 4 replicates per concentration. The Cp13124 bacterial liquid concentration was adjusted and 20. Mu.L of bacterial liquid was aspirated and added to each well to give a final bacterial concentration of about 10 ⁶ CFU/mL. The uninoculated MRS broth without reuterin was used as negative control and the broth with Cp13124 alone was used as positive control. After 24h anaerobic incubation, the cells were washed 2 times with sterile PBS to remove planktonic bacteria, and the cells were incubated200 μ L of 1% crystal violet was stained at room temperature for 10 min. Washing for 2 times, extracting the stained biofilm with 200 μ L100% ethanol, and reacting the quality of the bacterial biofilm with the absorbance of the extractive solution at 595nm, with the specific result shown in figure 6.

As can be seen in FIG. 6: when the concentration of the roxburgh bacilli is higher than the minimum inhibitory concentration, the formation of the bacterial biofilm is obviously inhibited; when the concentration of the reuterin is lower than the minimum inhibitory concentration, the formation of the Cp13124 biomembrane is obviously inhibited after the treatment of the concentration of 4.3mM, and no obvious inhibitory effect is produced after the treatment of the reuterin with lower concentration.

Example 8 Effect of Roisella on Clostridium perfringens virulence gene expression

After overnight culture of clostridium perfringens strain ATCC 13124 (Cp 13124), centrifugal washing was performed 3 times, then the bacterial pellets were resuspended with sterilized PBS and PBS buffer containing 2 × MIC reuterin, incubated at 37 ℃ for 2h, centrifuged and Cp13124 bacterial RNA was extracted with bacterial RNA extraction kit of nanjing nuozokean company for subsequent detection of inversion and quantitative gene expression, and the specific results are shown in fig. 7.

As can be seen in FIG. 7: 2 × MIC Roehemodin treatment significantly reduced the gene expression of Cp13124 α toxin (cyclopium perfringens alpha toxin, cpa), cytolysin (pfo) and sialidase I (neuramididase I, nanI), sialidase J (neuramididase J, nanJ).

Example 9 Effect of Lactobacillus reuteri LR21 on the growth of Clostridium perfringens

Inoculating activated LR21 and Cp13124 bacterial liquid into fresh MRS liquid culture medium at 2% volume ratio at the same time, and marking the treatment as a Co-culture group (Co group); in addition, both strains were inoculated into MRS liquid medium containing 250mM glycerol, and this treatment was labeled as a co-cultured plus glycerol group (CG group). Meanwhile, a control group (Cp group) was obtained by inoculating 2% Cp13124 bacterial suspension alone. Each set was set up for 3 biological replicates. And putting the groups into an incubator at 37 ℃ for incubation for 2, 6 and 10 hours respectively, sucking a proper amount of bacterial liquid for plate coating, and counting the number of Cp13124 bacteria under different incubation times and different treatment conditions. The specific results are shown in figure 8.

As can be seen in fig. 8: in the presence of LR21 alone, the Cp13124 bacterial count in the culture solution is reduced after 2h of co-culture; and under the condition of additionally adding glycerol into the culture solution, the LR21 co-culture causes the Cp13124 bacterial number to be reduced to a greater extent. When the cells were co-cultured and added with glycerol, the bacterial count of Cp13124 decreased to about 10 CFU/mL at 6 h, and to 10 CFU/mL or less after 10 h. The above results indicate that glycerol greatly enhances the inhibitory effect of lactobacillus reuteri LR21 on clostridium perfringens growth, due to the fact that LR21 converts part of glycerol into reuterin during fermentation.

The specific embodiments described herein are merely illustrative of the spirit of the invention. Various modifications or additions may be made to the described embodiments or alternatives may be employed by those skilled in the art without departing from the spirit or ambit of the invention as defined in the appended claims.

Claims (8)

1. Lactobacillus reuteri, wherein said Lactobacillus reuteri is Lactobacillus reuteri LR21; the strain is preserved in China Center for Type Culture Collection (CCTCC) No. M2022464 at 22.4.2022, with the preservation address of No. 299 in one of eight places in Wuchang, wuhan, hubei province.

2. A microbial preparation comprising the Lactobacillus reuteri strain according to claim 1.

3. A starter culture comprising the Lactobacillus reuteri strain of claim 1.

4. The starter culture of claim 3, wherein the starter culture comprises reuterin.

5. The starter culture of claim 3, wherein the starter culture is obtained by fermenting a composition comprising glycerol with the Lactobacillus reuteri.

6. A starter culture according to claim 5 wherein the composition further comprises a solid or liquid medium to provide nutrients.

7. Use of lactobacillus reuteri according to claim 1 or the microbial inoculum of claim 2 or the starter culture of claim 3 in the manufacture of a microbial additive for inhibiting clostridium perfringens growth, biofilm formation and virulence gene expression.

8. Use of lactobacillus reuteri according to claim 1 or the bacterial agent according to claim 2 or the starter culture according to claim 3 for the preparation of a feed additive.

Images