CN115820588A - Glycosyl transferase derived from camelina sativa and application thereof - Google Patents

Abstract

The invention discloses glycosyltransferase derived from camelina sativa and application thereof. The amino acid sequence of the UDP-glycosyltransferase disclosed by the invention is shown as SEQ ID NO. 1, and the amino acid sequence of a mutant thereof is shown as SEQ ID NO. 3. The UDP-glycosyltransferase and the mutant thereof provided by the invention can efficiently catalyze tyrosol to convert salidroside, and the mutant has better substrate tolerance and has important significance for production and application of salidroside.

Description

Glycosyl transferase derived from camelina sativa and application thereof

Technical Field

The invention belongs to the technical field of functional enzyme screening, and relates to UDP-glycosyltransferase derived from Camelina sativa L and mutants thereof, nucleic acid molecules for encoding the UDP-glycosyltransferase, recombinant vectors and recombinant cells containing the nucleic acid molecules, a preparation method of the UDP-glycosyltransferase and the mutants thereof, and application of the UDP-glycosyltransferase and the mutants thereof in preparation of salidroside.

Background

Salidroside is the main effective component of rhodiola rosea, belongs to phenylethanol derivatives, has a plurality of remarkable beneficial effects of oxidation resistance, inflammation resistance, fatigue resistance, hypoxia resistance, aging resistance, radiation resistance and the like, and is widely added to the production of various medicines, health care products, cosmetics and the like at present. The traditional acquisition method is to extract from plants, but the original content of salidroside in the plants is lower, so that the separation and extraction cost is higher; the synthesis can also be carried out by a chemical method, but a noble metal catalyst is needed to be used in the process, and multi-step reactions such as group protection, deprotection and the like are carried out, so that the method is not favorable for industrial large-scale production.

In recent years, researchers have attempted to clear the natural synthetic pathway of salidroside, which is expected to be industrially produced by genetically engineering microorganisms. At present, it is clear that salidroside can be generated by glycosylation of tyrosol at 8-OH group, the glycosylation reaction is catalyzed by uridine diphosphate glucosyltransferase (UGT), the method has high atom economic benefit, but the activity of the UGT is always the rate-limiting step of the reaction, researchers obtain enzyme genes of UGT73B6, UGT74R1, UGT72B1, UGT73C5, UGT73C6, UGT85A1 and the like from rhodiola sachalinensis, arabidopsis thaliana and bacillus subtilis, and clone and heterologous expression are carried out, but the phenomena of insufficient enzyme activity, low substrate conversion rate, poor substrate tolerance and the like exist, and the production and application of salidroside are greatly limited. Therefore, obtaining glycosyltransferases with high catalytic activity is very important for creating biosynthetic pathway for efficiently synthesizing salidroside.

Disclosure of Invention

The invention aims to provide UDP-glycosyltransferase derived from Camelina sativa L and a mutant thereof, aiming at solving the problem that the enzymatic activity and substrate tolerance in the catalytic synthesis of salidroside by the prior glycosyltransferase are limited.

Specifically, the UDP-glycosyltransferase is obtained from camelina sativa, the amino acid sequence of the UDP-glycosyltransferase is shown as SEQ ID NO. 1, the nucleotide sequence after codon optimization is shown as SEQ ID NO. 2, and the UDP-glycosyltransferase mutant which is obviously improved in the aspects of enzyme activity and substrate tolerance is obtained by further carrying out mutation treatment on the UDP-glycosyltransferase, wherein the amino acid sequence of the UDP-glycosyltransferase is shown as SEQ ID NO. 3, and the nucleotide sequence of the UDP-glycosyltransferase is shown as SEQ ID NO. 4.

In a first aspect, the present invention provides a UDP-glycosyltransferase having an amino acid sequence shown in SEQ ID NO 1.

The UDP-glycosyltransferase provided by the present invention can be a natural, recombinant or synthetic active polypeptide, which can be a natural purified product, a chemically synthesized product, or a product produced by using recombinant technology from a prokaryotic host (e.g., escherichia coli) or a eukaryotic host (e.g., yeast, higher plant).

In some embodiments, the UDP-glycosyltransferase is obtained by transforming a recombinant vector containing a gene encoding the UDP-glycosyltransferase into an escherichia coli expression host (e.g., e. Coli BL21 (DE 3)) to construct a recombinant genetically engineered strain, culturing the strain, and adding an inducer to induce expression.

In a second aspect, the present invention provides a nucleic acid molecule encoding the above UDP-glycosyltransferase, which has a nucleotide sequence shown in SEQ ID NO. 2, wherein the nucleotide sequence is codon-optimized.

The nucleic acid molecule provided by the present invention can be obtained by amplification using a PCR instrument or by artificial synthesis.

In a third aspect, the present invention provides a mutant of the above UDP-glycosyltransferase, which has an amino acid sequence shown in SEQ ID NO. 3 and further has improved catalytic activity and substrate tolerance as compared with the above UDP-glycosyltransferase. Compared with the amino acid sequence of UDP-glycosyltransferase shown in SEQ ID NO. 1, the mutant has the following mutations: arg at position 64 is mutated into His, leu at position 193 is mutated into Val, gly at position 335 is mutated into Ser, and Ile at position 461 is mutated into Val.

The mutant of the UDP-glycosyltransferase provided by the invention can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression, for example, the mutant is obtained by expression from a prokaryotic host (escherichia coli) or a eukaryotic host (such as yeast and higher plants) by using a recombinant technology.

In some embodiments, the UDP-glycosyltransferase mutant is obtained by transforming a recombinant vector containing a gene encoding the mutant into an escherichia coli expression host (e.g., e.coli BL21 (DE 3)) to construct a recombinant genetically engineered bacterium, culturing the strain, and adding an inducer to induce expression.

In a fourth aspect, the present invention provides a nucleic acid molecule encoding the above mutant, the nucleotide sequence of which is shown in SEQ ID NO. 4.

The mutant nucleic acid molecules provided by the invention can be obtained by amplification by using a PCR instrument or artificial synthesis methods.

In a fifth aspect, the present invention provides a recombinant vector comprising a nucleic acid molecule as described in any one of the above. Specifically, the recombinant vector includes a cloning vector for replicating a relevant sequence and an expression vector for expressing a relevant gene.

In some embodiments, the recombinant vector is pET-ugt71D1 or pET-ugt-32, which is obtained by replacing the nucleic acid molecule encoding the UDP-glycosyltransferase or the mutant with the sequence between the HindIII and EcoRI cleavage sites of pET-28a (+), respectively, and leaving the remaining sequence unchanged.

In a sixth aspect, the present invention provides a recombinant cell comprising the recombinant vector of any one of the above.

In some embodiments, the recombinant cell expresses the UDP-glycosyltransferase or mutant described above upon induction.

In some embodiments, the recombinant cell is constructed by a method comprising:

and transforming the recombinant vector into an expression host cell, culturing, and adding an inducer to induce expression to obtain the UDP-glycosyltransferase or the mutant.

Further, the recombinant vector is any one of the recombinant vectors described above, and the expression host cell is a prokaryotic cell or a eukaryotic cell, such as escherichia coli, yeast, and the like, preferably escherichia coli expression host e.coli BL21 (DE 3).

In some embodiments, the recombinant cell is recombinant bacterium U and recombinant bacterium 32, and the recombinant cell may be a recombinant genetically engineered bacterium. The culture medium used when the recombinant genetically engineered bacterium expresses the UDP-glycosyltransferase or the mutant thereof may be a culture medium, such as LB culture medium, which allows the recombinant genetically engineered bacterium to grow and express the UDP-glycosyltransferase or the mutant thereof of the present invention.

The culture method and the culture conditions have no special requirements, and the recombinant genetic engineering strain is ensured to grow normally and to induce and express UDP-glycosyltransferase and mutants thereof at the temperature of 18 ℃ for example.

More specifically, the method for constructing the recombinant cell comprises the following steps:

(1) Amplifying UDP-glycosyltransferase gene;

(2) Obtaining a gene of a UDP-glycosyltransferase mutant;

(3) Constructing recombinant expression plasmids pET-ugt71D1 and pET-ugt-32;

(4) The recombinant expression plasmids pET-ugt71D1 and pET-ugt-32 are transformed into host cells;

(5) Screening a plate resistance culture medium to obtain a positive clone strain, a recombinant strain U and a recombinant strain 32;

in a seventh aspect, the present invention provides a method for producing a UDP-glycosyltransferase or a mutant thereof, comprising the steps of:

1) Culturing any one of the recombinant cells and adding an inducer to induce expression of the UDP-glycosyltransferase or the mutant thereof to obtain a culture;

2) Isolating the above UDP-glycosyltransferase or a mutant thereof from the culture;

among them, the method of culturing and inducing recombinant cells and the method of isolating UDP-glycosyltransferase and its mutant from the culture are conventional in the art.

In an eighth aspect, the present invention provides the use of the UDP-glycosyltransferase described above, the nucleic acid molecule described in any of the above, the mutant described above, the recombinant vector described above, the recombinant cell described above and/or the UDP-glycosyltransferase prepared by the method described above, and mutants thereof, in the preparation of salidroside.

In a ninth aspect, the invention provides a preparation method of salidroside, which comprises the following steps: the UDP-glycosyltransferase, the mutant, the recombinant cell and/or the UDP-glycosyltransferase prepared by the method or the mutant thereof are used as a catalyst to catalyze a substrate tyrosol to obtain salidroside.

In some embodiments, in the above preparation method, the reaction conditions for the catalysis are: the reaction temperature is 25-50 ℃, such as 25 ℃, 30 ℃, 35 ℃,40 ℃, 45 ℃, 50 ℃, or a value or range between any two of these values, wherein 30 ℃ is preferred as the reaction temperature; the reaction pH is 6 to 8, and may be adjusted with a phosphate buffer, for example, by adjusting the reaction pH with 50mM PBS (pH 7.5); the reaction time is from 0.1 to 5h, for example 0.1h, 1h, 2h,3h, 4h, 5h, or a value or range between any two of these values, preferably 3h.

Tyrosol acts as a substrate for the enzyme-catalysed reaction of the invention, in some embodiments in a final concentration of from 2 to 50mM, for example 2mM, 5mM, 10mM, 20mM, 30mM, 40mM, 50mM, or a value or range between any two of these values, preferably 30mM.

In some embodiments, magnesium ions (Mg) are also included in the catalytic reaction ²⁺ ) The concentration of magnesium ions is 0.1-1mM, e.g. 0.1mM, 0.4mM, 0.6mM, 0.8mM, 1mM, or a value or range between any two of these values, preferably 1mM.

The recombinant cell or lyophilized powder thereof can be used as catalyst for whole-cell catalytic production of salidroside, wherein the amount of catalyst is 5-100mg/g tyrosol if the catalyst is lyophilized powder, and the amount of catalyst is 50-200mg bacteria culture solution if the catalyst is recombinant cell culture solutionLiquid (OD) ₆₀₀ 2)/g tyrosol, it is to be understood that the UDP-glycosyltransferase or a mutant thereof provided by the present invention may be used in the form of whole cells of an engineered bacterium, may be used in the form of crude enzyme without purification, may be used in the form of partially purified or fully purified enzyme, and may be used to prepare the UDP-glycosyltransferase or a mutant thereof of the present invention as an immobilized enzyme or a catalyst in the form of immobilized cells by using an immobilization technique known in the art.

The invention provides UDP-glycosyltransferase derived from camelina sativa for the first time, and further performs mutation treatment on the UDP-glycosyltransferase to obtain a UDP-glycosyltransferase mutant, wherein when the mutant catalyzes tyrosol to be converted into salidroside, the enzyme activity can reach 50.9U/mL which is 2.36 times of that of the original enzyme; when the concentration of tyrosol is increased to 50mM, the catalytic conversion rate of the mutant enzyme is 9.7 percent, which is 3 times of that of the original enzyme, and the method is favorable for further improving the yield of salidroside. The UDP-glycosyltransferase and the mutant thereof provided by the invention can efficiently catalyze tyrosol to convert salidroside, and the mutant has better substrate tolerance and has important significance for production and application of salidroside.

Drawings

FIG. 1 is a PCR-verified electrophoretogram of a colony of the recombinant bacterium 32.

FIG. 2 is an HPLC chromatogram, wherein (a) is an HPLC chromatogram of a tyrosol standard, (b) is an HPLC chromatogram of a salidroside standard, and (c) is an HPLC chromatogram of a reaction solution for measuring enzyme activity of a mutant.

Detailed Description

The present invention will be further described with reference to the following examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are all routine operations in the field or experimental methods suggested by manufacturers of kits and instruments. Reagents and biomaterials used in the examples were commercially available without specific reference.

pET-28a (+) is a product of Biotechnology (Shanghai) Inc., having product catalog number B540183.

Example 1: acquisition of the Gene sequence of UDP-glycosyltransferase

1. The Gene ID of UDP-glycosyltransferase 71D1 derived from Camelina sativa (Camelina sativa L.) registered in the NCBI official website is 104789205, and the amino acid sequence of the encoded enzyme is shown in SEQ ID NO. 1. By comparison, the homology of the Gene sequence of the enzyme and the UGT71D1 (Gene ID: 817523) Gene sequence derived from Arabidopsis thaliana (Arabidopsis thaliana) is 87%.

MRNAELIFIPTPTIGHLVPFLEFARRLIEQDARIRITILLMKLQGQSHMDSYVKSIASSLPFVRFIDVPELEEKPTLGTTQSVEAYVYDIIERNIPLVRNIVMDILTSLALDGVNVNGIVADLFCLPMIDVAKDASLPFHVFLTTNSGFLAMMKYLADRHCKDTSLFVKDSGEMLSIPGFVNPVPAKVLPSALFLEDGYDAYVKLAILFTKAKGVLVNSSFDIEPCSVSHFHHEQNYPSVYAVGPIFNRKAHPHPDQDLARRDELMKWLDDQPEASVVFLCFGSMGKLRGPLVKEIAHGLELCQYRFLWSLRTEEVTNVELLLPEGFLDRVAGRGMICGWSPQVEILAHKAVGGFVSHCGWNSIVESLWFGVPIVTWPMYAEQQLNAFLMVKELNLAVDMRLDYRAHSDELVSANEIETAVRCVMNKDNNVVRKRVMDISKMAREATMNGGSSYLAIEKFIQDVIGTKP(SEQ ID NO:1)

2. In order to realize the heterologous expression of the enzyme in the Escherichia coli, the gene sequence of the enzyme is subjected to codon optimization, the optimized sequence is shown as SEQ ID NO. 2, and artificial gene synthesis is carried out.

atgaggaatgctgaactaatatttattcccactccgacgatcggccatctggttccgttcttggaatttgcacgtcgtctgattgagcaagatgcgcgtatccgtattaccattctgctgatgaagctgcaaggtcagtctcacatggactcctacgttaaaagcatagcgagcagcttgccgttcgtgcgcttcatcgacgttccggagctagaagagaaaccgactctgggcaccacccagtcggtggaggcctatgtctacgacatcatcgaacgtaatattccgttggtgcgcaacatcgtgatggacatcctgacctctctcgcgttggatggtgtcaacgtcaacggtattgtggcggacctgttctgcctgccgatgattgacgtagcgaaggacgcgtcccttccgttccacgtctttttgacgacgaactccggcttccttgctatgatgaagtatctcgcggatcgtcattgtaaagacaccagcttgttcgtgaaggacagcggtgaaatgctgagcatcccgggttttgttaacccggttccggcaaaggtgctgccaagcgcgctgttcttggaggatggctacgatgcctacgtgaagttggccattctgttcaccaaagctaagggtgttctggtgaactcgagctttgatatcgagccgtgtagcgttagccactttcatcatgaacaaaactatccgtctgtgtacgctgtgggtccgatttttaatcgtaaggcgcacccgcatccggatcaggatctggcgcgccgtgatgagctgatgaagtggctggacgaccaaccggaggcgagcgtggtttttttatgctttggttcgatgggtaaactgcgtggtccgctggttaaagagatcgcccacggcctggaactctgtcagtatcgtttcctgtggagcttgcgcaccgaagaggttaccaacgtagagttgctgctgccggaaggtttccttgaccgcgtggcgggtcgtggtatgatctgcggctggtcaccgcaggttgagatcctggctcacaaagcggttggtggctttgtcagccactgcgggtggaacagcattgtggagagcctgtggttcggcgtgccgatcgttacgtggcctatgtatgcggaacagcagctgaatgcatttctgatggttaaagaactgaatctggcggtggatatgcgtctggactaccgcgcacactccgatgagttagtcagcgctaatgaaatcgaaaccgcagttcgctgcgttatgaataaagacaacaacgtggtgcgtaaacgtgttatggacatcagcaaaatggcacgtgaggcgaccatgaacggcggcagttcttacctggcgatcgagaagtttattcaagatgttattggcaccaaaccataa(SEQ ID NO:2)

3. The DNA shown by SEQ ID NO. 2 obtained in step 2 was used as a template with the upstream primer 1 (5' -aagcttatgaatgctgaactaatattcccactc-3', SEQ ID NO: 5) and the downstream primer 2 (5-gaattcttatgggtttggtgccaataacacatcttgaat-3', SEQ ID NO: 6) to obtain a DNA fragment containing a UDP-glycosyltransferase gene.

Example 2: obtaining gene sequence of UDP-glycosyltransferase mutant by error-prone PCR technology

The use of error-prone PCR can alter and increase the natural error rate of the polymerase based on standard PCR. Error-prone PCR reactions typically contain higher concentrations of magnesium chloride (7 mM) to stabilize the non-complementary pair compared to the basic PCR reaction (1.5 mM). This example utilizes error-prone PCR techniques to obtain mutants of the UDP-glycosyltransferase gene.

The DNA shown in SEQ ID NO. 2 is used as a template, and the upstream primer 1 and the downstream primer 2 are used as primers to carry out error-prone PCR according to the following reaction system, so that 90 mutants of the UDP-glycosyltransferase gene are obtained.

Error-prone PCR reaction system: 5. Mu.l of 10 XPmplification buffer, 4. Mu.l each of 4 kinds of dNTP mix (2.5 mmol/L), 50pmol each of primers, 1.5. Mu.g of template DNA, 0.5. Mu.L of Taq DNA polymerase, mg ²⁺ 7mmol/L, purified water was added to 50. Mu.l.

Example 3: cloning of UDP-glycosyltransferase Gene (ugt 71D 1) and construction of expression Strain

1. HindIII and EcoRI double digestion of the DNA fragment containing the UDP-glycosyltransferase gene obtained in example 1 to obtain a gene fragment; hindIII and EcoRI are subjected to double digestion of pET-28a (+) to obtain a vector fragment; the gene fragment and the vector fragment are connected to obtain a recombinant expression plasmid, the recombinant expression plasmid is named as pET-ugt71D1, the plasmid is sent for sequencing, and the result is consistent with the expectation.

2. Transferring the recombinant expression plasmid pET-ugt71D1 obtained in the step 1 into E.coli DH5 alpha competent cells through heat shock, coating LB solid culture medium containing 50 mu g/mL kanamycin, culturing to obtain a corresponding monoclonal strain, and obtaining pET-ugt71D1 plasmid through amplification and plasmid extraction. The obtained plasmid is transferred into E.coli BL21 (DE 3) by a chemical conversion mode, and an LB solid culture medium containing 50 mu g/mL kanamycin is coated for screening to obtain a recombinant bacterium U for expressing UDP-glycosyltransferase.

Example 4: cloning of UDP-glycosyltransferase gene mutant and construction of expression strain

Recombinant plasmids pET-ugt-1 to pET-ugt-90 were constructed using 90 mutants of the UDP-glycosyltransferase gene obtained in example 2, respectively, according to the method of example 3, and recombinant bacterium 1-recombinant bacterium 90 expressing the UDP-glycosyltransferase mutant was obtained.

Example 5: UDP-glycosyltransferase mutant with high-efficiency catalytic efficiency is obtained by high-throughput screening

The recombinant bacteria constructed in example 4 were cultured in 5mL of LB liquid medium containing 50. Mu.g/mL of kanamycin, while adding IPTG at a final concentration of 0.5mM to induce protein expression at 18 ℃ and after 16 hours, the OD of the bacterial solution was measured ₆₀₀ Value, and diluting the bacterial solution with water to OD ₆₀₀ The value is around 2. And (3) adding the diluted bacterial liquids into a 96-well plate respectively for reaction, and indirectly measuring UDP (user Datagram protocol) generated by the reaction by using an enzyme coupling method so as to monitor the catalytic capability of each mutant on tyrosol as a substrate, wherein the reaction of NADH (nicotinamide adenine dinucleotide) for generating NAD + can cause the change of light absorption at 340 nm.

The principle of the enzyme coupling method is as follows:

the specific reaction system is 250 μ L, and comprises 5mM tyrosol, 5mM UDP-glucose, and 1mM Mg ²⁺ 5mM NADH, 5mM PEP (phosphoenolpyruvate), 1mM PK (phosphokinase) and 1mM LDH (lactate dehydrogenase), 70mg of cell suspension (equivalent to 100mg of cell suspension/g tyrosol), and 50mM PBS (pH 7.5) as a buffer. The prepared reaction system was incubated for 1h at 30 ℃ in a shaking mixer at 120 rpm. After the reaction, the reaction was terminated by heating at 95 ℃ for 5min, and the reaction mixture was centrifuged to obtain 100. Mu.l of supernatant, and then 200. Mu.l of water was added thereto and the mixture was mixed well and then absorbance was measured at 340 nm.

And (3) carrying out plasmid extraction on a strain (recombinant strain 32) corresponding to the reaction solution with the lowest absorbance, and carrying out plasmid sequencing after extraction to obtain a gene sequence for coding the UDP-glycosyltransferase mutant as shown in SEQ ID NO. 4, and an amino acid sequence for coding the UDP-glycosyltransferase mutant as shown in SEQ ID NO. 3. Compared with the amino acid sequence of UDP-glycosyltransferase shown in SEQ ID NO. 1, the UDP-glycosyltransferase mutant has the following mutations: arg at position 64 is mutated into His, leu at position 193 is mutated into Val, gly at position 335 is mutated into Ser, and Ile at position 461 is mutated into Val.

MRNAELIFIPTPTIGHLVPFLEFARRLIEQDARIRITILLMKLQGQSHMDSYVKSIASSLPFVHFIDVPELEEKPTLGTTQSVEAYVYDIIERNIPLVRNIVMDILTSLALDGVNVNGIVADLFCLPMIDVAKDASLPFHVFLTTNSGFLAMMKYLADRHCKDTSLFVKDSGEMLSIPGFVNPVPAKVLPSAVFLEDGYDAYVKLAILFTKAKGVLVNSSFDIEPCSVSHFHHEQNYPSVYAVGPIFNRKAHPHPDQDLARRDELMKWLDDQPEASVVFLCFGSMGKLRGPLVKEIAHGLELCQYRFLWSLRTEEVTNVELLLPEGFLDRVAGRSMICGWSPQVEILAHKAVGGFVSHCGWNSIVESLWFGVPIVTWPMYAEQQLNAFLMVKELNLAVDMRLDYRAHSDELVSANEIETAVRCVMNKDNNVVRKRVMDISKMAREATMNGGSSYLAIEKFVQDVIGTKP(SEQ ID NO:3)

atgaggaatgctgaactaatatttattcccactccgacgatcggccatctggttccgttcttggaatttgcacgtcgtctgattgagcaagatgcgcgtatccgtattaccattctgctgatgaagctgcaaggtcagtctcacatggactcctacgttaaaagcatagcgagcagcttgccgttcgtgcgcttcatcgacgttccggagctagaagagaaaccgactctgggcaccacccagtcggtggaggcctatgtctacgacatcatcgaacgtaatattccgttggtgcgcaacatcgtgatggacatcctgacctctctcgcgttggatggtgtcaacgtcaacggtattgtggcggacctgttctgcctgccgatgattgacgtagcgaaggacgcgtcccttccgttccacgtctttttgacgacgaactccggcttccttgctatgatgaagtatctcgcggatcgtcattgtaaagacaccagcttgttcgtgaaggacagcggtgaaatgctgagcatcccgggttttgttaacccggttccggcaaaggtgctgccaagcgcgctgttcttggaggatggctacgatgcctacgtgaagttggccattctgttcaccaaagctaagggtgttctggtgaactcgagctttgatatcgagccgtgtagcgttagccactttcatcatgaacaaaactatccgtctgtgtacgctgtgggtccgatttttaatcgtaaggcgcacccgcatccggatcaggatctggcgcgccgtgatgagctgatgaagtggctggacgaccaaccggaggcgagcgtggtttttttatgctttggttcgatgggtaaactgcgtggtccgctggttaaagagatcgcccacggcctggaactctgtcagtatcgtttcctgtggagcttgcgcaccgaagaggttaccaacgtagagttgctgctgccggaaggtttccttgaccgcgtggcgggtcgtggtatgatctgcggctggtcaccgcaggttgagatcctggctcacaaagcggttggtggctttgtcagccactgcgggtggaacagcattgtggagagcctgtggttcggcgtgccgatcgttacgtggcctatgtatgcggaacagcagctgaatgcatttctgatggttaaagaactgaatctggcggtggatatgcgtctggactaccgcgcacactccgatgagttagtcagcgctaatgaaatcgaaaccgcagttcgctgcgttatgaataaagacaacaacgtggtgcgtaaacgtgttatggacatcagcaaaatggcacgtgaggcgaccatgaacggcggcagttcttacctggcgatcgagaagtttattcaagatgttattggcaccaaaccataa(SEQ ID NO:4)

Colony PCR verification of the recombinant bacteria 32 is performed by using the upstream primer 1 and the downstream primer 2, and an electrophoresis chart is shown in FIG. 1, wherein M represents DNA Marker, and lanes 1-8 are colony PCR products of the recombinant bacteria 32.

Example 6: preparation of enzyme and determination of enzyme activity

Respectively carrying out amplification culture on the recombinant bacterium U and the recombinant bacterium 32, centrifuging (8000rpm, 10min) fermentation liquor after amplification culture, crushing cells, carrying out freeze drying treatment, preparing freeze-dried powder of UDP-glycosyltransferase (primary enzyme) and a mutant (mutant enzyme) thereof, and storing at-80 ℃.

Definition of enzyme activity unit (U): the reaction system is 10ml, and contains 5mM substrate tyrosol, 5mM UDP-glucose, 35Mg lyophilized powder (equivalent to 50Mg lyophilized powder/g tyrosol), 1mM Mg ²⁺ When the buffer solution was 50mM PBS (pH 7.5), the temperature was 30 DEG CThe amount of enzyme required to catalyze the production of 1. Mu. Mol of salidroside per minute or 1. Mu. Mol of tyrosol per minute was 1 enzyme activity unit.

The reaction equation is as follows:

the enzyme activities of the original enzyme and the mutant enzyme are respectively 21.5U/mL and 50.9U/mL, and compared with the original enzyme, the enzyme activity of the mutant enzyme is increased by 1.36 times. The contents of the substrate tyrosol and the product salidroside can be detected by HPLC.

The specific detection method of HPLC is as follows: centrifuging 1mL of the reaction solution at 8000rpm for 10min, filtering the supernatant with 0.22 μm filter membrane, and separating with Shimadzu liquid chromatograph using 4.6 × 250mm C18 column; setting the detection wavelength to 225nm; mobile phase a was an aqueous solution containing 0.1% formic acid, mobile phase B was methanol, the volume ratio was 20% a/80% B, the flow rate was 1mL/min; the column temperature is 35 ℃; the amount of the sample was 10. Mu.L.

HPLC chromatograms of the standard substance and the mutant enzyme activity determination reaction liquid are shown in FIG. 2, the retention time of tyrosol standard substance is 12.8min, the retention time of salidroside standard substance is 10.9min, the retention time of tyrosol in the mutant enzyme activity determination reaction liquid is 12.8min, and the retention time of salidroside is 10.9min.

Example 7: substrate tolerance testing

The reaction system was prepared in a Erlenmeyer flask containing 2-50mM tyrosol and equal amounts of UDP-glucose, 1mM Mg ²⁺ 100mg of bacterial solution (OD) ₆₀₀ 2)/g tyrosol, 50mM PBS (pH 7.5) in buffer, and the reaction was carried out in a water bath at 30 ℃ and was terminated after 3 hours, to obtain the conversion rates of the two enzymes under the conditions of different substrate concentrations (conversion rate = (initial tyrosol reaction concentration-residual tyrosol concentration measured in liquid phase)/initial tyrosol reaction concentration = 100%) as shown in Table 1.

TABLE 1

The result shows that the mutant enzyme has better tolerance of substrate tyrosol, when the concentration of tyrosol is between 2 and 20mM, the conversion rate of the mutant enzyme can reach more than 22 percent, and compared with the original enzyme, the tolerance of the mutant enzyme is greatly improved; when the tyrosol concentration was increased to 50mM, the conversion of the original enzyme was as low as 3.2%, whereas the conversion of the mutant enzyme was 9.7%.

The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be able to cover the technical scope of the present invention and the equivalent alternatives or modifications according to the technical solution and the inventive concept of the present invention within the technical scope of the present invention.

Claims (10)

1. A UDP-glycosyltransferase has an amino acid sequence shown in SEQ ID NO. 1.

2. A nucleic acid molecule encoding a UDP-glycosyltransferase according to claim 1, having a nucleotide sequence shown in SEQ ID NO 2.

3. A mutant UDP-glycosyltransferase according to claim 1, having an amino acid sequence shown in SEQ ID NO 3.

4. A nucleic acid molecule encoding the mutant of claim 3, having the nucleotide sequence set forth in SEQ ID NO 4.

5. A recombinant vector comprising the nucleic acid molecule of claim 2 or 4.

6. A recombinant cell comprising the recombinant vector of claim 5.

7. A method for preparing UDP-glycosyltransferase or its mutant, comprising the following steps:

1) Culturing the recombinant cell of claim 6 and inducing expression of UDP-glycosyltransferase or a mutant thereof;

2) Isolating the UDP-glycosyltransferase of claim 1 or the mutant of claim 3 from the culture obtained in step 1).

8. Use of the UDP-glycosyltransferase of claim 1, the nucleic acid molecule of claim 2, the mutant of claim 3, the nucleic acid molecule of claim 4, the recombinant vector of claim 5, the recombinant cell of claim 6 and/or the UDP-glycosyltransferase produced by the process of claim 7 or a mutant thereof for the production of salidroside.

9. A method for preparing salidroside comprises the following steps: the UDP-glycosyltransferase according to claim 1, the mutant according to claim 3, the recombinant cell according to claim 6 and/or the UDP-glycosyltransferase produced by the method according to claim 7 or the mutant thereof is used as a catalyst to catalyze a substrate tyrosol to produce salidroside.

10. The method of claim 9, wherein: the reaction conditions of the catalysis are as follows: the reaction temperature is 20-50 ℃, the reaction pH is 6-8, and the reaction time is 0.1-5h; the substrate tyrosol concentration is 2-50mM ²⁺ The concentration is 0.1-1mM.

Images