CN115820524A - Construction method and application of genetic engineering bacteria for efficiently synthesizing lipopolysaccharide - Google Patents

Abstract

The invention discloses a construction method and application of a genetic engineering bacterium for efficiently synthesizing lipopolysaccharide, and belongs to the technical field of genetic engineering. The genetically engineered bacterium E.coliW3110 delta npr delta yhbJ delta fabF delta P _BAD(lpxD fabZ-lpxA-lpxB), wherein npr, yhbJ and fabF three gene deletion mutations are generated, and a promoter P is inserted in front of the chromosomal gene cluster lpxD-fabZ-lpxA-lpxB sequence _BAD . The genetically engineered bacterium of the invention has no resistance mark, good growth condition and is suitable for large-scale production, and the yield of the synthesized lipopolysaccharide is 13.0mg/gDCW, compared with the yield of the synthesized lipopolysaccharideColi W3110 increased by 91.2%.

Description

Construction method and application of genetic engineering bacteria for efficiently synthesizing lipopolysaccharide

Technical Field

The invention relates to a construction method and application of a genetic engineering bacterium for efficiently synthesizing lipopolysaccharide, belonging to the technical field of genetic engineering.

Technical Field

There are a variety of Toll-like receptors (TLRs) in mammalian cells, and particular TLRs recognize specific structural components of bacteria, fungi and viruses that invade the body, such as peptidoglycans, LPS, lipids, sugar chains, peptides, RNA or DNA. LPS is one of the most active pathogen-associated molecular patterns (PAMPs) known, and picogram-scale is capable of eliciting an immune response. Lipopolysaccharide-mediated signal transduction is an important link in the body's own defense response. Lipid a of lipopolysaccharide can be recognized by a host cell surface pathogen recognition receptor TLR4 (Toll-like receptor). Upon recognition, it activates intracellular signaling cascades, releases a variety of proinflammatory cytokines such as IL-6, IL-8, TNF- α, and produces co-stimulatory molecules that ultimately activate both humoral and cellular responses.

The vaccine can be used for enhancing the immunity intensity when being inoculated with a vaccine naturally containing bacterial components such as LPS, such as an attenuated vaccine, an inactivated vaccine, or a vaccine prepared by inoculating a purified antigen with LPS or a derivative thereof. Such molecules that provide "help" to an antigen are defined as vaccine adjuvants, which have an important role in the generation and enhancement of immune responses. Lipopolysaccharide is an active component for showing gram-negative bacteria virulence, the key structure of the lipopolysaccharide is lipoid A, and the lipoid A with different structures has different immune functions. People can obtain lipopolysaccharide or lipoid A structures with different structures through genetic engineering modification so as to obtain vaccine adjuvants or immunity experiment reagents with different functions, such as MPL, MPLA and Kdo ₂ -lipidA and the like. However, the production of E.coli strains naturally synthesizing these lipopolysaccharide molecules is low.

Disclosure of Invention

In order to solve the problems, the invention constructs a non-resistance Escherichia coli genetic engineering bacterium which has clear genetic background and can produce lipopolysaccharide, reasonably enhances the lipopolysaccharide synthesis way by means of gene editing, and effectively improves the lipopolysaccharide synthesis amount. The genetic engineering bacteria for synthesizing lipopolysaccharide has no resistance mark, has good growth condition and is suitable for large-scale production.

In order to solve the technical problems, the genetic engineering bacteria provided by the invention have deletion mutation inactivation on npr, yhbJ and fabF, and a promoter P is inserted in front of a gene cluster lpxD-fabZ-lpxA-lpxB sequence _BAD 。

The genetically engineered bacterium is E.coli W3110 delta npr delta yhbJ delta fabF delta P _{BAD(lpxD-fabZ-lpxA-lpxB)} It is constructed on the basis of Escherichia coli W3110 and named as strain WOZF01.

In the present invention, the amino acid sequences of the npr, yhbJ, and fabF gene deletion fragments are the sequences indicated by "BAE77250.1", "BAE77249.1", and "BAA35903.1" in NCBI, respectively.

In the present invention, the promoter P _BAD The sequence of (A) is the sequence shown in SEQ ID NO. 37.

In the invention, a promoter P is inserted in front of a gene cluster lpxD-fabZ-lpxA-lpxB _BAD Expression is carried out directly on the original chromosome.

In one embodiment, the deletion mutation inactivation is by gene knockout.

In one embodiment, the deletion mutation is a gene knockout in e.coli W3110 using the CRISPR-Cas9 knockout system.

In one embodiment, the knockout is a Cas enzyme mediated fragment recombination using CRISPR-Cas9 knockout system, and finally the pCas plasmid is removed by culture at 42 ℃ to obtain the genetically engineered bacterium which effectively synthesizes lipopolysaccharide without resistance.

The invention also provides a method for producing lipopolysaccharide by using the genetic engineering bacteria.

In one embodiment, the method is an arabinose-induced fermentation method.

In one embodiment, the method wherein arabinose is added to the LB liquid medium to a final concentration of 22.5mM for fermentation.

In one embodiment, the process wherein the fermentation conditions are 37 ℃ and 200rpm.

The invention also provides the application of the genetic engineering bacteria, which is to produce lipopolysaccharide by utilizing the genetic engineering bacteria, and then apply the lipopolysaccharide to cellular immunity or prepare vaccines containing lipopolysaccharide components.

The invention has the beneficial effects that:

genetically engineered bacterium E.coli W3110. Delta. Npr. Delta. YhbJ. Delta. FabF. Delta. P _{BAD(lpxD-fabZ-lpxA-lpxB)} The deletion mutation of three genes of npr, yhbJ and fabF is generated, and a promoter P is inserted in front of the lpxD-fabZ-lpxA-lpxB sequence of the chromosome gene cluster _BAD . The genetic engineering bacteria of the invention have no resistance mark, good growth condition and suitability for large-scale production, and the yield of the synthesized lipopolysaccharide is 13.0mg/gDCW, which is increased by 91.2 percent compared with the wild E.coli W3110.

Drawings

FIG. 1: genetically engineered bacterium E.coli W3110. Delta. Npr. Delta. YhbJ. Delta. FabF. Delta. P _{BAD(lpxD-fabZ-lpxA-lpxB)} (WOZF 01) SDS-PAGE silver stain analysis of lipopolysaccharide;

FIG. 2: genetically engineered bacterium E.coli W3110. Delta. Npr. Delta. YhbJ. Delta. FabF. Delta. P _{BAD(lpxD-fabZ-lpxA-lpxB)} (WOZF 01) lipopolysaccharide yield analysis;

FIG. 3: strain E.coliW3110, genetically engineered bacterium E.coliW 3110. Delta. Npr. Delta. YhbJ. Delta. FabF (WOZF) and E.coliW3110. Delta. Npr. Delta. YhbJ. Delta. FabF. Delta. P _{BAD(lpxD-fabZ-lpxA-lpxB)} (WOZF 01) growth curve;

FIG. 4: SDS-PAGE silver staining analysis and quantitative analysis of lipopolysaccharide of the recombinant strain WOZF/pWSK29-DZAB.

Detailed Description

1. The extraction method of lipopolysaccharide comprises the following steps:

extracting Escherichia coli LPS by thermal phenol hydrolysis, culturing seed overnight, and culturing with initial OD ₆₀₀ =0.02 transfer to 200mL LB medium, 37 ℃,200rpm culture for 16h, determination of cell concentration, record. By empirical value OD ₆₀₀ ＝0.323gDCW·L ^-1 For the standard, the dry matter amount is specified to be 258.4g, and the volume of the bacterial liquid (marked as V) is calculated ₁ ). Transferring the bacterial liquid with different volumes and the same dry weight to a large centrifugal bottle, centrifuging at 8000g for 20min, and discarding the supernatant. By ddH ₂ The pellet was aspirated in O15 mL and transferred all to a clean 50mL centrifuge tube. 15mL of 90% by volume hot benzene were addedAnd (3) screwing the cover, placing the phenol in a 68 ℃ water bath shaking table, shaking for 1h at the rotating speed of 150rpm, and turning the centrifugal tube upside down every 20 minutes to ensure that the thalli are fully cracked. After the water bath oscillation is finished, ventilating and cooling to room temperature, rotating speed is 4000g, temperature is 4 ℃, centrifuging for 20min for phase separation, and continuously standing for 4-8 hours. Carefully transfer the upper phase 5mL (noted V) ₂ ) Putting into a dialysis bag, dialyzing in deionized water for 24h, and changing water once every 4 h. And after the dialysis is finished, completely pouring the liquid in the dialysis bag into another clean 50mL centrifuge tube, freezing for 2-3h at the temperature of-80 ℃, putting the liquid into a vacuum freeze dryer after freezing to be opaque, and freeze-drying for 2 days to obtain the white fluffy bulk crude LPS. And (3) crude sample purification: the crude LPS containing impurities was resuspended in 10mL Tris-HCl buffer (formulation 100mM pH 7.5Tris-HCl,25mM MgCl) ₂ ，1mM CaCl ₂ ). Adding Dnase I and RNaseA to remove nucleic acid pollution, wherein the working concentration of both is 1 mug. Mg < -1 >, and reacting for 2 hours in a water bath shaker at 37 ℃. Then, 1. Mu.g. Mg-1 proteinase K was added to remove the residual protein, and the mixture was placed in a shaker at 37 ℃ for reaction for 2 hours. At this time, 5mL of water saturated phenol is added to terminate the reaction, and all proteins are precipitated (the water saturated phenol needs to be prepared one day in advance, 80mL of deionized water is added into 300g of phenol, the mixture is heated and stirred in a water bath until the mixture is dissolved, then the mixture is transferred into a 1L separating funnel filled with 200mL of deionized water, the mixture is gently shaken and mixed to form emulsion, the emulsion is kept for 6 hours for layering, the lower layer of colorless transparent liquid is the water saturated phenol, and the lower layer of the colorless transparent liquid is discharged from the separating funnel to a brown reagent bottle for storage.). Mixing to obtain turbid solution, centrifuging at 4000rpm for 30min, collecting the upper phase, and dialyzing for 24 hr. The lyophilization procedure was then repeated and the fluffy solid obtained was redissolved in chloroform: methanol =2:1 in the mixture, the mixture was centrifuged at 12000rpm for 20 minutes, and the supernatant was decanted and washed again. And (4) freeze-drying again, re-dissolving in water, and freeze-drying again to obtain the pure LPS product.

2. Detection and quantification of LPS:

polyacrylamide gel electrophoresis and silver staining for color development: polyacrylamide gel electrophoresis (SDS-PAGE) detection: the crude lyophilized LPS was dissolved in 1mL of deionized water and facilitated by sonication until a pale yellow homogeneous solution was obtained. Adding a commercial sample buffer to the LPS solution in a volume ratio of 4Washing SDS loading buffer, heating in water bath at 100 deg.C to remove spatial structure, and boiling for 10min to completely denature LPS. After completion of the water bath, the gel was cooled slightly to room temperature, spotted and 10. Mu.L of the spotted gel was added to the wells. When the LPS sample was on the top 5% gel, a constant current of 12mA was set, and the strip ran to the separation gel interface, the constant current was switched to 25mA. And stopping electrophoresis when the blue strip runs to about 1cm away from the bottom. Silver staining and color development: firstly, preparing a stationary liquid: 30% ethanol, 10% glacial acetic acid; oxidizing liquid: 30% ethanol, 10% glacial acetic acid, 0.7% periodic acid; silver ammonia solution: 28mL 0.1mol. L-1NaOH,1gAgNO ₃ 125mL of deionized water and 2mL of ammonia water are prepared as required; color development liquid: 0.05 g.L-1 citric acid, 0.02% formaldehyde. Silver staining step (1) rinsing. Simply washing away impurities on the surface of the gel by using deionized water; and (2) fixing. Fixing the solution for 20min to increase LPS staining sensitivity; and (3) oxidizing. Oxidizing the oxidizing solution for 20min; and (4) rinsing. The deionized water is gently shaken and washed for 20min, and the washing is repeated for three times, so that the rinsing time can be properly prolonged; and (5) silver staining. The prepared silver ammonia solution is used for treating gel for 10min, and sometimes, the oxidation time can be shortened due to overlarge sample concentration; (6) Washing with double distilled water for 20min, repeating the treatment with the developing solution three times (7) until the gel shows LPS bands, quickly and carefully pouring off the developing solution to prevent over reaction and excessive concentration of bands.

3. And (3) LPS (lipopolysaccharide) quantification:

(1) And (3) standard curve determination: weighing a certain amount of purified LPS on a precision balance, and preparing into 2-20 mg/mL-1 gradient standard solution by vortex oscillation and ultrasonic dissolution promotion. Samples of the solution with different concentration gradients were taken and 50. Mu.L each, in triplicate, placed in a clean 1.5mL centrifuge tube and placed on ice. Cysteine hydrochloride with the mass fraction of 6 percent is prepared in a fresh way and is placed on ice in the dark. A blank was set and 50. Mu.L of deionized water was added. The volume ratio of sulfuric acid to water in concentrated sulfuric acid used in the experiment was 6:1, it is prepared in advance and cooled because of the large amount of heat emitted, and it is put into an ice box as well. Adding 450 mu L of concentrated sulfuric acid into a centrifuge tube containing 50 mu L of LPS solution; continuously adding 5 mu L of cysteine hydrochloride solution into the centrifuge tube, and reinserting the solution into ice after violent shaking; after 3 minutes, the sample is thrown out of the boiling water and boiled for 20 minutes; transferring 100 mu L of reaction mixed liquid into a 96-well plate after 1 hour, measuring the numerical values of the absorption light wavelength at 505 nm and 545nm by using an enzyme-labeling instrument, and carrying out subtraction to obtain the required difference value; a standard curve was prepared based on the LPS concentration (X) and the difference (Y).

The various mutants whose yields need to be determined were tested for LPS solution concentration by quantifying the crude extracted LPS sample, diluting the sample to 1mL with deionized water. The procedure was as above for the standard curve determination.

(2) LPS quantification of each mutant strain

The various mutants whose yields need to be determined were tested for LPS solution concentration by quantifying the crude extracted LPS sample, diluting the sample to 1mL with deionized water. The procedure was as above for the standard curve determination.

Example 1: mutant E.coli W3110. Delta. Npr. Delta. YhbJ. Delta. FabF. Delta. P _{BAD(lpxD-fabZ-lpxA-lpxB)} Construction of

In this example, a three-gene-deleted strain E.coli W3110. Delta. Npr. Delta. YhbJ. Delta. FabF (named WOZF) was constructed, and then an arabinose-inducible promoter P was added in front of the chromosomal gene cluster lpxD-fabZ-lpxA-lpxB _BAD (the sequence is shown as SEQ ID NO. 37) to obtain a mutant strain E.coliW3110 delta npr delta yhbJ delta fabF delta P _{BAD(lpxD-fabZ-lpxA-lpxB)} (named WOZF 01).

Wherein, the amino acid sequences of the npr, yhbJ and fabF gene knockout fragments are respectively the sequences shown in "BAE77250.1", "BAE77249.1" and "BAA35903.1" on NCBI. All primers used are listed in table 1.

1. Construction of mutant E.coli W3110. DELTA. Npr. DELTA. YhbJ. DELTA. FabF (named WOZF)

(1) Construction of knockout plasmids and knockout fragments

A CRISPR-Cas9 knockout system is adopted, a genome fragment takes a W3110 genome as a template, a fragment derived from a plasmid takes a corresponding plasmid as the template, a corresponding primer is added, and 2 Xpfx polymerase is used for obtaining the DNA fragment by PCR. And (3) recovering and purifying the fragments, and obtaining the fragments by using a gel recovery kit after the correct band is confirmed by nucleic acid gel electrophoresis.

The npr gene was first knocked out in W3110, and then the yhbJ and fabF genes were knocked out in tandem. The gene knock-out operation of the present invention will be briefly described by taking the construction of W31105. Delta. Npr as an example. The website chopchopchop (uib. No) was used to predict the NGG sequence recognizable by pTargetF-npr, which should be in the middle of the npr gene sequence. The sequence of 20bp before NGG in the npr sequence is introduced into the 5' end of the primer, a primer pair sg-npr-F/sg-npr-R is designed, and pTargetF is used as a template to obtain pTargetF-npr linear plasmid through PCR. This was introduced into JM109 chemical competence, plated on a spectinomycin selection plate, cultured overnight, and transformants were selected. And selecting a single colony as a template by taking N20-npr-F/N20-R as a primer, and carrying out colony PCR verification. The correct transformants obtained by the screening were inoculated into a liquid medium containing spectinomycin, and the plasmid pTargetF-npr was extracted. The upstream fragment was amplified using the primer pair npr-U-F/npr-U-R and the downstream fragment was amplified using the W3110 genome as a template. And overlapping the upstream and downstream fragments by fusion PCR through reverse complementary fragments on the primers to obtain a knockout fragment npr-UD.

Construction of W3110. DELTA. Npr. DELTA. YhbJ: pTargetF-yhbJ plasmid, N20-yhbJ-F/N20-R validation plasmid was constructed using the primer pair sg-yhbJ-F/sg-yhbJ-R. The upstream fragment was knocked out and amplified using yhbJ-U-F/yhbJ-U-R, and the downstream fragment was amplified using yhbJ-D-F/yhbJ-D-R. When the upstream and downstream are overlapped, a primer yhbJ-U-F/yhbJ-D-R is selected to obtain a knockout fragment yhbJ-UD.

Construction of W3110. DELTA. Npr. DELTA. YhbJ. DELTA. FabZ: the primer pair sg-fabF-F/sg-fabF-R was used to construct pTargetF-fabF plasmid, N20-fabF-F/N20-R validation plasmid. The upstream fragment is knocked out and amplified by fabF-U-F/fabF-U-R, and the downstream fragment is amplified by fabF-D-F/fabF-D-R. When the upstream and the downstream are overlapped, a primer fabF-U-F/fabF-D-R is selected to obtain a knock-out fragment fabF-UD.

(2) Homologous recombination construction of knockout transformants

Taking a knockout npr as an example, 200ng of knockout plasmid and 300ng of knockout fragment are transferred into W3110/pCas9 electrotransformation competence by electric shock, the cells are cultured on a spectinomycin and kanamycin double antibiotic plate for 20h at 30 ℃, the transformant is verified by a primer pair npr-U-F/npr-D-R, W3110 is used as negative control to obtain a transformant after correct knockout, kanamycin and IPTG are added, the cells are cultured overnight at 30 ℃, the knockout plasmid pTargetF-npr is removed by induction, and the other two genes are knocked out independently or in series.

(3) Resistance removal to obtain a non-resistant knockout mutant

Finally, the resistance of pCas9 is removed, the pCas9 is removed by transferring for two generations at 42 ℃, and the primer pair is verified to be npr-U-F/npr-D-R by taking the removal resistance of the npr knockout strain as an example. . The final knockout success of W3110. Delta. Npr without other plasmids. The same is true for the two remaining genes, either alone or in tandem. And carrying out PCR verification of corresponding gene knockout. Finally, genetically engineered bacteria E.coli W3110 delta npr, E.coli W3110 delta yhbJ, E.coli W3110 delta fabF and E.coli W3110 delta npr delta yhbJ delta fabF (named WOZF) are obtained.

2. Coli W3110. Delta. Npr. Delta. YhbJ. Delta. FabF. Delta. P _{BAD(lpxD-fabZ-lpxA-lpxB)} (named WOZF 01) construction

(1) Knock-out fragment and pTargetF-P _BAD Construction of plasmids

A CRISPR-Cas9 knockout system is adopted, a genome fragment takes a W3110 genome as a template, a fragment derived from a plasmid takes a corresponding plasmid as a template, a corresponding primer is added, and 2 Xpfx polymerase is used for obtaining the DNA fragment through PCR. And (3) recovering and purifying the fragments, and obtaining the fragments by using a gel recovery kit after the correct band is confirmed by nucleic acid gel electrophoresis.

Prediction of availability of pTargetF-P using website CHOPCHOP (uib. No) _BAD The recognized NGG sequence uses primer pair sg-P _BAD -F/sg-P _BAD Construction of pTargetF-P by R _BAD Plasmid, N20-P _BAD -F/N20-R verification plasmid. The knock-in upstream fragment is amplified by taking bamA-U-F/bamA-U-R as a primer pair and taking W3110 genome as a template; midstream segment is represented by P _BAD -M-F/P _BAD M-R is a primer pair, and plasmid pBAD33 is used as a template for amplification; the downstream fragment was amplified using yhbJ-D-F/yhbJ-D-R as a primer set and W3110 genome as a template. When the upper, middle and lower streams are overlapped, the bamA-U-F/skp-D-R is used as a primer pair, and the mixed fragments of the upper, middle and lower streams with equal molar number are used as templates to obtain a knock-out fragment P _BAD -UMD。

(2) Promoter P _BAD Obtaining knock-in strains

Removal of pTargetF-P by addition of kanamycin and IPTG _BAD Verification that the primer set is N20-P _BAD F/N20-R, and then transferring at 42 ℃ for two generations to remove pCas9 after obtaining a correct transformant, wherein a transformant without resistance is the pCas removal success. Finally, the successful knock-in W3110. Delta. Npr. Delta. YhbJ. Delta. FabF. Delta. P without other plasmids is obtained _{BAD(lpxD-fabZ-lpxA-lpxB)} . Using combined T-P _BAD -F

/T-P _BAD R carries out PCR verification of the corresponding gene knock-in. Finally obtaining the genetically engineered bacterium E.coliW3110 delta npr delta yhbJ delta fabF delta P _{BAD(lpxD-fabZ-lpxA-lpxB)} (named WOZF 01).

Example 2: mutant strain lipopolysaccharide semi-quantitative analysis

And comparing the size, depth and thickness of LPS bands of wild bacteria E.coli W3110, genetically engineered bacteria WOZF01 and WOZF by polyacrylamide gel electrophoresis and silver staining for color development, and analyzing the relative content. As shown in FIG. 1, SDS-PAGE silver staining results show that the LPS size of the mutant strain WOZF01 is consistent with that of W3110 and WOZF, the LPS band of WOZF is darker than that of W3110, and the LPS band of WOZF01 is darker than that of WOZF, indicating that the content is increased.

Example 3: LPS content analysis of each mutant Strain

The strain culture method comprises the following steps: activating Escherichia coli W3110 and its mutant strains WOZF and WOZF01 on plate, selecting single colony, inoculating into test tube, culturing overnight, and taking initial OD ₆₀₀ =0.02 transfer to 500mL volume flask with 200mL LB medium, and add arabinose inducer with final concentration 22.5mM to LB liquid medium inoculated with WOZF01, each cell was cultured at 37 ℃,200rpm for 16h, determine cell concentration, record, fermentation completion. Wherein the LB culture medium contains 50g/L yeast extract, 100g/L peptone and 100g/L NaCl.

LPS of the mutant strain was quantified, and as shown in FIG. 2, the LPS quantification results showed that the mutant strain WOZF01 was increased by 91.2% and 36.0% as compared with LPS of wild type E.coli W3110 and WOZF, respectively, and the yield was 13.0mg/g.

Example 4: comparison of growth states of strains

Activating E.coli W3110, WOZF and WOZF01 strains on LB solid plate, respectively picking five single colonies and inoculating to 5mL LB liquid culture medium. OD after 6h of tube culture ₆₀₀ About 2.5 switching, according to the original OD ₆₀₀ =0.02 transferring to 250mL triangular flask containing 50mL LB liquid culture medium, culturing at 37 ℃ for 24h, taking bacterial liquid at different time points, and measuring bacterial liquid OD. Repeat three times, take the average. As shown in FIG. 3, the results show that the mutant strain WOZF01 has no resistance marker, no pollution hazard and no much influence on the growth condition.

Comparative example 5

In the comparative example, on the basis of the genetic engineering bacteria WOZF, the plasmid pWSK29 is used for over-expressing the gene cluster lpxD-fabZ-lpxA-lpxB, which is different from the example 1 that an inducible promoter is added in front of the gene cluster lpxD-fabZ-lpxA-lpxB to directly express on the original chromosome.

The primer sequences used are all listed in table 1.

1. Construction of WOZF/pWSK29-lpxD-fabZ-lpxA-lpxB recombinant Strain (named WOZF/pWSK 29-DZAB)

Here, plasmid pWSK29-DZAB was constructed using a one-step cloning kit. Using a primer pair DZAB-F/DZAB-R and W3110 genome as a template, amplifying lpxD-fabZ-lpxA-lpxB gene cluster sequence, linearizing plasmid pWSK29 by using restriction enzyme corresponding to an enzyme cutting site, simultaneously carrying out PCR amplification, recovering and purifying gel to obtain a gene fragment needing to be inserted, and then connecting the two by using a one-step cloning kit. Correct transformants were obtained by transformation and PCR-verified on T-DZAB-F/DZAB-R colonies with the primer set.

Of these, 2. Mu.L of restriction enzyme, 10. Mu.L of 10 XQ. Cut Buffer, 2000ng of pWSK29 plasmid, sterilized ddH ₂ And (4) filling the system with O to 100 mu L to prepare an enzyme digestion reaction system, and carrying out constant-temperature water bath at 37 ℃ for 30min. After enzyme digestion, the fragment after enzyme digestion is recovered by using a PCR product SanPrep column type purification kit. The DNA fragments obtained by the linear plasmid after enzyme digestion, PCR amplification reaction and gel recovery are connected by using a Clonexpress one-step cloning kit.

The system for the ClonExpressTM II recombination reaction is as follows: 5 XCE II Buffer 4. Mu.L, exnaseTM II 2. Mu.L, optimum cloning vector usage, optimum insert usage, sterilized ddH ₂ The O content was adjusted to 100. Mu.L. Wherein the most suitable cloning vector is usedAmount = (0.02 × cloning vector base number) ng; the optimum amount of insert used = (0.04 × number of bases of insert) ng.

The correct pWSK29-lpxD-fabZ-lpxA-lpxB recombinant plasmid is transferred into a mutant strain WOZF strain to obtain a recombinant strain WOZF/pWSK29-lpxD-fabZ-lpxA-lpxB which is named as WOZF/pWSK29-DZAB.

2. Semi-quantitative and quantitative analysis of recombinant strain WOZF/pWSK29-DZAB lipopolysaccharide

Reference is made to example 2 and example 3.

The quantitative result of FIG. 4 shows that the LPS synthesized by the recombinant strain WOZF/pWSK29-DZAB constructed by the plasmid pWSK29 over-expressing gene cluster lpxD-fabZ-lpxA-lpxB is lower than that of WOZF. Therefore, the WOZF01 of the genetic engineering bacteria constructed by adopting the on-genome promoter insertion method of the embodiment 1 and adding and inducing arabinose to strengthen the expression of the gene cluster lpxD-fabZ-lpxA-lpxB is the key step of the invention.

TABLE 1 primer sequences used in the present invention

P _BAD The promoter sequence is as follows:

GATGCGTCCGGCGTAGAGGATCTGCTCATGTTTGACAGCTTATCATCGATGCATAATGTG

CCTGTCAAATGGACGAAGCAGGGATTCTGCAAACCCTATGCTACTCCGTCAAGCCGTCA

ATTGTCTGATTCGTTACCAATTATGACAACTTGACGGCTACATCATTCACTTTTTCTTCAC

AACCGGCACGGAACTCGCTCGGGCTGGCCCCGGTGCATTTTTTAAATACCCGCGAGAAA

TAGAGTTGATCGTCAAAACCAACATTGCGACCGACGGTGGCGATAGGCATCCGGGTGGT

GCTCAAAAGCAGCTTCGCCTGGCTGATACGTTGGTCCTCGCGCCAGCTTAAGACGCTAA

TCCCTAACTGCTGGCGGAAAAGATGTGACAGACGCGACGGCGACAAGCAAACATGCTG

TGCGACGCTGGCGATATCAAAATTGCTGTCTGCCAGGTGATCGCTGATGTACTGACAAG

CCTCGCGTACCCGATTATCCATCGGTGGATGGAGCGACTCGTTAATCGCTTCCATGCGCC

GCAGTAACAATTGCTCAAGCAGATTTATCGCCAGCAGCTCCGAATAGCGCCCTTCCCCTT

GCCCGGCGTTAATGATTTGCCCAAACAGGTCGCTGAAATGCGGCTGGTGCGCTTCATCC

GGGCGAAAGAACCCCGTATTGGCAAATATTGACGGCCAGTTAAGCCATTCATGCCAGTA

GGCGCGCGGACGAAAGTAAACCCACTGGTGATACCATTCGCGAGCCTCCGGATGACGA

CCGTAGTGATGAATCTCTCCTGGCGGGAACAGCAAAATATCACCCGGTCGGCAAACAAA

TTCTCGTCCCTGATTTTTCACCACCCCCTGACCGCGAATGGTGAGATTGAGAATATAACC

TTTCATTCCCAGCGGTCGGTCGATAAAAAAATCGAGATAACCGTTGGCCTCAATCGGCGT

TAAACCCGCCACCAGATGGGCATTAAACGAGTATCCCGGCAGCAGGGGATCATTTTGCG

CTTCAGCCATACTTTTCATACTCCCGCCATTCAGAGAAGAAACCAATTGTCCATATTGCAT

CAGACATTGCCGTCACTGCGTCTTTTACTGGCTCTTCTCGCTAACCAAACCGGTAACCCC

GCTTATTAAAAGCATTCTGTAACAAAGCGGGACCAAAGCCATGACAAAAACGCGTAACA

AAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTT

GCTATGCCATAGCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCA

ACTCTCTACTGTTTCTCCATACCCG

although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Claims (10)

1. A genetically engineered bacterium is characterized in that npr, yhbJ and fabF of the genetically engineered bacterium are subjected to deletion mutation inactivation, and a gene cluster lpxD-fabZThe promoter P is inserted in front of the lpxA-lpxB sequence _BAD 。

2. The genetically engineered bacterium of claim 1, wherein the genetically engineered bacterium is constructed on the basis of E.coli W3110, and is E.coli W3110. Delta. Npr. Delta. YhbJ. Delta. FabF. Delta. P _{BAD(lpxD-fabZ-lpxA-lpxB)} 。

3. The genetically engineered bacterium of claim 1, wherein the amino acid sequences of the npr, yhbJ and fabF gene deletion fragments are those shown in "BAE77250.1", "BAE77249.1" and "BAA35903.1" at NCBI, respectively.

4. The genetically engineered bacterium of claim 1, wherein the promoter P is a promoter _BAD The sequence of (A) is shown as SEQ ID NO. 37.

5. The genetically engineered bacterium of claim 1, wherein the genetically engineered bacterium is constructed by carrying out a promoter P in E.coli W3110 Δ npr Δ yhbJ Δ fabF with deletion mutation inactivation of npr, yhbJ and fabF through a CRISPR-Cas9 knockout system _BAD The promoter P whose transcription intensity increased with the increase of arabinose addition amount was inserted before the chromosomal gene cluster lpxD-fabZ-lpxA-lpxB of E.coli W3110. Delta. Npr. Delta. YhbJ. Delta. FabF _BAD 。

6. The genetically engineered bacterium of claim 1, wherein the knockout is a genetically engineered bacterium which uses Cas enzyme-mediated fragment recombination of a CRISPR-Cas9 knockout system, and finally cultures at 42 ℃ to remove pCas plasmid, so as to obtain the nonresistant and efficiently synthesized lipopolysaccharide.

7. A method for producing lipopolysaccharide by using the genetically engineered bacterium of any one of claims 1 to 6.

8. The method according to claim 7, wherein the fermentation process is induced by adding arabinose.

9. The method according to claim 7, wherein arabinose is added to the fermentation in LB liquid medium at a final concentration of 22.5 mM.

10. The use of the genetically engineered bacteria of any one of claims 1 to 6 to produce lipopolysaccharides and then to use the lipopolysaccharides for cellular immunity or to prepare vaccines comprising the lipopolysaccharides.

Images