CN105087579B - The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs - Google Patents
The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs Download PDFInfo
- Publication number
- CN105087579B CN105087579B CN201510409204.5A CN201510409204A CN105087579B CN 105087579 B CN105087579 B CN 105087579B CN 201510409204 A CN201510409204 A CN 201510409204A CN 105087579 B CN105087579 B CN 105087579B
- Authority
- CN
- China
- Prior art keywords
- promoter
- glandular hairs
- expressed
- gene
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of gene promoter of plant biotechnology field, the nucleotide sequence such as SEQ ID NO of the promoter:Shown in 1, target gene specifically expressing in plant nonsecreting type glandular hairs can be regulated and controled.Purposes the invention further relates to forementioned gene promoter in using the genetic engineering breeding of plant glandular hairs tissue expression and production metabolite simultaneously.When carrying out genetic manipulation to the glandular hairs system of plant due to the promoter using plant glandular hairs specifically expressing, growing for plant will not be damaged.Therefore, the present invention is significant to the genetic engineering breeding using plant glandular hairs tissue expression and production metabolite.
Description
Technical field
The present invention relates to a kind of promoter, more particularly to a kind of to utilize molecular biology method to obtain non-in plant
The terpene synthase gene promoter (proTTPS5) of specifically expressing and its application in genetically modified plants in secreting type glandular hairs.
Background technology
Sweet wormwood (Artemisia annua L.) is composite family artemisia annual herb plant, and plant has strong volatility fragrant
Gas, contain many secondary metabolites in its plant：Qinghaosu, volatile oil, australene, camphor, artemisia ketone etc., additionally contain
Flavone compound.Qinghaosu (Artemisinin) is a kind of times containing peroxide bridge structure isolated from its aerial part
Sesquiterpene lactone compound, the anti-malaria medicaments therapeutic alliance (Artemisinin- recommended as the World Health Organization (WHO)
Based combination therapies, ACTs) principle active component.The main source of qinghaosu is from sweet wormwood at present
Aerial part extraction, but the content of Artemisinin in Artemisia annuna is very low (0.01%-1%), and this causes the big rule of this medicine
Mould, which is commercially produced, receives very big limitation.
The blade surface of sweet wormwood has two kinds of glandular hairs：Secreting type glandular hairs (glandular secretory trichome, GST)
With nonsecreting type glandular hairs (T shape trichome, TST), growth of two kinds of glandular hairs for plant, development, defence, pollen pass
Broadcast etc. and all to play vital effect.Promoter is the specific nucleic acid sequence positioned at structural gene 5' ends upstream, can be regulated and controled
The expression of downstream gene, promoter pass through the interaction of cis-acting elements and trans-acting factor just as one " switch "
To play its specific function.Promoter one is divided into three kinds：Constitutive promoter, specific promoter, inducible promoter.
At present in the genetic engineering research of sweet wormwood, more using constitutive promoter, such as cauliflower mosaic virus 35 S promoter
(CaMV35S), this promoter can drive foreign gene to be expressed in all tissues and organ, can consume excessively intracellular
Matter and energy, and the expression of target gene can not be regulated and controled over time and space, most probably can be to the normal life of plant
Length causes certain burden and harm.Therefore it is badly in need of finding specific expressed promoter in the histoorgan of plant to replace
Constitutive promoter, so as to which the expression preferably to plant gene regulates and controls.Due to glandular hairs specifically expressing promoter for
The glandular hairs system of plant carries out genetic manipulation, growing for plant will not be damaged, can overcome constitutive promoter
A variety of drawbacks.Therefore, the present invention endeavours to provide a kind of promoter for being cloned into plant glandular hairs organizing specific expression.
The content of the invention
In view of the drawbacks described above of prior art, at the same for further investigation nonsecreting type glandular hairs generation and development and its
In secondary metabolite metabolic regulation.The present invention provides a kind of startup of the specifically expressing in plant nonsecreting type glandular hairs
Son, can guiding gene specifically expressing in genetically modified plants nonsecreting type glandular hairs.The promoter is that terpene synthase gene opens
Mover, the nucleotide sequence of the promoter is as shown in SEQ ID NO.1.
Further, the promoter is inducible promoter.
The present invention also provides the promoter that a kind of controlling gene as described above is expressed in nonsecreting type glandular hairs, can apply
In the genetic engineering breeding in plant production metabolite.
Further, the promoter is specific promoter, and constitutive promoter guiding foreign gene can be replaced to exist
Specifically expressing in plant nonsecreting type glandular hairs.
The present invention also provides a kind of carrier and is connected with what controlling gene as described above was expressed in nonsecreting type glandular hairs
Promoter.
The preparation method of the invention that the promoter that a kind of controlling gene is expressed in nonsecreting type glandular hairs is also provided, including with
Lower step：
Step 1: culture sweet wormwood aseptic seedling；
Step 2: the promoter gene group sequence that clone's controlling gene is expressed in nonsecreting type glandular hairs；
Step 3: the cis-acting elements above the promoter that analysis controlling gene is expressed in nonsecreting type glandular hairs, really
The fixed promoter and enhancer；
Step 4: the promoter being cloned into is connected into pCAMBIA1391z carriers by digestion；
Step 5: the carrier built in step 4 is converted into Agrobacterium tumefaciems；
Step 6: the Agrobacterium tumefaciems stable conversion sweet wormwood for carrier being carried in step 5；
Step 7: PCR detects transfer-gen plant；
Step 8: determine gus reporter gene that the promoter the is guided expressive site in plant.
Further, the step 2 is using genomic DNA as template, is expanded using two-wheeled nested PCR method non-secreting
Type glandular hairs specific promoter sequence.
Further, the cis work above promoter that controlling gene is expressed in nonsecreting type glandular hairs in the step 3
Included with element：TATA box, CAAT box, G-box, ARE, ATCT-motif, GARE-motif, HES or G-box.
Controlling element see the table below 1 in promoter sequence：
Table 1：Controlling element is analyzed in promoter sequence
Further, in the step 4, to build pCAMBIA1391z carriers, PstI digestions position is introduced in forward primer
Point, EcoRI restriction enzyme sites are introduced in reverse primer, and primer sequence is as shown in the table：
1391z-proTTPS5-F：AACTGCAGTAATCTATGACCCACCACCACTAAAG
1391z-proTTPS5-R：CGGAATTCCACTAGACGTGACCGATCGATTAC
Further, the step 6 specifically includes：
1) preculture of explant；
2) co-cultivation of Agrobacterium and explant；
3) screening of resistance regeneration plant.
Compared with prior art, the beneficial effects of the invention are as follows：The present invention utilizes effective sweet wormwood epidermal hair organizing specific
Property promoter instead of constitutive promoter can be used for structure in molecular biology in sweet wormwood nonsecreting type glandular hairs specifically expressing
The fusion of target gene, is transferred in the genome of other plant using genetic transfoumation, so as to realize purpose base
The directional operation of cause has obtained genetically modified plants, and growing for plant will not be damaged, and can be widely used in utilization
In the genetic engineering breeding of plant glandular hairs tissue expression and production metabolite.
Brief description of the drawings
Fig. 1 is the AaTTPS5 gene promoter sequences and its cis-acting elements of one embodiment of the present of invention；
Fig. 2 is the PCR positive test symbol figures of transgene abrotanum plant；
Fig. 3 is that the carrier pCAMBIA1391z-pro TTPS5 merged using AaTTPS5 gene promoters with gus gene are led to
After crossing agriculture bacillus mediated stable conversion sweet wormwood, GUS tissue stainings figure in the transgene abrotanum obtained.
Embodiment
The present invention is elaborated with reference to instantiation, following instance will be helpful to those skilled in the art
Further understand of the invention and the invention is not limited in any way.It should be pointed out that for the ordinary skill of this area,
Without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the protection model of the present invention
Enclose.
The experimental method of unreceipted actual conditions in following embodiments, generally according to normal condition, such as Sambrook etc.
Molecular cloning：Laboratory manual is shown in New York：In Cold Spring Harbor Laboratory Press versions in 1989
Described condition, or according to the condition proposed by manufacturer.
The Agrobacterium tumefaciems EHA105 that the present embodiment is related to exists《Huang Yali, Jiang Xiliang, field Yunlong, Guo Ping, Zhu Changxiong；
The research of Agrobacterium tumefaciens mediated trichoderma harzianum genetic transformation, Chinese biological engineering magazine, 2008,28 (3)：38-43》Text
Disclosed in offering.Agrobacterium tumefaciems EHA105, plasmid pCAMBIA1391z can be obtained by disclosing commercially available commercial channel, such as can be with
Bought from Australian CAMBIA companies, strain number Gambar1.
Embodiment
The present embodiment is related to the acquisition of AaTTPS5 gene promoters, specifically comprises the following steps：
Step 1: culture sweet wormwood aseptic seedling
The ethanol that seeds of southernwood volume fraction is 75% soaks 1min, then soaks 20min with 20% (w/v) NaClO
Afterwards, aseptic water washing 3 times~4 times, surface moisture is blotted with sterile blotting paper, is inoculated in the MS solid mediums without any hormone
On, 25 DEG C, 16h/8h (light/dark) illumination cultivation, sweet wormwood aseptic seedling can be obtained after 14 days；
Step 2: in genomic DNA promoter sequence clone
1. the extraction of genomic DNA
2 steel balls are added in 1.5mL centrifuge tubes, put a piece of sweet wormwood blade (1cm wherein2Left and right size, is contained with ice chest
Take).300 μ L TPS buffer (being operated in fume hood, contain 2% mercaptoethanol in TPS) are added, 55-60Hz, are shaken 90 seconds.
Add 300 μ L TPS buffer (fume hood).65 DEG C of water-bath 1h (being shaken every 20min), can the proper extension time, most
Long 1.5h.Room temperature is cooled to, 4 DEG C of 12000rpm centrifuge 15min.Take 300 μ L-400 μ L of supernatant liquid.It is isometric to add 300 μ L-
400 μ L isopropanols (isopropanol is in -20 DEG C of precoolings).10-15min (1h can be extended to) is placed after mixing in -20 DEG C of refrigerators.Take
Go out 4 DEG C of 12000rpm centrifugation 10min, suck supernatant, 10-15min is inverted in fume hood.75% ethanol 500-600 μ L are added,
Precipitation has been blown and beaten or upspring with finger, has been placed on shaking table and shakes 15-20min, be repeated once.Liquid is blotted, is placed in 37 DEG C and dries
It is dry, until precipitation is changed into transparent.Add 50 μ LddH2O back dissolvings, 4 DEG C of preservations.
2.PCR is expanded
Using genomic DNA as template, nonsecreting type glandular hairs specific promoter sequence is expanded using PCR method.In order to improve
The specificity of product, expanded using two-wheeled nest-type PRC (Nested PCR), obtained according to this laboratory gene order-checking
The promoter sequence design nest-type PRC primer of AaTTPS5 genes is as shown in table 2, and first run PCR reaction systems are as shown in table 3.PCR
Condition is：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s；50 DEG C of annealing 30s；72 DEG C of extension 2min, 35 circulations；72 DEG C of extensions
10min.The electrophoresis detection PCR primer in 1% Ago-Gel.
The nest-type PRC design of primers of table 2
3 first round of table PCR reaction systems
By first run PCR 100 times of product dilution, the second wheel PCR is carried out as template, the second wheel PCR reaction systems are shown in Table
4.PCR conditions are：95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s；55 DEG C of annealing 30s；72 DEG C of extension 2min, 35 circulations；72℃
Extend 10min.The electrophoresis detection PCR primer in 1% Ago-Gel, gel extraction purpose fragment, purify DNA.Then connect
It is connected to pMD18-T (being purchased from TaKaRa companies) carrier to be used to be sequenced, the sequence of the fragment is spliced with gene order, obtained
AaTTPS5 upstream region of gene about 2.4kbp fragment.
Table 4 second takes turns PCR reaction systems
Step 3: the cis-acting elements for the AaTTPS5 gene promoters that analysis obtains, determines AaTTPS5 gene promoters
The type of son
The AaTTPS5 gene promoter sequences length obtained in the present invention is 2407bp.In order to find above promoter
Cis-acting elements, with Plantcare (http://bioinformatics.psb.ugent.be/webtools/plant
Care/html/) promoter of AaTTPS5 genes is analyzed.Analysis find above the polyclonal promoter arrived have except
TATA box and CAAT box, also with many cis-acting elements：G-box、ARE、ATCT-motif、GARE-motif、HES
Deng；G-box is found in many plant promoters, and it is that many response promoters function necessary member
Part, critically important effect is played in plant promoter is to the response process of light, oxygen-free environment and plant hormone；In addition, GA-
Motif light regulates and controls, and GARE-motif can respond gibberellin in plant；Result above analysis shows, AaTTPS5 genes open
Mover is the promoter of an induction type, can be induced by a variety of hormones and natural cause.
Step 4: obtained promoter is connected into pCAMBIA-1391z carriers, gus reporter gene is merged.
In order to study expression of the gene promoter in plant different tissues position, by the promoter of AaTTPS5 genes
ProTPS5 connection pCAMBIA-1391z carriers merge gus reporter gene, in order to realize the structure to expression vector, forward primer
Middle introducing PstI restriction enzyme sites, EcoRI restriction enzyme sites are introduced in reverse primer, and primer sequence is as shown in the table：
The pCAMBIA1391z-proTTPS5 vector construction PCR primers of table 4
Step 5: the pCAMBIA1391z-proTTPS5 carriers built are converted into Agrobacterium tumefaciems and detected.
The plant binary expression vector completed containing structure is transferred to Agrobacterium tumefaciems (EHA105), performing PCR of going forward side by side checking.
As a result show：Plant binary expression vector containing promoter gene fragment is successfully building up in Agrobacterium tumefaciens strain, from
And obtain the plant expression vector pCAMBIA1391z-proTTPS5 merged containing gene promoter and gus gene crown gall agriculture bar
In bacteria strain.
Step 6: by the Agrobacterium tumefaciens transformation sweet wormwood with pCAMBIA1391z-proTTPS5 carriers
1) preculture of explant
The ethanol that seeds of southernwood volume fraction is 75% soaks 1min；Again 20min is soaked with 20% (w/v) NaClO；
Aseptic water washing 3~4 times；Surface moisture is blotted with sterile blotting paper；The MS of no hormone is inoculated in, the MS culture mediums use
Murashige and Skoog can be obtained in the solid medium invented in 1962, the solid medium by commercial channel；25
DEG C, the daylight of 16 hours and the culture of the night of 8 hours, you can obtain sweet wormwood aseptic seedling, after seedling length to 5cm or so, clip without
Vaccine blade explant is used to convert；
2) co-cultivation of Agrobacterium and explant
By described blade explant, go in the co-cultivation culture medium of 1/2MS and 100 μm of ol/L AS composition, dropwise addition contains
The 1/2MS suspensions of the Agrobacterium tumefaciems engineering bacteria of the gene plant binary expression vector containing DEL0 to DEL8 activated, make
Explant fully contacts with bacterium solution, 28 DEG C of light culture 3d, so that the 1/2MS liquid in the Agrobacterium tumefaciems without target gene is added dropwise
The blade explant of body culture medium suspension is control；
3) screening of resistance regeneration plant
Described co-cultivation 3d sweet wormwood explant is transferred to MS, 0.5mg/L 6-BA, 0.05mg/L NAA, 50mg/L
On the germination screening and culturing medium of Kan and 500mg/L Cb compositions, in 25 DEG C, the daylight (light) of 16 hours and the dark of 8 hours
(dark) cultivated in, squamous subculture once, Kan resistance Multiple Buds can be obtained after 2-3 subculture, will be grown good every two weeks
Good resistance Multiple Buds, which are cut, is transferred to 1/2MS0Cultivated with the root media of 125mg/L Cb compositions to taking root, so as to obtain
Kan resistances regenerate sweet wormwood plant；
Step 7, PCR detection transfer-gen plants
Expression cassette promoter-GUS sequences promoter and GUS according to where target gene separately design forward primer
(proTTPS5:) and reverse primer (GUSR GTAATCGATCGGTCACGTCTAGTG:GACATCGGCTTCAAATGGCGTA it is) right
Gus gene is detected；As a result show, using designed PCR special primers, specific DNA fragment can be amplified, and with non-turn
When change sweet wormwood genomic DNA is template, any fragment is not amplified, as shown in Figure 2；
Step 8, the determination of expressive site of the gus reporter gene that promoter is guided in plant
To the sweet wormwood plant of PCR test positive, its blade is taken to carry out GUS tissue stainings, as a result as shown in figure 3, result
Show, dyeing part is specific expressed in the nonsecreting type glandular hairs of sweet wormwood, illustrates that AaTTPS5 gene promoters are blue or green in transgenosis
Foreign gene specifically expressing in glandular hairs can be guided in wormwood artemisia, it can be seen that, the proTTPS5 gene promoters that the present invention is cloned
Son can be used for using plant glandular hairs tissue expression and produce in the genetic engineering breeding and industrialization of metabolite.
Preferred embodiment of the invention described in detail above.It should be appreciated that the ordinary skill of this area is without wound
The property made work can makes many modifications and variations according to the design of the present invention.Therefore, all technician in the art
Pass through the available technology of logical analysis, reasoning, or a limited experiment on the basis of existing technology under this invention's idea
Scheme, all should be in the protection domain being defined in the patent claims.
Claims (10)
1. the promoter that a kind of controlling gene is expressed in nonsecreting type glandular hairs, it is characterised in that the promoter is closed for terpene
Into enzyme gene promoter, the nucleotide sequence of the promoter is as shown in SEQ ID NO.1.
2. the promoter that a kind of controlling gene as claimed in claim 1 is expressed in nonsecreting type glandular hairs, it is characterised in that institute
It is inducible promoter to state promoter.
3. the promoter that a kind of controlling gene as claimed in claim 1 is expressed in nonsecreting type glandular hairs is metabolized in plant production
Application in the genetic engineering breeding of product.
4. the purposes for the promoter that a kind of controlling gene is expressed in nonsecreting type glandular hairs, it is characterised in that the promoter is
Specific promoter, constitutive promoter guiding foreign gene specifically expressing, institute in plant nonsecreting type glandular hairs can be replaced
The nucleotide sequence of promoter is stated as shown in SEQ ID NO.1.
5. a kind of carrier, it is characterised in that the carrier is connected with controlling gene as claimed in claim 1 in nonsecreting type gland
The promoter expressed in hair.
A kind of 6. preparation method for the promoter that controlling gene is expressed in nonsecreting type glandular hairs, it is characterised in that the startup
As shown in SEQ ID NO.1, the preparation method comprises the following steps the nucleotide sequence of son：
Step 1: culture sweet wormwood aseptic seedling；
Step 2: the promoter gene group sequence that clone's controlling gene is expressed in nonsecreting type glandular hairs；
Step 3: the cis-acting elements above the promoter that analysis controlling gene is expressed in nonsecreting type glandular hairs, determines institute
State promoter and enhancer；
Step 4: the promoter being cloned into is connected into pCAMBIA1391z carriers by digestion；
Step 5: the carrier built in step 4 is converted into Agrobacterium tumefaciems；
Step 6: the Agrobacterium tumefaciems stable conversion sweet wormwood for carrier being carried in step 5；
Step 7: PCR detects transfer-gen plant；
Step 8: determine gus reporter gene that the promoter the is guided expressive site in plant.
7. the preparation method for the promoter that a kind of controlling gene as claimed in claim 6 is expressed in nonsecreting type glandular hairs, its
It is characterised by, the step 2 is using genomic DNA as template, and it is special to expand nonsecreting type glandular hairs using two-wheeled nested PCR method
Different promoter sequence.
8. the preparation method for the promoter that a kind of controlling gene as claimed in claim 6 is expressed in nonsecreting type glandular hairs, its
It is characterised by, the cis-acting elements bag above the promoter that controlling gene is expressed in nonsecreting type glandular hairs in the step 3
Include：TATA box, CAAT box, G-box, ARE, ATCT-motif, GARE-motif, HES or G-box.
9. the preparation method for the promoter that a kind of controlling gene as claimed in claim 6 is expressed in nonsecreting type glandular hairs, its
It is characterised by, in the step 4, to build pCAMBIA1391z carriers, introduces PstI restriction enzyme sites in forward primer, reversely
EcoRI restriction enzyme sites are introduced in primer, primer sequence is as follows：
1391z-proTTPS5-F：AACTGCAGTAATCTATGACCCACCACCACTAAAG
1391z-proTTPS5-R：CGGAATTCCACTAGACGTGACCGATCGATTAC
10. the preparation method for the promoter that a kind of controlling gene as claimed in claim 6 is expressed in nonsecreting type glandular hairs, its
It is characterised by, the step 6 specifically includes：
1) preculture of explant；
2) co-cultivation of Agrobacterium and explant；
3) screening of resistance regeneration plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510409204.5A CN105087579B (en) | 2015-07-13 | 2015-07-13 | The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510409204.5A CN105087579B (en) | 2015-07-13 | 2015-07-13 | The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105087579A CN105087579A (en) | 2015-11-25 |
| CN105087579B true CN105087579B (en) | 2017-12-29 |
Family
ID=54568912
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510409204.5A Active CN105087579B (en) | 2015-07-13 | 2015-07-13 | The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105087579B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105567685B (en) * | 2016-01-18 | 2018-07-13 | 上海交通大学 | AaPDR3 gene promoters and its application |
| CN105925577B (en) * | 2016-05-06 | 2019-06-07 | 上海交通大学 | The promoter and application of controlling gene predominant expression in secreting type glandular hairs basal cell |
| CN107058314B (en) * | 2016-11-30 | 2020-09-04 | 暨南大学 | Promoter and application thereof |
| CN109852614B (en) * | 2018-12-06 | 2022-11-22 | 上海交通大学 | Promoter for regulating expression of gene in non-secretory glandular hair and application thereof |
| CN112646814B (en) * | 2020-12-24 | 2022-11-22 | 上海交通大学 | Isolated nucleic acid molecules and uses thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1878792A1 (en) * | 2006-07-12 | 2008-01-16 | Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. | Polynucleotides encoding caryophyllene synthase and uses thereof |
| US8609371B2 (en) * | 2008-08-12 | 2013-12-17 | Allylix, Inc. | Isoprenoid compounds |
| CN103243083B (en) * | 2012-02-06 | 2015-06-03 | 中国科学院上海生命科学研究院 | Novel sesquiterpene synthetase and application thereof |
-
2015
- 2015-07-13 CN CN201510409204.5A patent/CN105087579B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105087579A (en) | 2015-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105087579B (en) | The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs | |
| Blanc et al. | Efficient Agrobacterium tumefaciens-mediated transformation of embryogenic calli and regeneration of Hevea brasiliensis Müll Arg. plants | |
| CN105925577B (en) | The promoter and application of controlling gene predominant expression in secreting type glandular hairs basal cell | |
| CN105177007B (en) | The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs | |
| CN105505935B (en) | AaALDH1 gene promoters and application thereof | |
| CN105087580B (en) | The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs | |
| CN105132423B (en) | The promoter and its application that a kind of controlling gene is expressed in secreting type glandular hairs | |
| CN105274109B (en) | The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs | |
| CN105132422B (en) | The promoter and its application that a kind of controlling gene is expressed in nonsecreting type glandular hairs | |
| CN107937398A (en) | Sweet wormwood glandular hairs predominant expression AaTCP15 gene promoters and application | |
| CN108070596A (en) | Sweet wormwood glandular hairs predominant expression AaTCP14 gene promoters and its preparation method and application | |
| CN108441495A (en) | A kind of AaWBC1 gene promoters and its function verification method and application | |
| CN106282186B (en) | A kind of AaADH1 gene promoter and its application and preparation method | |
| CN107435044A (en) | The promoter of paddy rice stamen specifically expressing and its application | |
| CN113308468B (en) | Plant root specific promoter and application thereof | |
| CN105567685B (en) | AaPDR3 gene promoters and its application | |
| CN105779456B (en) | A kind of AaPDR2 gene promoters and its function verification method and application | |
| CN105112420B (en) | A kind of AaTSW1 gene promoters and its application and preparation method | |
| CN105861506A (en) | Rice endosperm non-expression promoter SAFES2 and separation method and application thereof | |
| Elayabalan et al. | Genetic engineering in banana and plantain | |
| CN105112421B (en) | A kind of AaTSW2 gene promoters and its application and preparation method | |
| CN109852614A (en) | A kind of promoter and its application that controlling gene is expressed in nonsecreting type glandular hairs | |
| CN110157710A (en) | Henbane NaD1 gene promoter and application thereof | |
| CN102533766B (en) | Seed-specific promoter and application thereof | |
| CN106399305B (en) | The building and identification of rice green organizing specific expression synthetic promoter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |