CN115820725A - Method for regulating and controlling expression of target gene by using lipid transporter gene promoter, transformation vector and application thereof - Google Patents

Abstract

The invention relates to a method for regulating and controlling the expression of a target gene in secretory glandular hairs of plants by utilizing a lipid transporter gene promoter, a carrier applied in the method and application thereof in genetic engineering breeding of plant glandular hair tissue expression and metabolite production. The promoter is the promoter of AaLTP1 gene, and can regulate and control the specific expression of target genes in secretory glandular hairs of plants. Meanwhile, the invention also relates to the application of the gene promoter in gene engineering breeding for expressing and producing metabolites by using plant glandular hair tissues. When the promoter specifically expressed by the plant glandular hairs is used for carrying out genetic operation on the glandular hair system of the plant, the plant growth and development are not damaged. Therefore, the invention has important significance for gene engineering breeding by utilizing plant glandular hair tissue to express and produce metabolites.

Description

Method for regulating and controlling expression of target gene by using lipid transporter gene promoter, transformation vector and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a method for regulating and controlling target gene expression by utilizing a lipid transporter gene promoter, a transformation vector and application thereof.

Background

Artemisia annua L is an annual herb of Artemisia in Compositae, and has strong volatile fragrance, and contains many secondary metabolites: artemisinin, volatile oil, alpha-pinene, camphor, artemisone and the like, and also contains a plurality of flavonoid compounds. Artemisinin (Artemisinin) is a sesquiterpene lactone compound isolated from its aerial parts and containing a peroxide bridge structure, and is used as a main active ingredient of the antimalarial drug combination therapies (ACTs) recommended by the World Health Organization (WHO). The main source of artemisinin is currently extracted from the aerial parts of artemisia annua, however the content of artemisinin in artemisia annua is very low (0.01% -1%), which makes the large-scale commercial production of this drug very limited.

The surface of the leaves of the sweet wormwood herb has two types of epidermal hairs: secretory glandular hairs (GSTs) and non-secretory epidermal hairs (TSTs), both of which play a crucial role in plant growth, development, defense, pollen transmission, etc. A promoter is a specific nucleotide sequence located upstream of the 5' end of a gene, like a "switch", which exerts its specific function through the interaction of cis-acting elements and trans-acting factors. The promoters are divided into three parts: constitutive promoters, specific promoters, inducible promoters. In the current genetic engineering research of artemisia apiacea, a constitutive promoter is mostly adopted, such as a cauliflower mosaic virus 35S promoter (CaMV 35S), and the promoter can drive an exogenous gene to be expressed in all tissues and organs, but cannot regulate the expression of a target gene in specific tissues and organs, so that substances and energy in cells are excessively consumed, certain burden and harm are possibly caused to plants, and the normal growth of the plants is influenced. Therefore, it is urgently needed to find a promoter specifically expressed in a tissue organ of a plant to replace a constitutive promoter so as to better regulate and control a plant gene. Because the glandular hair specific expression promoter is used for carrying out genetic operation on the glandular hair system of the plant, the plant growth and development are not damaged, and various defects of the constitutive promoter can be overcome. Plant lipid transporter gene LTPs have a variety of physiological functions including plant signaling, synthesis of cutin and wax metabolism, cell wall extension, pollen development, somatic embryogenesis, seed germination, biotic and abiotic stresses. Therefore, the AaLTP1 gene promoter cloned to the specific expression of the plant glandular hair tissue has very important significance for artemisinin metabolic engineering.

Therefore, those skilled in the art have been devoted to the development of a promoter which does not cause any harm to plant growth.

Disclosure of Invention

In order to overcome the defects of the existing plant genetic engineering technology and simultaneously deeply research the initiation and development of secretory glandular hairs and the metabolic regulation of secondary metabolites in the secretory glandular hairs. The invention provides a promoter specifically expressed in secretory glandular hairs of a plant, which can guide genes to be specifically expressed in the secretory glandular hairs of a transgenic plant and does not cause damage to the growth and development of the plant.

In order to achieve the purpose, the invention provides a method for regulating and controlling the expression of a target gene in a plant secretory glandular hair by using a lipid transporter gene promoter, which is characterized in that the lipid transporter gene is an AaLTP1 gene specifically expressed in plant glandular hair tissues, and the promoter of the gene is a nucleotide sequence shown in SEQ ID NO. 1.

In a preferred embodiment of the invention, the method comprises the steps of:

step one, culturing sweet wormwood aseptic seedlings;

step two, cloning by PCR to obtain an AaLTP1 promoter by utilizing the sweet wormwood aseptic seedlings cultured in the step one;

step three, analyzing cis-acting elements on the AaLTP1 promoter, and determining the type of the AaLTP1 gene promoter;

step four, connecting the promoter cloned in the step two into a pCAMBIA1391z vector, fusing a reporter gene and constructing a transformation vector;

step five, transforming the agrobacterium tumefaciens by the transformation vector constructed in the step four and detecting;

step six, stably transforming the agrobacterium tumefaciens with the transformation vector obtained in the step five into the sweet wormwood herb;

step seven, detecting the transgenic southernwood plants obtained in the step six by PCR;

and step eight, determining the expression part of the GUS reporter gene guided by the promoter in the plant.

In another preferred embodiment of the present invention, the second step specifically includes:

extracting genome DNA from the sweet wormwood aseptic seedling leaves obtained in the step one, and performing amplification by using the genome DNA as a template and adopting a two-round nested PCR method, wherein primer sequences adopted in the two-round nested PCR method comprise:

PF1：ACGTTAGCTCTTTTGCTAAGGACCAT

PR1：TACTGGTTAGGTAGGTCACACACG

PF2：CTTACACGTTCTTACTTTAATTTTATA

PR2：ACCATTTCTCCACTTGCTATTACT。

in another preferred embodiment of the present invention, in the fourth step, the transformation vector is pCAMBIA1391z-proLTP1 vector, and in order to construct the transformation vector, bamH I cleavage site is introduced into the forward primer, and Nco I cleavage site is introduced into the reverse primer.

In another preferred embodiment of the present invention, in the fourth step, the primer sequences are as follows:

1391z-proLTP1-F：

CAGGTCGACGGATCCCTTACACGTTCTTACTTTAATTTTATA；

1391z-proLTP1-R：

TCAGATCTACCATGGTTCTCCACTTGCTATTACTTTAATT. In another preferred embodiment of the present invention, the agrobacterium tumefaciens used in the fifth step is EHA105.

In another preferred embodiment of the present invention, the sixth step specifically includes: the method comprises the steps of performing explant pre-culture by using artemisia apiacea seeds to obtain aseptic seedling leaf explants, performing co-culture on the leaf explants and agrobacterium tumefaciens with transformation vectors, transferring the artemisia apiacea explants obtained through the co-culture to a germination screening culture medium, and performing screening culture after 2-3 times of subculture to obtain screened artemisia apiacea plants.

In another preferred embodiment of the present invention, the seventh step specifically includes:

respectively designing a forward primer proLTP1: CTTACACGTTCTTACTTTAATTTTATA and a reverse primer GUSR according to the promoter of an expression cassette where a target gene is located and the GUS gene:

ATCCAGACTGAATGCCCACA detects GUS gene.

The vector used in the method for regulating and controlling the expression of the target gene in the secretory glandular hairs of the plant by utilizing the lipid transporter gene promoter is a pCAMBIA1391z-proLTP1 vector, and contains a promoter of the AaLTP1 gene specifically expressed in the glandular hair tissues of the plant and a GUS reporter gene.

The method for regulating and controlling the expression of a target gene in a plant secretory glandular hair by using the lipid transporter gene promoter is applied to the gene engineering breeding of plant glandular hair tissue expression and metabolite production.

Technical effects

Compared with the prior art, the invention has the beneficial effects that: the invention uses the effective sweet wormwood secretion glandular hair tissue specific promoter to replace the constitutive promoter to construct the fusion gene of the sweet wormwood secretion glandular hair specific expression target gene in molecular biology, and transfers the fusion gene into the genome of other plants by using the genetic transformation technology, thereby realizing the directional operation of the target gene to obtain the transgenic plants, causing no harm to the growth and development of the plants, and being widely used in the genetic engineering breeding of expressing and producing metabolites by using the plant glandular hair tissue.

The conception, the specific structure and the technical effects of the present invention will be further described with reference to the accompanying drawings to fully understand the objects, the features and the effects of the present invention.

Drawings

FIG. 1 is a PCR positive detection electrophoretogram of transgenic Artemisia annua plants of a preferred embodiment of the present invention;

FIG. 2 is a diagram showing GUS tissue staining of Artemisia annua after stably transforming Artemisia annua with AaLTP1 gene promoter.

Detailed Description

The technical contents of the preferred embodiments of the present invention will be made clear and easily understood by referring to the drawings attached to the specification. The present invention may be embodied in many different forms of embodiments and the scope of the invention is not limited to the embodiments set forth herein.

Experimental procedures without specific conditions noted in the examples below, generally followed by conventional conditions, such as molecular cloning in Sambrook et al: the laboratory manual is described in New York: the conditions described in 1989 edition of Cold Spring Harbor Laboratory Press, or as recommended by the manufacturer.

The Agrobacterium tumefaciens EHA105 related to the present example has been described in Huang Yali, jiang Xiliang, tian Yunlong, guo Ping, zhu Changxiong; study of agrobacterium tumefaciens-mediated genetic transformation of trichoderma harzianum, journal of biological engineering, china 2008,28 (3): 38-43, respectively. Agrobacterium tumefaciens EHA105, plasmid pCAMBIA1391z is commercially available from a public commercial source, such as that available from CAMBIA, australia under the strain designation Gambar1.

Examples

The embodiment relates to the acquisition of the promoter of the AaLTP1 gene, which specifically comprises the following steps:

step one, culturing sweet wormwood aseptic seedlings

Soaking sweet wormwood seeds in 75% ethanol for 1min, then soaking in 20% (w/v) NaClO for 20min, washing with sterile water for 3-4 times, sucking surface water with sterile absorbent paper, inoculating on MS solid culture medium without any hormone, culturing at 25 ℃ under 16h/8h (light/dark) illumination, and obtaining sweet wormwood sterile seedlings after 14 days;

step two, cloning of promoter sequence in genome DNA

Extraction of genomic DNA

2 small steel balls were added to a 1.5mL centrifuge tube, and a piece of Artemisia apiacea leaf (1 cm) ² Left and right size, and taken out with ice box). Add 300. Mu.L of TPS buffer (operating in the fume hood, 2% mercaptoethanol in TPS), 55-60Hz, shake for 90s. An additional 300. Mu.L of TPS buffer (fume hood) was added. The temperature of the water bath is 65 ℃ for 1h (shaking every 20 min), and the time can be properly prolonged to be 1.5h at most. Cooled to room temperature and centrifuged at 12000rpm at 4 ℃ for 15min. Collecting 300-400 μ L supernatant. 300. Mu.L-400. Mu.L of isopropanol (pre-cooled at-20 ℃ C.) was added in equal volume. Mixing, and standing in-20 deg.C refrigerator for 10-15min (1 h). Taking out, centrifuging at 12000rpm at 4 deg.C for 10min, sucking off supernatant, and inverting in fume hood for 10-15min. Adding 75% ethanol 500-600 μ L, blowing or flicking the precipitate with finger, shaking on shaking table for 15-20min, and repeating once. The liquid was blotted dry and dried at 37 ℃ until the precipitate became clear. Add 50. Mu.L ddH2O to dissolve back, and store at 4 ℃.

PCR amplification

The genome DNA is used as a template, and a PCR method is utilized to amplify the secretory glandular hair specific promoter sequence. In order to improve the specificity of the product, two rounds of Nested PCR (Nested PCR) amplification are adopted, the Nested PCR primers are designed according to the promoter sequence of AaLTP1 gene obtained by the sequencing of the laboratory genome and are shown in the table 1, and the first round of PCR reaction system is shown in the table 2. The PCR conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 94 ℃ for 30s; annealing at 50 ℃ for 30s; extension at 72 ℃ for 2min,35 cycles; extension at 72 ℃ for 10min. The PCR products were detected by electrophoresis in a 1% agarose gel.

TABLE 1 nested PCR primer design

TABLE 2 first round PCR reaction System

The product of the first round of PCR was diluted 100 times and used as a template for the second round of PCR, the reaction system of the second round of PCR is shown in Table 3. The PCR conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 94 ℃ for 30s; annealing at 55 ℃ for 30s; extension at 72 ℃ for 2min,35 cycles; extension at 72 ℃ for 10min. Detecting the PCR product in 1% agarose gel, cutting gel, recovering target segment, and purifying DNA. Then connected to pLB (purchased from Tiangen) vector for sequencing, the sequence of the fragment and the gene sequence were spliced to obtain a fragment of about 2000bp upstream of the AaLTP1 gene.

TABLE 3 second round PCR reaction System

Step three, analyzing the cis-acting element of the AaLTP1 gene promoter to determine the type of the AaLTP1 gene promoter

The sequence length of the AaLTP1 gene promoter obtained in the embodiment is 1967bp. In order to find cis-acting elements on the promoter, the promoter of the AaLTP1 gene was analyzed with Plantcare (http:// bioinformatics. Psb. Element. Be/wbtools/plantatecare/html /). The analysis found that the polyclonal promoter has many cis-acting elements on top of TATAbox and CAAT box: ABRE, ARE, G-box, auxRR-core, CGTCA-motif, GT1-motif, P-box, TCA-element, TCT-motif, TGA-element, TGACG-motif and the like; g-box is found in a plurality of plant promoters, is an essential element for the function of a plurality of stress response promoters, and plays an important role in the process of responding light, anaerobic environment and plant hormone of plants; in addition, both GT1-motif and TCT-motif are regulated by light, CGTCA-motif and TGACG-motif can respond to methyl jasmonate and P-box can respond to gibberellin in plants, and cis-acting elements of the promoter of AaLTP1 gene are shown in Table 4 below. Analysis of the above results shows that the AaLTP1 gene promoter is an inducible promoter.

TABLE 4 cis-acting elements of AaLTP1 Gene promoter and their function

And step four, connecting the obtained promoter into a pCAMBIA1391z vector, and fusing a GUS reporter gene.

In order to research the expression of gene promoters in different tissue parts of plants, the promoter proLTP1 of the AaLTP1 gene is connected with a pCAMBIA1391z vector to fuse GUS reporter gene, in order to realize the construction of an expression vector, a BamH I enzyme cutting site is introduced into a forward primer, an Nco I enzyme cutting site is introduced into a reverse primer, and the sequence table 5 of the primers is shown as follows:

TABLE 5 PCR primers for construction of pCAMBIA1391z-proLTP1 vector

And step five, transforming the constructed pCAMBIA1391z-proLTP1 vector into agrobacterium tumefaciens and detecting.

The constructed plant binary expression vector is transferred into agrobacterium tumefaciens (EHA 105) and PCR verification is carried out. The results show that: the plant binary expression vector containing the gene promoter fragment is successfully constructed into the agrobacterium tumefaciens strain, so that the agrobacterium tumefaciens strain containing the plant expression vector pCAMBIA1391z-proLTP1 fused by the gene promoter and the GUS gene is obtained.

Step six, transforming the agrobacterium tumefaciens with the pCAMBIA1391z-proLTP1 vector into southernwood

1) Pre-culture of explants

Soaking herba Artemisiae Annuae seed in 75% ethanol for 1min; then soaking for 20min by using 20% (w/v) NaClO; washing with sterile water for 3-4 times; absorbing the surface moisture by using sterile absorbent paper; inoculating to hormone-free MS, wherein the MS culture medium adopts a solid culture medium invented by Murashige and Skoog in 1962, and the solid culture medium can be obtained from commercial sources; culturing at 25 deg.C for 16 hr in sunlight and 8 hr in dark to obtain herba Artemisiae Annuae aseptic seedling, and cutting aseptic seedling leaf explant for transformation after seedling grows to about 5 cm;

2) Co-culture of Agrobacterium with explants

Transferring the leaf explant into a co-culture medium consisting of 1/2MS and 100 mu mol/L AS, dropwise adding 1/2MS suspension of the Agrobacterium tumefaciens engineering bacteria containing the activated plant binary expression vector containing the AaLTP1 promoter, fully contacting the explant with a bacterial solution, performing dark culture at 28 ℃ for 3 days, and taking the leaf explant dropwise added to a 1/2MS liquid culture medium suspension of the Agrobacterium tumefaciens without a target gene AS a control;

3) Selection of resistant regenerated plants

Transferring the artemisia apiacea explant subjected to co-culture for 3d to a germination screening culture medium consisting of MS, 0.5 mg/L6-BA, 0.05mg/L NAA, 50mg/L Kan and 500mg/L Cb, culturing in 16-hour sunlight (light) and 8-hour darkness (dark) at the temperature of 25 ℃, subculturing once every two weeks, obtaining Kan resistant cluster buds after 2-3 subcultures, cutting off the well-grown resistant cluster buds, and transferring the well-grown resistant cluster buds to a rooting culture medium consisting of 1/2MS0 and 125mg/L Cb for culturing until rooting, thereby obtaining a Kan resistant regeneration artemisia apiacea plant;

step seven, PCR detection of the transgenic plant

Respectively designing a forward primer (proLTP 1: CTTACACGTTCTTACTTTAATTTTATA) and a reverse primer (GUSR: ATCCAGACTGAATGCCCACA) according to a promoter and GUS sequence of an expression cassette where a target gene is located to detect the GUS gene; the result shows that the designed PCR specific primer can be used for amplifying specific DNA fragments, and when non-transformed southernwood genome DNA is used as a template, no fragment is amplified, as shown in figure 1;

step eight, determining the expression part of GUS reporter gene guided by promoter in plant

The leaves of the Artemisia annua plants which are positive in PCR detection are subjected to GUS tissue staining, the result is shown in figure 2, the result shows that the staining parts are specifically distributed in secretory glandular hairs of the Artemisia annua, and the AaLTP1 gene promoter can guide the specific expression of exogenous genes in the glandular hairs in the transgenic Artemisia annua, so that the AaLTP1 gene promoter cloned by the invention can be used for gene engineering breeding and industrialization for producing metabolites by utilizing plant glandular hair tissue expression.

The foregoing detailed description of the preferred embodiments of the invention has been presented. It should be understood that numerous modifications and variations could be devised by those skilled in the art in light of the present teachings without departing from the inventive concepts. Therefore, the technical solutions available to those skilled in the art through logic analysis, reasoning and limited experiments based on the prior art according to the concept of the present invention should be within the scope of protection defined by the claims.

Claims (10)

1. A method for regulating and controlling the expression of a target gene by using a lipid transporter gene promoter is characterized in that the lipid transporter gene is an AaLTP1 gene specifically expressed by a plant glandular hair tissue, and the promoter of the gene is a nucleotide sequence shown in SEQ ID NO. 1.

2. The method of claim 1, comprising the steps of:

step one, culturing sweet wormwood aseptic seedlings;

step two, cloning by PCR to obtain an AaLTP1 promoter by utilizing the sweet wormwood aseptic seedlings cultured in the step one;

step three, analyzing cis-acting elements on the AaLTP1 promoter, and determining the type of the AaLTP1 gene promoter;

step four, connecting the promoter cloned in the step two into a pCAMBIA1391z vector, fusing a reporter gene and constructing a transformation vector;

step five, transforming the agrobacterium tumefaciens by the transformation vector constructed in the step four and detecting;

step six, stably transforming the agrobacterium tumefaciens with the transformation vector obtained in the step five into the sweet wormwood herb;

step seven, detecting the transgenic southernwood plants obtained in the step six by PCR;

and step eight, determining the expression part of the GUS reporter gene guided by the promoter in the plant.

3. The method for regulating the expression of a target gene using a lipid transporter gene promoter according to claim 2, wherein the second step comprises:

extracting genome DNA from the sweet wormwood sterile seedling leaves obtained in the step one, and performing amplification by using the genome DNA as a template and adopting a two-round nested PCR method, wherein primer sequences adopted in the two-round nested PCR method comprise:

PF1：ACGTTAGCTCTTTTGCTAAGGACCAT

PR1：TACTGGTTAGGTAGGTCACACACG

PF2：CTTACACGTTCTTACTTTAATTTTATA

PR2：ACCATTTCTCCACTTGCTATTACT。

4. the method according to claim 2, wherein in the fourth step, the transformation vector is pCAMBIA1391z-proLTP1 vector, and in order to construct the transformation vector, a BamH I cleavage site is introduced into the forward primer and a Nco I cleavage site is introduced into the reverse primer.

5. The method according to claim 4, wherein in the fourth step, the primer sequences are as follows:

1391z-proLTP1-F：

CAGGTCGACGGATCCCTTACACGTTCTTACTTTAATTTTATA；

1391z-proLTP1-R：

TCAGATCTACCATGGTTCTCCACTTGCTATTACTTTAATT。

6. the method for regulating the expression of a target gene by using a lipid transporter gene promoter according to claim 2, wherein the agrobacterium tumefaciens used in the fifth step is EHA105.

7. The method for regulating the expression of a target gene by using a lipid transporter gene promoter according to claim 2, wherein the sixth step specifically comprises: the method comprises the steps of performing explant pre-culture by using artemisia apiacea seeds to obtain aseptic seedling leaf explants, co-culturing the leaf explants and agrobacterium tumefaciens with a transformation carrier, transferring the artemisia apiacea explants obtained through co-culture to a germination screening culture medium, and performing screening culture after 2-3 times of subculture to obtain screened artemisia apiacea plants.

8. The method according to claim 2, wherein the seventh step comprises:

respectively designing a forward primer proLTP1: CTTACACGTTCTTACTTTAATTTTATA and a reverse primer GUSR according to the promoter of an expression cassette where a target gene is located and a GUS gene sequence:

ATCCAGACTGAATGCCCACA detects GUS gene.

9. A vector for use in the method for regulating the expression of a gene of interest using a lipid transporter gene promoter according to any one of claims 1 to 8, wherein the vector is pCAMBIA1391z-proLTP1 vector, and comprises a promoter for AaLTP1 gene specifically expressed in plant glandular hair tissue and a GUS reporter gene.

10. Use of the method for regulating the expression of a gene of interest using a lipid transporter gene promoter according to any one of claims 1 to 8 for genetic engineering breeding for the expression of plant glandular hair tissues and the production of metabolites.

Images