CN115814089A

CN115814089A - Application of MT1G protein inhibitor as new target in preparation of medicine for treating renal cancer

Info

Publication number: CN115814089A
Application number: CN202211304971.6A
Authority: CN
Inventors: 王森; 王科鑫; 张斌
Original assignee: AFFILIATED HOSPITAL OF JINING MEDICAL UNIVERSITY
Current assignee: AFFILIATED HOSPITAL OF JINING MEDICAL UNIVERSITY
Priority date: 2022-10-24
Filing date: 2022-10-24
Publication date: 2023-03-21
Anticipated expiration: 2042-10-24
Also published as: CN115814089B

Abstract

The invention provides an application of an MT1G protein inhibitor in preparation of a medicine for treating kidney cancer, which belongs to the technical field of biological medicines, and results prove that after an MT1G lentivirus overexpresses a renal clear cell carcinoma 786-0 cell, proliferation and migration of the 786-0 cell are remarkably increased relative to a control group, and the sensitivity of sorafenib is remarkably inhibited; compared with cells in a control group, after 786-0 cells are knocked down by MT1G gene lentivirus, proliferation and migration of the 786-0 cells are obviously inhibited, and the sensitivity of the sorafenib drugs is obviously increased. The invention firstly provides and verifies that the MT1G protein is used as a new gene therapy target of the kidney cancer, has important significance for screening new anti-kidney cancer drugs, and provides a new idea for the treatment of the kidney cancer.

Description

Application of MT1G protein inhibitor as new target in preparation of medicine for treating kidney cancer

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of an MT1G protein inhibitor as a new target in preparation of a medicine for treating renal cancer.

Background

Renal cancer is one of the most common malignant tumors of the urinary system, and has a rising trend in recent years, nearly half of renal cancer patients are diagnosed at a late stage or have distant metastasis for the first time, and about 50% of patients relapse or metastasis after surgery. At present, the treatment of kidney cancer is mainly performed by surgery, but the pain of patients is increased by surgical treatment, the effects of radiotherapy and chemotherapy are poor, and the advantages of biological treatment are gradually revealed, wherein the gene treatment becomes a hot spot of kidney cancer research in recent years along with the discovery of new kidney cancer related genes.

Gene therapy is a therapeutic method for treating a disease by expressing a gene that is not originally expressed in a specific target cell or by shutting down or suppressing an abnormally expressed gene in a specific manner. Since kidney gene expression is limited to the kidney itself and its synthetic protein products are mainly localized to the kidney, the kidney is an ideal target organ for gene therapy.

Metallothioneins (MTs) are a low molecular weight family of 6-7 kDa, cysteine-rich cytoplasmic proteins that play an important role in metal ion homeostasis and detoxification. Recently, many studies have shown that there are differences in the expression of MT in different tumors, suggesting that MTs may play an important role in the oncogenic process. Abnormal cell proliferation and apoptosis have been considered as the major characteristics of cancer, however the function of MT1G in different cancer types is not consistent, for example, in a study conducted in thyroid cancer, it has been shown that MT1G inhibits proliferation, invasion or induces apoptosis, but promotes differentiation and chemosensitivity of colorectal cancer. To date, the biological function of MT1G in renal clear cell carcinoma (RCC) has never been studied.

Disclosure of Invention

In view of the above, the present invention aims to provide an application of an MT1G protein inhibitor as a new target in the preparation of a medicament for treating renal cancer.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides an application of an MT1G protein inhibitor in preparing a medicine for treating renal cancer.

Preferably, the MT1G protein inhibitor comprises one or more of a modulator that reduces MT1G expression, a protease that degrades the MT1G product, a nuclease, and a modulator that reduces the MT1G product.

Preferably, the modulator that reduces expression of MT1G comprises an agent that knocks out or silences MT1G.

Preferably, the modulator that reduces MT1G production comprises an MT1G antibody.

Preferably, the agent for knocking out or silencing MT1G comprises siRNA, shRNA or miRNA.

Preferably, the functional sequence for knocking down in the shRNA plasmid is shown as SEQ ID NO. 1.

Preferably, the medicament inhibits renal cancer cell migration and cell proliferation.

Preferably, the medicament comprises an effective component and a pharmaceutically acceptable carrier, wherein the effective component is an MT1G protein inhibitor.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides an application of an MT1G protein inhibitor in preparation of a medicine for treating renal cancer, and results prove that the proliferation and migration of a renal clear cell carcinoma 786-0 cell overexpressed by an MT1G lentivirus are remarkably increased relative to a control group, and the sensitivity of sorafenib is remarkably inhibited; compared with cells in a control group, the MT1G gene lentivirus knockdown 786-0 cell proliferation and migration are obviously inhibited, and the sorafenib drug sensitivity is obviously increased. The invention firstly provides and verifies that the MT1G protein is used as a new gene therapy target of the kidney cancer, has important significance for screening new anti-kidney cancer drugs, and provides a new idea for the treatment of the kidney cancer.

Drawings

FIG. 1 is a bright field image and a fluorescence image of the infection efficiency of MT1G gene RNA interference lentivirus particles on cells;

FIG. 2 shows the efficiency of MT1G gene lentivirus knockdown 786-0 cells and control lentivirus 786-0 cells interfering with MT1G expression;

FIG. 3 is an immunoblot electrophoretogram of MT1G expression in MT1G gene lentivirus-knocked-down 786-0 cell group and control lentivirus 786-0 cells;

FIG. 4 is a graph of the effect of MT1G on migration of renal clear cell carcinoma cells;

FIG. 5 is a graph showing the effect of infection of 786-0 cells with a lentivirus overexpressing MT1G and 786-0 cells in a control group on proliferation of renal clear cell carcinoma cells;

FIG. 6 shows the effect of MT1G gene lentivirus-knockdown 786-0 cells and control 786-0 cells on proliferation of renal clear cell carcinoma cells;

FIG. 7 is a graph showing the effect of infecting 786-0 cells with a lentivirus that overexpresses MT1G and a control group of 786-0 cells on sorafenib sensitivity;

FIG. 8 shows the effect of MT1G gene lentivirus-knockdown 786-0 cells on sorafenib sensitivity in the control 786-0 cells.

Detailed Description

The invention researches renal clear cell carcinoma and discovers a new target MT1G protein for treating renal cancer, so that the invention provides application of an MT1G protein inhibitor in preparation of a medicament for treating renal cancer.

The MT1G protein of the invention may be of human origin MT1G, more specifically, the nucleotide sequence of MT1G may be or include the NCBI reference sequence: NM-005950. The amino acid sequence of MT1G may be or include, but is not limited to, the amino acid sequence of the NCBI reference sequence: NM — 005950 sequence has an amino acid sequence that is at least 80%, 85%, 90% or 95% identical, and an amino acid sequence that has the properties or functions of MT1G.

In the present invention, the kidney cancer cell is preferably a renal clear cell carcinoma. In the present invention, the MT1G protein inhibitor preferably includes one or more of a modulator that reduces MT1G expression, a protease that degrades the MT1G product, a nuclease, and a modulator that reduces the MT1G product, i.e., is capable of inhibiting the activity or expression of MT1G.

In the present invention, the modulator that reduces expression of MT1G preferably comprises an agent that knockdown or silences MT1G. Further preferably, the agent for knocking out or silencing MT1G includes siRNA, shRNA or miRNA, in the present invention, the siRNA refers to short double-stranded RNA capable of inducing RNA interference by cleaving certain mRNA, the siRNA includes a sense RNA strand having a sequence homologous to mRNA of a target gene and an antisense RNA strand having a sequence complementary thereto, the siRNA can inhibit expression of the target gene, and can be used for gene knock-down, gene therapy. In the present invention, the shRNA (short hairpin RNA) is a single-stranded RNA including a stem portion and a loop portion forming a double-stranded portion by hydrogen bonding, which is processed by a protein such as Dicer to be converted into siRNA and performs the same function as siRNA. In the present invention, miRNA refers to 21 to 23 non-coding RNAs which regulate gene expression after transcription by promoting degradation of target RNA or by inhibiting translation thereof. In the present invention, the functional sequence for knockdown in shRNA is preferably GCTCCCAAGTACAAATAGAGT (SEQ ID NO: 1).

In the present invention, the modulator that reduces the production of MT1G preferably comprises an MT1G antibody.

In the present invention, the MT1G protein inhibitor is an inhibitor that reduces the expression of MT1G in cancer cells, as compared to cancer cells that are not treated with the MT1G protein inhibitor. Decreasing MT1G expression refers to decreasing MT1G gene expression or decreasing MT1G protein levels.

In the present invention, the drug inhibits migration and cell proliferation of renal cancer cells. The medicine preferably comprises an effective component and a pharmaceutically acceptable carrier, wherein the effective component is an MT1G protein inhibitor. The carrier may include one or more of lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, ethylene glycol, water, saline, and aqueous dextrose. The medicament may also include an antioxidant such as ascorbic acid, sodium sulfite or sodium bisulfate. The medicament also comprises excipient, such as corn starch, wheat starch, methyl cellulose, sodium carboxymethyl cellulose or gelatin. The routes of administration of the medicaments of the present invention include oral, intravenous, parenteral, intramuscular, subcutaneous, intraperitoneal, intranasal, rectal or topical administration. In the present invention, the dosage of the drug of the present invention can be determined by the type of the disease to be treated, the severity of the disease, the administration route, the age, sex, health condition of the patient, and the like, and for example, the dosage of the drug of the present invention can be 0.01. Mu.g to 1000mg per day per patient.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

1.1 Establishment of MT1G gene lentivirus knockdown 786-0 cell line:

the first day:

preparing cells: culturing the cells to a logarithmic growth phase, counting the cells of a control group and a target group after the cells are treated with pancreatin, and culturing the cells with the same number of cells in a 10cm cell culture dish by resuspension culture of a cell culture solution. This inoculum of 786-0 cells grew to 80% to 90% confluence on day 3 post infection.

The next day:

(1) Preparing lentivirus particles, namely constructed MT1G gene RNA interference lentivirus vector particles (LV-MT 1G-RNAi) and control group lentivirus vector particles, calculating the amount of the required lentivirus particles, taking out the lentivirus particles frozen at-80 ℃, thawing in ice bath, wherein the functional sequence MT1G-RNAi for knocking down MT1G is GCTCCCAAGTACAAATAGAGT (SEQ ID No. 1), and the control group insertion sequence is TTCTCCGAACGTGTCACGT (SEQ ID No. 2).

(2) Infecting the target cells: taking out the cells from the incubator, and observing the growth state and the cell fusion degree of the cells under a microscope; if the cell status is good, the experiment is started:

A. carefully sucking out the old culture solution of a 10cm cell culture dish by using a pipette gun, and adding a new complete culture solution;

B. respectively adding the calculated slow virus particle liquid into the cells, flatly placing the culture plate on a workbench, and gently and uniformly mixing in a 8-shaped manner;

C. after mixing, the cell culture plate was placed at 37 ℃ and 5% CO ₂ And (5) an incubator for overnight culture.

And on the third day:

replacing the culture solution: after 12 to 16 hours of infection, the culture medium containing the lentiviral particles was aspirated, and a complete culture medium containing 10% serum 1640 was added to the culture plate again to continue the culture.

The fourth day:

the cells were further cultured and the state of the cells was observed for abnormalities.

The fifth day:

observation (evaluation) of lentivirus particle infection efficiency: the 10cm cell culture dish was tightly covered, the outer wall of the culture plate was cleaned with 70% ethanol, fluorescence was observed in an inverted fluorescence microscope, and photographs were taken and the infection efficiency of lentiviral particles on the cells was estimated.

The sixth day: the number of fluorescent cells was found to be more than 50%, and positive cells were selected using puromycin (see the result in FIG. 1), to obtain MT1G gene lentivirus-knocked-down 786-0 cells, i.e., shMT1G.

The results in FIG. 1 show that the number of fluorescent cells is more than 50% by observing fluorescence through an inverted fluorescence microscope, namely, the MT1G gene lentivirus successfully infects 786-0 cells.

1.2 Determination of interference efficiency of MT1G gene lentivirus knockdown 786-0 cells

1) RNA extraction and cDNA preparation:

RNA was extracted using RNAfast200 total RNA rapid extraction kit, and RNA concentration was determined using nandorop 2000.

Preparation of cDNA:

a genome DNA removal reaction:

PCR reaction solution was prepared on ice according to Table 1, and the PCR apparatus was set to 42 ℃ for 2min.

TABLE 1 genomic DNA removal PCR reaction System

b, reverse transcription reaction:

after the first-step reaction is finished, sequentially adding the components in the table 2 into a PCR reaction tube, setting the program of a PCR instrument at 37 ℃ for 15min; 7s at 85 ℃; storing at 4 ℃. The reverse transcription reaction product was diluted 20 times and placed in a refrigerator at-20 ℃.

TABLE 2 reverse transcription PCR reaction System

2) RT-PCR assay

Through primer 3.0 online software, designThe primers were quantified and analyzed for primer specificity using primer blast from NCBI website, inc. synthesis (sequence information see Table 3). Extracted RNA was reverse transcribed into cDNA, the reverse transcribed cDNA was diluted 10-fold into template, and three replicates were set for each set of samples. Using SYBR PremixEx TaqTM kit, amplification program 95 ℃ pre deformation for 2min; denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 10s, and elongation at 72 ℃ for 10s for 40 cycles. By using

The method analyzes the result of the quantitative PCR.

TABLE 3 RT-PCR primer sequences

As can be seen from FIG. 2, compared with shNC, the expression level of MT1G gene of shMT1G is significantly reduced, and a MT1G gene lentivirus knockdown 786-0 cell line is successfully established.

1.3 immunoblot detection

The prepared protein sample is mixed with 5 × loading buffer according to a proportion by adopting 10% SDS-PAGE gel, and the mixture is bathed in water at 100 ℃ for 10min. Protein marker, 5. Mu.L/lane, appropriate volume protein sample was added to lane. Electrophoresis was terminated by applying a constant voltage of 80V for 30min and a constant voltage of 120V until bromophenol blue reached the bottom of the gel. Taking out the gel, marking and transferring the gel to a membrane, soaking the gel in a transfer buffer solution for balancing for 10min, cutting the PVDF membrane and the filter paper according to the size of the gel, placing the PVDF membrane and the filter paper in the transfer buffer solution for balancing for 10min, and soaking the PVDF membrane in methanol for 5 seconds before use. The gel was placed on the negative side and the transfer sandwich was assembled in order, one layer at a time, and the air bubbles were removed gently with a glass rod. The transfer tank is placed in ice, a sandwich is placed according to the electrodes, transfer buffer solution is added, constant current of 250V is carried out, and the membrane transfer time is set according to the molecular weight of the target protein. After the membrane transfer is finished, the transferred PVDF membrane is placed in TBST buffer solution for standby. The membrane was washed with TBST buffer for 5min and shaken slowly. The membranes were placed in TBST containing 5% skim milk and blocked overnight at 4 ℃. Washing the membrane with TBST 3 times for 5 min/time, placing the membrane in a hybridization bag, adding a proper amount of primary antibody diluted with TBST, and incubating for 2h at 37 ℃ with slow shaking or overnight at 4 ℃. The membrane is washed 3 times and 5 min/time by TBST. The membrane was placed in a hybridization bag, appropriate amount of TBST diluted secondary antibody was added, and incubation was performed at 37 ℃ for 1h. The membrane is washed 3 times and 15 min/time by TBST. Preparing developer according to the specification of the luminous kit, putting the developer into a darkroom, putting the film into a hybridization bag, uniformly coating a proper amount of developer, sealing the opening of the bag, removing air bubbles in the bag, fixing the hybridization bag in a cassette, tightly attaching the film to the hybridization bag, not leaving the air bubbles, closing the cassette, groping for proper exposure time, scanning the film and analyzing images. The antibody dilution ratios were all referred to the antibody specification.

TABLE 4 immunoblotting and IF antibodies

As can be seen from FIG. 3, compared with shNC, the expression level of MT1G protein of shMT1G is significantly reduced, and a MT1G gene lentivirus knockdown 786-0 cell line is successfully established.

1.4 Effect of MT1G on migration of renal clear cell carcinoma cells

Transwell migration experiment: MT1G gene lentivirus-knocked-down 786-0 cells (shMT 1G) and control group 786-0 cells (shNC), MT1G overexpression lentivirus-infected 786-0 cells (OE-MT 1G) and control group 786-0 cells (OE-NC), respectively screening stable cell strains, digesting and collecting cells, washing the cells three times with PBS, resuspending with serum-free culture medium, counting under a microscope to obtain the final concentration of 1 × 10 ⁵ Single cell suspension of cells per mL, 100. Mu.L of this single cell suspension was taken, and added to the upper chamber of the invader chamber, and 600. Mu.L of 10% FBS-containing PRMI-1640 medium was added to the lower chamber of the invader chamber. Each group was provided with 3 parallel cells. Cell culture: 37 deg.C, 5% CO ₂ The cells were cultured under conditions for 48h. Taking out the chamber, wiping off cells on the upper side of the chamber membrane by a cotton swab, fixing the cells by 4% paraformaldehyde for 30min, and then dyeing by 5% crystal violet solution. And (4) counting the number of the transmembrane cells under a 100-fold optical lens with more than 3 visual fields, and performing statistical analysis.

As can be seen from the results in fig. 4, overexpression of MT1G significantly promoted migration of renal clear cell carcinoma cells, and knock-down of MT1G expression significantly inhibited migration of renal clear cell carcinoma cells.

1.5 Effect of MT1G on proliferation of renal clear cell carcinoma cells

Respectively preparing single cell suspensions (MT 1G gene lentivirus-knocked-down 786-0 cells (shMT 1G) and control group 786-0 cells (shNC), MT1G overexpression lentivirus-infected 786-0 cells (OE-MT 1G) and control group 786-0 cells (OE-NC)), inoculating 5000 cells/hole in each group by using a 96-hole plate, setting three times for each detection value, adding 10 mu LCCK8 reagent into each hole at different time periods, incubating for 1h at 37 ℃ in a dark place, detecting absorbance values at 490nm by using a microplate reader, preparing a proliferation curve by using GraphPadPrism5, and respectively detecting the cell proliferation conditions of 0h, 24h, 48h, 72h, 96h and 110h in OE-NC and OE-MT1G groups (see figure 5). The shNC and shMT1G groups were tested for cell proliferation at 0h, 24h, 48h, 72h and 96h, respectively (see FIG. 6). 6 μ M sorafenib was added to the OE-NC and OE-MT1G groups, and cell proliferation was examined at 0h, 24h, and 48h in the OE-NC and OE-MT1G groups, respectively (see FIG. 7). 0 mu M, 6 mu M and 12 mu M sorafenib are added into each group of shNC and shMT1G respectively, and the cell proliferation of each group is detected after 24 hours of culture (see figure 8).

The results of fig. 5 and 6 show that the over-expression of MT1G promotes the proliferation of renal clear cell carcinoma cells, and the knock-down of MT1G expression significantly inhibits the proliferation of renal clear cell carcinoma cells.

As shown by the results of fig. 7 and 8, the sensitivity of sorafenib was significantly inhibited after overexpression of MT1G. And after the MT1G expression is knocked down, the sensitivity of the sorafenib drug is obviously increased.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.

Claims

Application of MT1G protein inhibitor in preparing medicine for treating renal cancer.
2. The use according to claim 1, wherein the inhibitor of the MT1G protein comprises one or more of a modulator of reduced MT1G expression, a protease, a nuclease, and a modulator of reduced MT1G product that degrades MT1G product.
3. The use according to claim 2, wherein the modulator of MT1G expression comprises an agent that knockdown or silences MT1G.
4. The use according to claim 2, wherein the modulator that reduces MT1G production comprises an MT1G antibody.
5. The use of claim 3, wherein the agent that knockdown or silences MT1G comprises siRNA, shRNA or miRNA.
6. The use according to claim 5, wherein the functional sequence for knockdown in the shRNA plasmid is shown in SEQ ID NO. 1.
7. The use according to any one of claims 1 to 6, wherein the medicament inhibits renal cancer cell migration and cell proliferation.
8. The use according to any one of claims 1 to 6, wherein the medicament comprises an active ingredient which is an MT1G protein inhibitor and a pharmaceutically acceptable carrier.