CN115820910A - Method for screening wheat with different filling rates - Google Patents

Abstract

The invention discloses a method for screening wheat with different filling rates. The method comprises the following steps: detecting whether the genotype of the wheat to be detected based on the AX-110942203 locus is CC homozygous or TT homozygous, and the filling rate of the wheat of which the genotype based on the AX-110942203 locus is CC homozygous is greater than the filling rate of the wheat of which the genotype based on the AX-110942203 locus is TT homozygous; the AX-110942203 locus is the 36 th nucleotide from the 5' terminus of SEQ ID NO 1 in the wheat genome. Experiments prove that the wheat filling rate character can be screened by detecting the genotype of the wheat to be detected based on the AX-110942203 locus. The invention has important application value in wheat breeding.

Description

Method for screening wheat with different filling rates

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for screening wheat with different filling rates.

Background

Wheat is the grain crop with the largest planting area in the world and is also the third grain crop in China. With the reduction of the cultivated land area, the increase of population, the improvement of the living standard of people and the deepening of the influence of international situation on the global grain production, the continuous improvement of the wheat yield has important practical significance for guaranteeing the grain safety in China. In recent 20 years, the improvement of wheat yield in China mainly benefits from the improvement of unit yield. Therefore, increasing the yield per unit area by genetic improvement is one of the most effective measures for increasing wheat yield.

The Huang-Huai-Mai area is the most important wheat production area in China, the seeding area and the total yield are over 60 percent of the whole country, and the Huang-Huai-Mai area is of great importance to guarantee the national food safety. The wheat yield is influenced by three factors of the number of ears per unit area, the number of grains per ear and the thousand-grain weight, and the coordination of the three factors is the key for obtaining the high yield of the wheat. The annual genetic gain of the wheat yield in Huang-Huai-Mai region is about 0.48-1.05%, and the annual genetic gain of thousand kernel weight is 0.35-0.51% in the constitutive factors. Although the genetic gain in yield slowed down in recent 15 years, grain weight continued to increase, suggesting that grain weight improvement is a key factor in significant yield improvement. The grain weight is mainly controlled by genotype and is significantly influenced by the environment, and the grain weight has the highest heritability among yield-forming factors. In the wheat filling period of Huang-Huai-winter wheat, the grain weight is reduced, and the yield loss is caused because the grains are not full due to the influence of adverse environments such as high temperature, drought, dry hot air, rainfall and the like. A number of studies have shown that the grain weight depends mainly on the rate of grouting and the duration of grouting. For the main production area of Huang-Huai with short grouting duration, the grouting rate is a decisive factor of grain weight and is mainly controlled by genotype; the duration of the grouting contributes relatively little to the grain weight, and is mainly determined by the climate and cultivation system in a specific area. Therefore, increasing the filling rate is one of the key points of current wheat breeding efforts. Considering the importance of grouting rate to grain weight, considering that grouting rate measurement is cumbersome and grain weight is significantly and positively correlated with average grouting rate (r =0.90, p-bale 0.001), the average grouting rate can be calculated by recording parameters of flowering period, maturity period and thousand-grain weight, taking days from flowering period to maturity period as grouting duration, and from the ratio of thousand-grain weight to grouting duration.

Single Nucleotide Polymorphism (SNP) widely exists in a genome, has the advantages of extremely high density, wide coverage range and high-throughput detection, is gradually applied to high-density genetic map construction, quantitative character gene positioning and germplasm genotype detection, and effectively accelerates the molecular breeding process. In recent years, the SNP genotyping detection scheme based on KASP (Kompetitive Allle-Specific PCR) technology developed by LGC Genomics can replace a site-Specific fluorescent probe by a general fluorescent probe, effectively saves cost, and is increasingly applied to MAS breeding research of crops. Based on parents or natural groups, the gene chip is utilized to detect SNP genotypes, target character genetic sites are excavated, KASP markers are developed, breeding materials are detected, and MAS breeding work of wheat with complex agronomic characters can be efficiently, accurately and inexpensively carried out.

The Jimai 22 is a high-yield variety bred by a crop research institute of agricultural academy of sciences of Shandong province, passes the national approval of Huanghuai north tablets in 2006, completes the introduction and the record work of Anhui and Henan provinces of Huanghuai south tablets in 2010 and 2011 respectively, is accumulated and popularized to exceed 2100 hectares, is ranked the first in the nation in 12 years continuously, and has the planting area of about 100 hectares in the current year. Zhongmai 578 is a new strong and high-yield wheat variety bred by the crop science research institute and the cotton research institute of Chinese academy of agricultural sciences, passes through national approval of two barley areas of Huang-Huai-Nanpian and Huang-Huai-Bei-pian in 2020 and 2021 respectively, has a popularization area of about 37 ten thousand hectares in the current year, and has become a main popularization variety and an important backbone parent in Huang-Huai-mai area.

Disclosure of Invention

The invention aims to identify the filling rate of wheat.

The invention firstly protects a primer group, which consists of an upstream primer F1, an upstream primer F2 and a downstream primer R;

the upstream primer F1 consists of a fluorescent label sequence A and a DNA fragment shown in the 22 nd to 45 th positions from the 5' end of SEQ ID NO. 2;

the upstream primer F2 consists of a fluorescent label sequence B and a DNA fragment shown in the 22 nd to 45 th positions from the 5' end of SEQ ID NO. 3;

the nucleotide sequence of the downstream primer R is shown as SEQ ID NO. 4.

In the primer group, the nucleotide sequence of the fluorescent label sequence A is shown as 1 st to 21 st from the 5' end of SEQ ID NO. 2. The nucleotide sequence of the fluorescent label sequence B is shown as 1 st to 21 st from the 5' end of SEQ ID NO 3.

In the above, the nucleotide sequence shown in the 1 st to 21 st positions from the 5' end of SEQ ID NO. 2 is FAM fluorescent tag sequence, and the fluorescent signal is blue. 3 from the 5' end, the nucleotide sequence shown in the 1 st to 21 st positions is a HEX fluorescent tag sequence, and the fluorescent signal is red.

The invention also protects the application of any one of the primer groups, which can be any one of the following b 1) -b 3):

b1 Identifying the filling rate of the wheat to be tested;

b2 Screening wheat varieties with high filling rate;

b3 ) wheat breeding.

The invention also protects the application of the DNA segment shown in SEQ ID NO. 1, which can be any one of the following b 1) -b 4):

b1 Identifying the filling rate of the wheat to be tested;

b2 Screening wheat varieties with high filling rate;

b3 Breeding wheat;

b4 As a molecular marker for identifying the filling rate of the wheat to be tested.

b4 The invention also protects the molecular marker shown in SEQ ID NO. 1.

The invention also discloses a method for screening wheat with different filling rates, which comprises the following steps: detecting whether the genotype of the wheat to be detected based on the AX-110942203 locus is CC homozygous or TT homozygous,

the filling rate of the wheat with CC homozygotic genotype based on the genotype of the AX-110942203 locus is more than the filling rate of the wheat with TT homozygotic genotype based on the genotype of the AX-110942203 locus;

the AX-110942203 locus is the 36 th nucleotide from the 5' terminus of SEQ ID NO 1 in the wheat genome.

In the method, the step of detecting whether the genotype of the wheat to be detected based on the AX-110942203 locus is CC homozygous or TT homozygous is as follows:

(a1) Taking genome DNA of wheat to be detected as a template, and carrying out PCR amplification by adopting any one of the primer groups to obtain a PCR amplification product;

(a2) And (b) after the step (a 1) is finished, detecting the fluorescent signal of the PCR amplification product by using an instrument, and obtaining the genotype of the wheat to be detected based on the AX-110942203 locus according to the color of the fluorescent signal.

In the method, the step of detecting whether the genotype of the wheat to be detected based on the AX-110942203 locus is CC homozygous or TT homozygous is as follows:

(b1) Taking genome DNA of wheat to be detected as a template, and carrying out PCR amplification by adopting any one of the primer groups to obtain a PCR amplification product;

(b2) Taking the PCR amplification product obtained in the step (b 1), and sequencing;

(b3) And (c) obtaining the genotype of the wheat to be detected based on the AX-110942203 locus according to the sequencing result obtained in the step (b 2).

The invention also discloses a kit for identifying the wheat filling rate, which comprises a substance for detecting the genotype of the wheat to be detected based on the AX-110942203 locus;

the AX-110942203 locus is the 36 th nucleotide from the 5' terminus of SEQ ID NO 1 in the wheat genome.

The kit can specifically comprise substances for detecting the genotype of wheat to be detected based on the AX-110942203 locus.

In the kit, the substance for detecting the genotype of the wheat to be detected based on the AX-110942203 locus can be any one of the primer sets.

The preparation method of the kit also belongs to the protection scope of the invention. The preparation method of the kit comprises the step of separately packaging each primer in any one primer group.

The invention also protects the application of any one of the kits, which can be any one of the following b 1) -b 3):

b1 Identifying the filling rate of the wheat to be tested;

b2 Screening wheat varieties with high filling rate;

b3 ) wheat breeding.

In the above, the > may be specifically statistical >. The high grouting rate may specifically be a statistically high grouting rate.

Experiments prove that the method provided by the invention is adopted to detect whether the genotype of the wheat to be detected based on the AX-110942203 locus is CC homozygous or TT homozygous, and the filling rate of the wheat of which the genotype based on the AX-110942203 locus is CC homozygous is greater than the filling rate of the wheat of which the genotype based on the AX-110942203 locus is TT homozygous;

the AX-110942203 locus is the 36 th nucleotide from the 5' terminus of SEQ ID NO 1 in the wheat genome. Therefore, the wheat filling rate character can be screened by detecting the genotype of the wheat to be detected based on the AX-110942203 locus. The invention has important application value in the wheat molecular marker-assisted breeding process.

Drawings

FIG. 1 is a genetic linkage map constructed from SNP markers in a 50K chip.

FIG. 2 shows F of 578/economical wheat 22 in step five 262 of example 1 ₅ Partial assay results for the RIL population.

FIG. 3 shows the results of some of the tests performed on the 109 Huang-Huai-Mai wheat varieties of example 2.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, and the examples are given only for illustrating the present invention and not for limiting the scope of the present invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Jimai 22 (described in the following documents: high-yield stable-yield disease-resistant eurytopic new wheat variety-Jimai 22. Li Haosheng, liu Jianjun, song Jianmin, liu Aifeng, cheng Duigong, zhao Zhendong Proc. Wheat crop Proc. 2007 (04): 744) is a wheat variety bred by genealogical institute of agriculture academy of sciences, shandong province, hybridizing with self-bred line 935024 as female parent and 35106 as male parent, and performing pedigree breeding. The Jimai 22 has the characteristics of good comprehensive agronomic characters, high yield potential, good stable yield and wide adaptability, and is a high-quality medium-gluten wheat variety.

Zhongmai 578 (described in the following documents: planting performance and cultivation technology of Zhongmai 578 in the Ma shop region Wang Haifeng, zhao Weiqin, ran Wuling, wu Changcheng, wang Gurun, wang Zijun, wang Fang, chinese breed 2020 (10): 99-101.) is a new high-quality strong-gluten high-yield wheat variety cultivated by the crop science institute and the cotton institute of Chinese academy of agricultural sciences, has the advantages of good early ripening and yellowing, good and stable gluten, high and stable yield, lodging resistance, high and stable thousand kernel weight, good seed commodity and the like, and is a high-quality strong-gluten wheat production updating variety in the Ma shop region of Henan province.

The duration of the grout is the number of days from the flowering to the maturity stage. Grouting rate = thousand grain weight/grouting duration (g/day). The rate of filling has a determining effect on the grain fullness and grain weight.

Example 1 discovery of AX-110942203 site of a filling rate controlling gene and acquisition of primer set for identification of wheat filling rate

1. Analysis of field phenotype data and discovery of new grouting rate QTL

1. 2019-2020, F for Miao 578, ji 22 and 262 Miao 578/Ji 22 ₅ RIL populations were grown from Henan Xinxiang (34 ° 53'N,113 ° 23' E; in 2020-2021, zhongmai 578, jimai 22 and 262 Zhongmai 578/Jimai 22F ₅ RIL population, respectively planted in Henan Xinxiang (E2), shang Hu (33 ° 43'N,114 ° 49' ELuoyang (34 ° 32' N,112 ° 16E) and Hebei Gaoyi (37 ° 33' N,114 ° 26' E; there are five environments. All environments adopt a completely random block design, the three times of repetition are carried out, the row length is 1m, the grain/row spacing is 30 grains/row, and other field management measures are carried out according to local wheat field management specifications. And recording the flowering period, the mature period and the grain weight of the wheat, and further counting the grouting duration and the grouting rate. And repeatedly taking the average value for three times to obtain the filling rate of the wheat.

2. And (3) after the step 1 is finished, selecting a PROC CORR model of international general SAS statistical software to calculate a Pearson correlation coefficient of the grouting rate and a PROC MIXED command for variance analysis.

The result of the anova shows that the grouting rate has 0.01 level significant difference among different genes, the correlation coefficient of five environments is 0.41-0.74, the correlation is good, and the accuracy of the phenotype data is further clarified.

3. Construction of genetic linkage map

F of middle wheat 578, ji Ma 22 and 262 middle wheat 578/Ji Ma 22 by using wheat 50K chip (Bo-ao) ₅ The RIL population was genotyped. The wheat 50K chip contains 55224 SNP markers which are uniformly distributed on 21 chromosomes. Before constructing a genetic linkage map, firstly removing markers without polymorphism between parents, and deleting the markers with deletion rate of more than 20 percent and minimum allele frequency of less than 0.3. The remaining 9354 high quality polymorphic markers were then used for analysis. 1501 markers remained after redundant markers were removed by the BIN function of Icimapping 4.2, and linkage analysis was performed by the JoinMap 4.0 software, and a linkage map was constructed using maphart 2.32.

The genetic linkage map constructed from the SNP markers in the 50K chip is shown in FIG. 1.

4. QTL location

QTL analysis was performed using the complete interval mapping method (ICIM) of IciMapping 4.2 software. The mapping parameters were set to a scan step of 0.1cM, a stepwise regression with a probability of entry (PIN) of 0.001, and a LOD (Logarithm of the odds) cut-off was calculated using 1000 permutation tests (P < 0.05). Explaining that the phenotypic variation rate of more than 10% is the main effect QTL, and the repeated positioning under 3 or more environments is the stable QTL. QTLs are named according to international genetics nomenclature.

Finally, locating a stable grouting rate QTL QGfr. Caas-7A under 5 environments and an expected mean value; qtlqgfr. caas-7A is a new grouting rate QTL.

2. Discovery of AX-110942203 site

The inventor of the invention carries out a large number of sequence analysis, alignment and preliminary experiments, and finds that the AX-110942203 SNP locus at the upstream of QGfr. Caas-7A is not only close to the physical position, but also has more different loci among 3 homologous chromosomes. The AX-110942203 SNP site is abbreviated as AX-110942203 site.

The locus AX-110942203 is the 36 th nucleotide from 5' end of SEQ ID NO 1 in wheat genome, and the genotypes are CC homozygote, TT homozygote and CT heterozygote. SEQ ID NO:1:

ATGTCGTCAGCTCTTTTACGCTACACCCTGACGGAYGGATGCATGTAAGTAAGTAAGCATTTTGTCATTTT (Y is C/T).

Since genomic DNA is a double-stranded DNA molecule composed of two single-stranded DNA molecules that are complementary in opposite directions, a DNA molecule encoding a protein is generally designated as a sense DNA molecule; a DNA molecule complementary to the reverse direction of the sense DNA molecule is designated as an antisense DNA molecule. The genotypes of the AX-110942203 loci are all the genotypes of sense DNA.

3. Obtaining of primer group for identifying wheat filling rate

According to the AX-110942203 locus and nucleotide sequences before and after the locus, a primer group suitable for identifying the wheat filling rate by using an allele competitive specific PCR method is designed and synthesized. The primer group consists of an upstream primer F1, an upstream primer F2 and a downstream primer R3 primer sequences and is used for amplifying a target sequence including an AX-110942203 locus. The nucleotide sequences of the respective primers are shown in Table 1.

TABLE 1

Primer name	Nucleotide sequence (5 '-3')
		Upstream primer F1	GAAGGTGACCAAGTTCATGCTTGCTTACTTACTTACATGCATCCG(SEQ ID NO:2)
Upstream primer F2	GAAGGTCGGAGTCAACGGATTTGCTTACTTACTTACATGCATCCA(SEQ ID NO:3)
		Downstream primer R	CCGACGAGACACGCTATCTC(SEQ ID NO:4)

Note: single underlined is FAM fluorescent tag sequence and double underlined is HEX fluorescent tag sequence.

4. Establishment of wheat genotype typing method based on AX-110942203 locus

1. Obtaining genomic DNA of wheat to be tested

And (3) extracting the genome DNA of the wheat to be detected by adopting a CTAB method.

The quality and the concentration of the genome DNA of the wheat to be detected both need to meet the PCR requirement, and the standard of reaching the standard is as follows: agarose electrophoresis showed that the DNA band was single and not dispersed significantly; detecting that the ratio of A260/A280 is between 1.8 and 2.0 (a DNA sample is not polluted by protein), the ratio of A260/A230 is between 1.8 and 2.0 (the salt ion concentration of the DNA sample is low) and no obvious light absorption is generated at 270nm (the DNA sample is not polluted by phenol) by using an ultraviolet spectrophotometer Nanodrop2100 (Thermo); the concentration of the genome DNA of the wheat to be detected is 50-200 ng/. Mu.L.

2. Competitive allele-specific PCR

(1) And (3) taking the genome DNA of the wheat to be detected as a template, and carrying out PCR amplification by adopting the primer group synthesized in the step three to obtain a PCR amplification product.

The reaction procedure is as follows: pre-denaturation at 94 ℃ for 15min; denaturation at 94 ℃ for 20s and 61-55 ℃ (touch down program is selected, the temperature is reduced by 0.6 ℃ per cycle), 1min, and amplification is carried out for 10 cycles; denaturation at 94 ℃ for 20s, and denaturation at 55 ℃ for 1min, and amplification is continued for 26 cycles.

3. After the step 2 is completed, when the temperature of the PCR amplification product is reduced to be below 40 ℃, scanning and reading a fluorescence value through FAM and HEX light beams of a microplate reader (reading value is observed when the FAM fluorescent label sequence is at 485nm of exciting light and 520nm of emitting light, reading value is observed when the HEX fluorescent label sequence is at 528nm of exciting light and 560nm of emitting light), and judging the genotype of the wheat to be detected based on the AX-110942203 locus according to the color of a fluorescence signal. The specific judgment principle is as follows: if the wheat to be detected displays a blue fluorescent signal based on the AX-110942203 locus, the wheat to be detected is homozygous for the genotype CC based on the AX-110942203 locus; if the wheat to be detected displays a red fluorescent signal based on the AX-110942203 locus, the genotype of the wheat to be detected based on the AX-110942203 locus is TT homozygous; if the wheat to be detected displays a green fluorescent signal based on the AX-110942203 locus, the genotype of the wheat to be detected based on the AX-110942203 locus is a CT heterozygous type.

If the fluorescence signal is weak after PCR amplification, which affects data analysis, cycles (denaturation at 94 ℃ for 20s, renaturation at 55 ℃ and extension for 1min,5 cycles) may be added until the results are satisfactory.

5. Detecting F of Miao 578, ji 22 and 262 Miao 578/Ji 22 using the method of step four ₅ RIL population genotype based on AX-110942203 locus

According to the method of the fourth step, replacing the wheat to be detected with F of the medium wheat 578, the Jimai 22 and the 262 medium wheat 578/Jimai 22 respectively ₅ RIL population, all other steps were unchanged, resulting in F for Miao 578, ji 22 and 262 Miao 578/Ji 22 ₅ The RIL population is based on the genotype at AX-110942203. Part of the assay results are shown in FIG. 2 (NTC for blank control, i.e., no template).

The genotyping results were compared to F of 578 and 22 Miao wheat in 50K chips and 262 Miao wheat 578/22 Miao wheat ₅ The results of genotyping of the RIL populations were compared. The result shows that the method provided by the fourth step is adopted to detect the base of the wheat based on the AX-110942203 locusThe genotype is completely consistent with the genotype typing result in the wheat 50K chip. Therefore, the method provided by the step four is adopted to detect the genotype of the wheat based on the AX-110942203 locus, and the method has high accuracy.

Example 2, example 1 analysis and verification of association between primer set for identifying wheat filling rate and wheat filling rate

The wheat to be tested is 109 wheat varieties in Huang-Huai-Mai region, and the names of the wheat varieties are shown in the 1 st column in the table 2. The 109 wheat varieties in Huang-Huai-Mai district shown in column 1 of Table 2 are all common varieties.

TABLE 2

Note: CC is CC homozygote, and TT is TT homozygote.

1. Detection of genotypes of 109 Huang-Huai-Mai-district wheat varieties based on AX-110942203 locus

According to the method of the fourth step in the embodiment 1, the wheat to be detected is replaced by 109 Huang-Huai-Mai-district wheat varieties respectively, and other steps are not changed, so that the genotypes of the 109 Huang-Huai-Mai-district wheat varieties based on the AX-110942203 locus are obtained. Part of the assay results are shown in FIG. 3 (NTC for blank control, i.e., no template).

The results are shown in Table 2, column 2.

2. Grouting rate detection

In 2012-2013 years and 2013-2014 years, 109 varieties of wheat in Huang-Huai-Mai areas are respectively planted in Henan Anyang and Anhui \28617Jixiu; in 2014-2015, 109 wheat varieties in Huang-Huai-Mai areas are planted in Hebei Shijiazhuang. All environments adopt a completely random block design, three times of repetition, a single-row area with the row length of 1.5m, the row width of 0.2m and 50 blocks/row, and other field management measures are carried out according to local wheat field management specifications. And recording the flowering period, the mature period and the grain weight of the wheat, and further counting the grouting duration and the grouting rate. And repeatedly taking the average value for three times to obtain the filling rate of the wheat variety.

The statistics of the filling rate of each wheat variety for 5 environments are shown in columns 3-7 of table 2.

And calculating the average value of the filling rate of 5 environments of each wheat variety, namely the filling rate of each wheat variety. The filling rate statistics for each wheat variety are shown in table 2, column 8.

3. Association analysis

And respectively counting the filling rate of the wheat varieties with the two genotypes, and simultaneously carrying out t test by using a PROC TTEST model of the international general SAS9.2 statistical software. The statistical results are shown in Table 3.

The result shows that in the group consisting of 109 wheat varieties in Huang-Huai-Mai district, the filling rate of the wheat variety of CC homozygotic type is greater than that of the wheat variety of TT homozygotic type; the ">" is statistically > (i.e., significantly above at the 0.05 level). Thus, it can be seen that the CC homozygous type is an excellent genotype to increase the filling rate of wheat.

TABLE 3

Note: * Represents P <0.05; * Denotes P <0.01; * Denotes P <0.001; CC is CC homozygote, and TT is TT homozygote.

The results show that the filling rate character of the wheat can be screened by detecting the genotype of the wheat to be detected based on the AX-110942203 locus, and the method has important application value in the molecular marker-assisted breeding process of the wheat.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific examples, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Claims (10)

1. The primer group consists of an upstream primer F1, an upstream primer F2 and a downstream primer R;

the upstream primer F1 consists of a fluorescent label sequence A and a DNA fragment shown in the 22 th to 45 th positions from the 5' end of SEQ ID NO. 2;

the upstream primer F2 consists of a fluorescent label sequence B and a DNA fragment shown in the 22 th to 45 th positions from the 5' end of SEQ ID NO. 3;

the nucleotide sequence of the downstream primer R is shown as SEQ ID NO. 4.

2. The primer set of claim 1, wherein:

the nucleotide sequence of the fluorescent label sequence A is shown as 1 st to 21 st from the 5' end of SEQ ID NO 2;

the nucleotide sequence of the fluorescent label sequence B is shown as 1 st to 21 st from the 5' end of SEQ ID NO 3.

3. The use of the primer set according to claim 1 or 2, which is any one of the following b 1) to b 3):

b1 Identifying the filling rate of the wheat to be tested;

b2 Screening wheat varieties with high filling rate;

b3 ) wheat breeding.

The application of the DNA fragment shown in SEQ ID NO:

b1 Identifying the filling rate of the wheat to be tested;

b2 Screening wheat varieties with high filling rate;

b3 Breeding wheat;

b4 As a molecular marker for identifying the filling rate of the wheat to be tested.

5. A method for screening wheat with different filling rates comprises the following steps: detecting whether the genotype of the wheat to be detected based on the AX-110942203 locus is CC homozygous or TT homozygous, and the filling rate of the wheat of which the genotype based on the AX-110942203 locus is CC homozygous is greater than the filling rate of the wheat of which the genotype based on the AX-110942203 locus is TT homozygous;

the AX-110942203 locus is the 36 th nucleotide from the 5' terminus of SEQ ID NO 1 in the wheat genome.

6. The method of claim 5, wherein: the method for detecting whether the genotype of the wheat to be detected based on the AX-110942203 locus is CC homozygous or TT homozygous comprises the following steps:

(a1) Performing PCR amplification by using the genome DNA of wheat to be detected as a template and adopting the primer group of claim 1 or 2 to obtain a PCR amplification product;

(a2) After the step (a 1) is finished, detecting a fluorescent signal of a PCR amplification product by using an instrument, and obtaining the genotype of the wheat to be detected based on the AX-110942203 locus according to the color of the fluorescent signal.

7. The method of claim 5, wherein: the method for detecting whether the genotype of the wheat to be detected based on the AX-110942203 locus is CC homozygous or TT homozygous comprises the following steps:

(b1) Taking genome DNA of wheat to be detected as a template, and carrying out PCR amplification by adopting the primer group of claim 1 or 2 to obtain a PCR amplification product;

(b2) Taking the PCR amplification product obtained in the step (b 1), and sequencing;

(b3) And (c) obtaining the genotype of the wheat to be detected based on the AX-110942203 locus according to the sequencing result obtained in the step (b 2).

8. A kit comprises a substance for detecting the genotype of wheat to be detected based on an AX-110942203 locus;

the AX-110942203 locus is the 36 th nucleotide from the 5' terminus of SEQ ID NO 1 in the wheat genome.

9. The kit of claim 8, wherein: the substance for detecting the genotype of wheat to be detected based on the AX-110942203 locus is the primer group of claim 1 or 2.

10. The use of the kit according to claim 8 or 9, being any of the following b 1) -b 3):

b1 Identifying the filling rate of the wheat to be tested;

b2 Screening wheat varieties with high filling rate;

b3 ) wheat breeding.

Images