CN115807091B - Septin9 gene methylation detection kit based on microfluidic chip type digital PCR - Google Patents
Septin9 gene methylation detection kit based on microfluidic chip type digital PCR Download PDFInfo
- Publication number
- CN115807091B CN115807091B CN202211451405.8A CN202211451405A CN115807091B CN 115807091 B CN115807091 B CN 115807091B CN 202211451405 A CN202211451405 A CN 202211451405A CN 115807091 B CN115807091 B CN 115807091B
- Authority
- CN
- China
- Prior art keywords
- septin9
- methylation
- septin9 gene
- digital pcr
- detection kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 68
- 101150042012 SEPTIN9 gene Proteins 0.000 title claims abstract description 58
- 230000011987 methylation Effects 0.000 title claims abstract description 53
- 238000007069 methylation reaction Methods 0.000 title claims abstract description 53
- 238000007847 digital PCR Methods 0.000 title claims abstract description 49
- 238000006243 chemical reaction Methods 0.000 claims abstract description 45
- 239000000523 sample Substances 0.000 claims abstract description 45
- 239000013612 plasmid Substances 0.000 claims abstract description 41
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 17
- LSNNMFCWUKXFEE-UHFFFAOYSA-N Sulfurous acid Chemical compound OS(O)=O LSNNMFCWUKXFEE-UHFFFAOYSA-N 0.000 claims abstract description 13
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 10
- 108091029523 CpG island Proteins 0.000 claims abstract description 7
- 108020004707 nucleic acids Proteins 0.000 claims abstract description 6
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 6
- 102000039446 nucleic acids Human genes 0.000 claims abstract description 6
- 108700039691 Genetic Promoter Regions Proteins 0.000 claims abstract description 4
- 238000000605 extraction Methods 0.000 claims abstract description 3
- 102000012060 Septin 9 Human genes 0.000 claims description 21
- 230000003321 amplification Effects 0.000 claims description 17
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 17
- 108020004414 DNA Proteins 0.000 claims description 15
- 238000000034 method Methods 0.000 claims description 14
- 108050002584 Septin 9 Proteins 0.000 claims description 10
- 238000012408 PCR amplification Methods 0.000 claims description 7
- 101000632056 Homo sapiens Septin-9 Proteins 0.000 claims description 5
- 239000012295 chemical reaction liquid Substances 0.000 claims description 5
- 238000002360 preparation method Methods 0.000 claims description 4
- 239000012530 fluid Substances 0.000 claims description 3
- 238000010791 quenching Methods 0.000 claims description 3
- 230000000171 quenching effect Effects 0.000 claims description 3
- 239000000126 substance Substances 0.000 claims description 3
- 238000012360 testing method Methods 0.000 claims description 3
- 201000010099 disease Diseases 0.000 claims description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims description 2
- 230000001225 therapeutic effect Effects 0.000 claims 1
- 230000035945 sensitivity Effects 0.000 abstract description 8
- 108091028043 Nucleic acid sequence Proteins 0.000 abstract 1
- 239000002773 nucleotide Substances 0.000 abstract 1
- 125000003729 nucleotide group Chemical group 0.000 abstract 1
- 206010009944 Colon cancer Diseases 0.000 description 13
- 238000011529 RT qPCR Methods 0.000 description 9
- 238000004925 denaturation Methods 0.000 description 9
- 230000036425 denaturation Effects 0.000 description 9
- 239000000203 mixture Substances 0.000 description 9
- 238000000137 annealing Methods 0.000 description 8
- 206010028980 Neoplasm Diseases 0.000 description 6
- 238000005516 engineering process Methods 0.000 description 6
- 108090000623 proteins and genes Proteins 0.000 description 5
- 208000001333 Colorectal Neoplasms Diseases 0.000 description 4
- 201000011510 cancer Diseases 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- LSNNMFCWUKXFEE-UHFFFAOYSA-M Bisulfite Chemical compound OS([O-])=O LSNNMFCWUKXFEE-UHFFFAOYSA-M 0.000 description 3
- 238000003556 assay Methods 0.000 description 3
- 210000004369 blood Anatomy 0.000 description 3
- 239000008280 blood Substances 0.000 description 3
- 238000010367 cloning Methods 0.000 description 3
- 238000011156 evaluation Methods 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 108091029430 CpG site Proteins 0.000 description 2
- 238000007400 DNA extraction Methods 0.000 description 2
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 238000009534 blood test Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 238000003745 diagnosis Methods 0.000 description 2
- 238000010790 dilution Methods 0.000 description 2
- 239000012895 dilution Substances 0.000 description 2
- 238000011304 droplet digital PCR Methods 0.000 description 2
- 230000002550 fecal effect Effects 0.000 description 2
- 238000011534 incubation Methods 0.000 description 2
- 230000002401 inhibitory effect Effects 0.000 description 2
- 210000005259 peripheral blood Anatomy 0.000 description 2
- 239000011886 peripheral blood Substances 0.000 description 2
- 238000003752 polymerase chain reaction Methods 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 238000011002 quantification Methods 0.000 description 2
- 230000003252 repetitive effect Effects 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 241000270617 Cheloniidae Species 0.000 description 1
- 230000007067 DNA methylation Effects 0.000 description 1
- 102000015602 Septin Human genes 0.000 description 1
- 108050004875 Septin Proteins 0.000 description 1
- 230000001640 apoptogenic effect Effects 0.000 description 1
- 210000001124 body fluid Anatomy 0.000 description 1
- 239000010839 body fluid Substances 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 238000001839 endoscopy Methods 0.000 description 1
- 230000002708 enhancing effect Effects 0.000 description 1
- 230000004049 epigenetic modification Effects 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 208000024200 hematopoietic and lymphoid system neoplasm Diseases 0.000 description 1
- 230000006607 hypermethylation Effects 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 239000003112 inhibitor Substances 0.000 description 1
- 230000003902 lesion Effects 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000000386 microscopy Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 230000001338 necrotic effect Effects 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 1
- 238000005987 sulfurization reaction Methods 0.000 description 1
- 239000000439 tumor marker Substances 0.000 description 1
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a Septin9 gene methylation detection kit based on microfluidic chip type digital PCR. The Septin9 gene methylation detection kit comprises an upstream primer, a downstream primer and a detection probe for methylation of CpG islands of a promoter region of a Septin9 gene V2 transcript, wherein the nucleotide sequences of the upstream primer and the downstream primer are respectively shown as SEQ ID NO. 1-2, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 3. The Septin9 gene methylation detection kit also comprises 2 XProbe Master Mix and ddH 2 O, nucleic acid extraction reagent, sulfite conversion reagent, methylated plasmid standard and unmethylated plasmid standard. The Septin9 gene methylation detection kit has the advantages of high sensitivity, strong specificity, good repeatability, wide linear range and strong mixed sample detection capability.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a Septin9 gene methylation detection kit based on microfluidic chip type digital PCR.
Background
The latest data of the national cancer center show that 40.8 ten thousand new cases of colorectal cancer (colorectal cancer, CRC) occur in 2016 China, 19.6 ten thousand death cases occur, and in addition, CRC also has third incidence rate of malignant tumors in Fujian province and fourth death rate. Colorectal cancer is therefore one of the great burdens in the economic and social development of our country, i am province. Currently common methods for CRC detection are mainly endoscopy, imaging, blood tumor marker detection and fecal occult blood test (fecal occult blood test, FOBT). Colorectal microscopy in combination with pathological examination is the gold standard for diagnosing CRC, however limited by invasive examination and complications, with low compliance. FOBT and tumor markers are not suitable for early diagnosis of CRC due to inefficiency, hyposensitization and non-specificity. It is therefore necessary to develop a simple, sensitive, specific means of diagnosing CRC.
Methylation of the gene promoter is the most studied epigenetic modification, with Septin9 gene promoter methylation being the most widely used CRC diagnostic marker in clinical use today. The research shows that Septin9 gene as tumor inhibiting gene has its promoter region methylated to inhibit the normal expression of the gene, so as to lose cancer inhibiting function and promote CRC development. During colorectal cancer occurrence, septin9 DNA is released from necrotic and apoptotic cancer cells into peripheral blood, so CRC can be diagnosed by detecting the extent of peripheral blood Septin9 gene methylation (methylated Septin, msepat 9). However, the concentration of target molecules in body fluids is extremely low, whereas the sensitivity of free DNA methylation detection depends on the methylation level of individual CpG sites, which has been a major obstacle for cancer diagnosis based on methylated DNA fragments.
Effective methylation gene detection means are key to clinical application. Methyllight is a fluorescence-based real-time quantitative PCR method (quantitative real-time PCR, qPCR), and is widely used for methylation detection of tumor genes due to its simple operation and relative quantification. In recent years, kits for detecting mSEPT9 based on qPCR have been developed abroad, and the technology not only has higher sensitivity and specificity, but also overcomes the sensitivity difference caused by lesion positions. However, qPCR techniques have limitations such as low sensitivity, poor precision and reproducibility when detecting low concentration samples. Compared with qPCR technology, the methylation detection method based on digital PCR (digital PCR) technology can reduce background interference and pollution, can reduce the influence of PCR inhibitor, has higher sensitivity and better accuracy and repeatability, and can realize absolute quantification. However, the common droplet dPCR technique has the key difficulties of complicated operation, easy pollution generation and the like.
Disclosure of Invention
The invention aims to overcome the defects of low methylation sensitivity, complex operation, easy pollution and the like of a Septin9 gene detection in the prior art, and provides a Septin9 gene methylation detection kit based on microfluidic chip type digital PCR, which enhances the specificity of a reaction system by introducing a primer and a probe modified by locked nucleic acid, optimizes the concentration of the primer and the probe, and optimizes the denaturation time and annealing/extension temperature of the microfluidic chip type digital PCR, thereby further improving the amplification efficiency of the system and enhancing fluorescent signals.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
a Septin9 gene methylation detection kit based on microfluidic chip type digital PCR comprises an upstream primer and a downstream primer and a detection probe for CpG island methylation of a promoter region of a Septin9 gene V2 transcript, wherein the sequences of the upstream primer and the downstream primer and the detection probe are as follows:
septin9 upstream primer: 5 '-GTAGTTAGTTTAGTATTTATTTTC/iXNA-G/-3',
septin9 downstream primer: 5 '-CCCACCAACCATCATAT/iXNA-C/-3',
septin9 detection probe: 5'-TTAGTTG/iXNA_C/G/iXNA_C/GTTGAT/iXNA_C/G-3'.
Further, the 5 '-end of the septin9 detection probe is marked with a fluorescence report group FAM, and the 3' -end is marked with a quenching group MGB.
Furthermore, the Septin9 gene methylation detection kit also comprises 2 XProbe Master Mix and ddH 2 O, nucleic acid extraction reagent, sulfite conversion reagent, methylated plasmid standard and unmethylated plasmid standard.
Furthermore, the methylated plasmid standard is a plasmid containing a sequence specific for the methylation of the Septin9 gene, and the unmethylated plasmid standard is a plasmid containing a sequence specific for the unmethylation of the Septin9 gene.
Further, the methylation specific sequence of the Septin9 gene was GTAGTTAGTTTAGTAT TTATTTTCGAAGTTCGAAATGATTTTATTTAGTTGCGCGTTGATCGCGGGGTTCGATATGATGGTTGGTGGG, and the unmethylation specific sequence of the Septin9 gene was GTAGTTAGTTTAGTATTTATTTTTGAAGTTTGAAATGATTTTATTTAGTTGTGTGTTGATTGTGGGGTTTGATATGATGGTTGGTGGG.
Furthermore, the Septin9 gene methylation specific sequence was cloned from HeLa cell ATCC CCL-2 (the Septin9 gene region was methylated), and the Septin9 gene unmethylation specific sequence was cloned from Jurkat cell SCSP-513 (the Septin9 gene region was not methylated).
The application of the Septin9 gene methylation detection kit in preparing products for detecting Septin9 gene methylation.
A method for detecting the methylation of a Septin9 gene by using the Septin9 gene methylation detection kit based on microfluidic chip digital PCR, wherein the method is used for the purpose of non-disease diagnosis and treatment, and comprises the following steps of:
1) Treatment of the sample under test: extracting genome DNA of an object to be detected, and performing sulfite treatment to obtain a DNA template converted from sulfite of a detected sample;
2) Preparing a digital PCR reaction system: the formula of the digital PCR reaction system is as follows: 2 XProbe Master Mix 20. Mu.L, 10. Mu.M upstream and downstream primers each 0.8. Mu.L, 10. Mu.M detection Probe 0.4. Mu.L, PCR promoter 1. Mu.L, sulfite-converted template DNA 5. Mu.L, ddH 2 O 12 μL；
3) Preparing PCR micro-reaction liquid drops capable of independently performing PCR amplification reaction by using the digital PCR reaction system prepared in the step 2) through a micro-fluid preparation system;
4) Carrying out digital PCR amplification reaction on the PCR micro-reaction liquid drops prepared in the step 3);
5) And 4) collecting signals of the products obtained after the digital PCR amplification reaction in the step 4), and judging whether the sample to be detected contains the methylated human Septin9 gene according to the existence of fluorescent signals.
The invention has the remarkable advantages that:
the specificity of the reaction system is enhanced by introducing the primer and the probe modified by the locked nucleic acid, and simultaneously, the concentration of the primer and the probe, the denaturation time and the annealing/extension temperature of the microfluidic chip type digital PCR are optimized, so that the amplification efficiency of the system is further improved, and the fluorescent signal is enhanced. The invention can eliminate non-specific products generated by non-methylated alleles, and the improved novel technology has higher sensitivity and specificity, and can distinguish methylated and non-methylated Septin9 gene sequences from free DNA with low concentration.
Drawings
FIG. 1 is a sequence diagram of sequencing of methylated plasmid standards and unmethylated plasmid standards. A. B, unmethylated plasmid standard; C. d, methylated plasmid standard.
FIG. 2 shows qPCR amplification patterns of primer and probe specificity verification.
FIG. 3 is a digital PCR amplification plot of microfluidic chips with different denaturation times and different annealing/extension temperatures. A, different denaturation times; b, different annealing/extension temperatures.
FIG. 4 is a microfluidic chip-type digital PCR amplification plot of different primer concentrations and different probe concentrations. A, different primer concentrations; b, different probe concentrations.
FIG. 5 is a linear range of Septin9 methylation detection kit for microfluidic chip digital PCR.
FIG. 6 is the specificity of Septin9 methylation detection kit for microfluidic chip digital PCR.
FIG. 7 shows the minimum detection limit of Septin9 methylation detection kit for microfluidic chip-based digital PCR.
FIG. 8A shows the results of repeated day 1 detection of Septin9 methylation detection kit for microfluidic chip-based digital PCR; FIG. 8B is a repetitive day 2 assay result of the Septin9 methylation detection kit of microfluidic chip-based digital PCR; FIG. 8C shows the results of repeated day 3 detection of Septin9 methylation detection kit for microfluidic chip-based digital PCR; FIG. 8D shows the results of repeated day 4 detection of Septin9 methylation detection kit for microfluidic chip-based digital PCR; FIG. 8E shows the results of a repetitive day 5 assay of the Septin9 methylation detection kit of microfluidic chip-based digital PCR; 1:10 7 copies/mL；2：10 4 copies/mL。
FIG. 9 shows the detection capability of the Septin9 methylation detection kit of microfluidic chip digital PCR on mixed samples.
Detailed Description
The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.
The experimental materials related to the invention are as follows:
blood/cell/tissue genomic DNA extraction kit, available from TIANGEN company under the designation DP304.HeLa cells, purchased from ATCC cell bank, accession ATCC CCL-2, whose Septin9 gene region has been methylated. Jurkat cells, available from the China academy of sciences typical culture Collection, accession number SCSP-513, have the Septin9 gene region unmethylated. Bisulphite conversion reagent set, available from Zymo Research company under the designation D5003.Taq PCR Master Mix from Sangon Biotech, cat# B639295. pMD ™ -T Vector Cloning Kit, available from TaKaRa company under the designation 6011.Trans1-T1 phase response chemocompetent cells, available from TransGen Biotech company under the designation D501. Plasmid miniprep kit, available from TIANGEN company under the designation DP103.2 XProbe Master Mix, available from Vazyme under the designation Q112-02.PCR promoter, available from the technology of small sea turtle under the product number E014-01.
Example 1
1. Design of primers and probes
Searching a CpG island sequence (NM_ 001113493) on a promoter of a v2 transcript of the human Septin9 gene on an NCBI database, and obtaining a CpG island sequence after sulfite treatment through MethPrimer conversion; and then predicting the CpG island hypermethylation site through the combination of the MethPrimer and the Methbank. Primers and probes were designed using oligo7 with the DNA after sulfuration (CpG island sequence after sulfite treatment) as template strand. The design principle is as follows: the methylation sequence is amplified by the primer, and then the detection probe is combined with the CG site on the methylation sequence to specifically identify the methylation sequence. In order to improve the recognition capability and the discrimination capability of mismatched bases of the primers, the invention carries out nucleic acid locking modification on the primers and the probes, and the sequences of the primers and the probes are shown in Table 1.
TABLE 1 Septin9 Gene detection primers and probes
Wherein, the 5 'end of the detection probe is marked with a fluorescence report group FAM, and the 3' end is marked with a quenching group MGB.
2. Construction of plasmid Standard
Extracting HeLa cell ATCC CCL-2 genome DNA by using a blood/cell/tissue genome DNA extraction kit, performing sulfite conversion and purification by using a bisulfite conversion method kit, and performing PCR amplification by using the sulfite conversion method kit as a template. The PCR amplification system is as follows: taq PCR Master Mix 10. Mu.L, 0.4. Mu.L each of the upstream and downstream primers, 5. Mu.L of template DNA, and 20. Mu.L of water were made up; wherein, the upstream primer is 5'-GTAGTTAGTTTAGTATTTATTTTC-3' and the downstream primer is 5'-CCCACCAACCATCATAT-3'. The PCR amplification procedure was: 94. 3 min at the temperature; 94. 10s at the temperature, 20 s at 60 ℃ and 15 s at 72 ℃ for 35 cycles; 72. the temperature is 5 min. The product was recovered and ligated to T vector using pMD ™ 18-T Vector Cloning Kit and transformed into Trans1-T1 phase resistance chemocompetent cells. After overnight incubation at 37℃single colonies were picked for PCR and agarose gel electrophoresis identification. The sequence of the product was verified by colony sequencing to obtain the sequence GTAGTTAGTTTAGTATTTATTTTCGAAGTTCGAAATGATTTTATTTAGTTGCGCGTTGATCGCGGGGTTCGATATGATGGTTGGTGGG specific for methylation of the Septin9 gene cloned from HeLa cells, and the plasmid was extracted to obtain a methylated plasmid standard (FIG. 1). The concentration of the methylated plasmid standard was quantified using a Nanodrop2000 micro-spectrophotometer and the plasmid concentration was converted to copies/mL. The plasmids were subjected to gradient dilution to establish methylated plasmid standards of different concentrations.
Extracting the genome DNA of Jurkat cell SCSP-513 by blood/cell/tissue genome DNA extracting reagent, performing sulfite conversion and purification by using a bisulfite conversion method reagent kit, and performing PCR amplification by using the sulfite conversion method reagent kit as a template. The PCR amplification system is as follows: taq PCR Master Mix 10. Mu.L, 0.4. Mu.L each of the upstream and downstream primers, 5. Mu.L of template DNA, and 20. Mu.L of water were made up; wherein, the upstream primer is 5'-GTAGTTAGTTTAGTATTTATTTTC-3' and the downstream primer is 5'-CCCACCAACCATCATAT-3'. The PCR amplification procedure was: 94. 3 min at the temperature; 94. 10s at the temperature, 20 s at 60 ℃ and 15 s at 72 ℃ for 35 cycles; 72. the temperature is 5 min. The product was recovered and ligated to T vector using pMD ™ 18-T Vector Cloning Kit and transformed into Trans1-T1 phase resistance chemocompetent cells. After overnight incubation at 37℃single colonies were picked for PCR and agarose gel electrophoresis identification. The sequence of the product was verified by colony sequencing to obtain a sequence GTAGTTAGTTTAGTATTTATTTTTGAAGTTTGAAATGATTTTATTTAGTTGTGTGTTGATTGTGGGGTTTGATATGATGGTTGGTGGG specific for unmethylation of the Septin9 gene cloned from Jurkat cells, and the plasmid was extracted to obtain a methylated plasmid standard (FIG. 1). The concentration of the methylated plasmid standard was quantified using a Nanodrop2000 micro-spectrophotometer and the plasmid concentration was converted to copies/mL. The plasmids were subjected to gradient dilution to establish unmethylated plasmid standards at different concentrations.
3. Verification of primer and Probe specificity
The specificity of the primers and probes in Table 1 was verified using RT-qPCR technology detection. 40. Mu.L of the reaction system was used: 2 XProbe Master Mix 20. Mu.L, 1.2. Mu.L each of the upstream and downstream primers (10. Mu.M), 0.4. Mu.L of the detection Probe (10. Mu.M), 0.01 ng/. Mu.L to 10 ng/. Mu.L of the template (methylated plasmid standard or unmethylated plasmid standard) 5. Mu.L, ddH 2 O12.2. Mu.L. The test was performed on a qPCR instrument. The reaction conditions are as follows: 95℃for 30s, 60℃for 30s,45 cycles. The results indicate that the specificity of the detection method is better, and primers and probes are viable (FIG. 2).
4. Optimizing micro-fluidic chip type digital PCR detection reaction condition and reaction system
Preparing a digital PCR reaction system: the initial formula of the digital PCR reaction system is as follows: 2 XProbe Master Mix 20. Mu.L, each of the upstream and downstream primers (10. Mu.M) 0.8. Mu.L, the detection Probe (10. Mu.M) 0.8. Mu.L, the PCR promoter 1. Mu.L, 10 7 Template (methylated plasmid standard) 5. Mu.L of copies/mL,ddH 2 o12. Mu.L. The prepared digital PCR reaction system is used for preparing PCR micro-reaction liquid drops capable of independently carrying out PCR amplification reaction by a micro-fluid preparation system, and carrying out one-step digital PCR amplification reaction, wherein the initial reaction conditions are as follows: preheating at 50deg.C for 10 min, and pre-denaturing at 95deg.C for 5 min; denaturation at 95℃for 30s, annealing/extension at 60℃for 30s,45 cycles. And (3) collecting signals of products obtained after the one-step digital PCR amplification reaction, and judging whether the sample to be detected contains methylated human Septin9 genes, and the quantity and content of the methylated human Septin9 genes according to the existence of fluorescent signals.
Based on initial conditions, changing the annealing/extension temperature to 52-62 ℃ for digital PCR amplification of the microfluidic chip, and selecting the optimal temperature according to the positive micro-droplet clustering effect; and changing the denaturation time to 5-30 s for digital PCR amplification of the microfluidic chip, and selecting the optimal denaturation time according to the total digital PCR amplification time and the positive micro-droplet clustering effect. On the basis of an initial system, the final concentration of the diluted primer in a reaction system is 0.1 mu M-0.5 mu M, amplification is carried out, and the concentration of the optimal primer is judged according to the positive micro-droplet clustering effect; the final concentration of the diluted probe in the reaction system is 0.1 mu M-0.5 mu M, amplification is carried out, and the optimal probe concentration is judged according to the positive micro-droplet clustering effect. The results indicated an optimum annealing/extension temperature of 60 ℃ and an optimum denaturation time of 5 s (fig. 3); the optimal final concentration of the primer in the reaction system was 0.2. Mu.M, and the optimal final concentration of the probe in the reaction system was 0.1. Mu.M (FIG. 4).
The finally obtained optimized microfluidic chip type digital PCR detection system and reaction conditions are as follows:
the reaction system: 2 XProbe Master Mix 20. Mu.L, each of the upstream and downstream primers (10. Mu.M) 0.8. Mu.L, the detection Probe (10. Mu.M) 0.4. Mu.L, the PCR promoter 1. Mu.L, the template 5. Mu.L, ddH 2 O 12 μL；
Reaction conditions: preheating at 50deg.C for 10 min, and pre-denaturing at 95deg.C for 5 min; denaturation at 95℃5 s, annealing/extension at 60℃30s,45 cycles.
5. Evaluation of Septin9 methylation detection method of microfluidic chip type digital PCR
System for performing optimized microfluidic chip type digital PCR detection system by using self-built plasmid standard substanceThe method performance evaluation of (2) comprises the index evaluation of precision, minimum detection limit, specificity, linear range and the like. Diluting the constructed standard sample by a multiple ratio of 10 7 copies/mL-10 1 The copies/mL was tested for methylated plasmid standards at different concentrations, and the standard curve showed a linear range of 10 7 -10 2 copies/mL，R 2 0.9992 (fig. 5) can be reached; methylated and unmethylated plasmid Standard and blank (ddH) 2 O), simultaneous amplification in the same dPCR reaction, the results indicate better specificity of the detection method (fig. 6); the optimized microfluidic chip type digital PCR reaction system is used for detecting methylated plasmid standard substances with different low concentrations, and the result shows that the minimum detection limit is 10 3 cobies/mL (FIG. 7); within the detection range, take the height (10 7 copies/mL, low (10) 4 cobies/mL) 2 concentrations of plasmid standard, 5 times per day, 5 days in succession, the results indicated 10 7 The coefficients of intra-and inter-batch variation of copies/mL were 6.35% and 10.70%,10 4 The coefficients of intra-and inter-batch variation of copies/mL were 3.50% and 3.57% (FIG. 8A-FIG. 8E); the methylated and unmethylated plasmid standards were mixed at different concentrations, and the results indicated that the actual mutation ratios were consistent with the calculated ratios of the microfluidic chip-type digital PCR assays (R 2 =0.9939，P<0.0001 Preferably (fig. 9).
Claims (4)
1. A Septin9 gene methylation detection kit based on microfluidic chip type digital PCR is characterized in that: comprising an upstream primer and a downstream primer for methylation of CpG islands of a promoter region of a Septin9 gene V2 transcript and a detection probe, wherein the sequences of the upstream primer and the downstream primer and the detection probe are as follows:
septin9 upstream primer: 5 '-GTAGTTAGTTTAGTATTTATTTTC/iXNA-G/-3',
septin9 downstream primer: 5 '-CCCACCAACCATCATAT/iXNA-C/-3',
septin9 detection probe: 5'-TTAGTTG/iXNA_C/G/iXNA_C/GTTGAT/iXNA_C/G-3'; the 5 '-end of the septin9 detection probe is marked with a fluorescence reporting group FAM, and the 3' -end of the septin9 detection probe is marked with a quenching group MGB;
the Septin9 geneThe methylation detection kit also comprises 2 XProbe Master Mix and ddH 2 O, nucleic acid extraction reagent, sulfite conversion reagent, methylated plasmid standard and unmethylated plasmid standard;
the methylation plasmid standard substance is a plasmid containing a Septin9 gene methylation specific sequence, and the unmethylation plasmid standard substance is a plasmid containing a Septin9 gene unmethylation specific sequence;
the methylation specific sequence of the Septin9 gene is GTAGTTAGTTTAGTATTTATTTTCGAAGTTCGAAATGATTTTATTTAGTTGCGCGTTGATCGCGGGGTTCGATATGATGGTTGGTGGG, and the unmethylation specific sequence of the Septin9 gene is GTAGTTAGTTTAGTATTTATTTTTGAAGTTTGAAATGATTTTATTTAGTTGTGTGTTGATTGTGGGGTTTGATATGATGGTTGGTGGG.
2. The microfluidic chip digital PCR based Septin9 gene methylation detection kit of claim 1, wherein: the Septin9 gene methylation specific sequence is cloned from HeLa cells ATCC CCL-2, and the Septin9 gene unmethylation specific sequence is cloned from Jurkat cells SCSP-513.
3. Use of a Septin9 gene methylation detection kit of claim 1 in the preparation of a product for detecting Septin9 gene methylation.
4. A method for detecting the methylation of a Septin9 gene by using the Septin9 gene methylation detection kit based on microfluidic chip digital PCR as claimed in claim 1, which is characterized in that: the method is for non-disease diagnostic therapeutic purposes; the method comprises the following steps:
1) Treatment of the sample under test: extracting genome DNA of an object to be detected, and performing sulfite treatment to obtain a DNA template converted from sulfite of a detected sample;
2) Preparing a digital PCR reaction system: the formula of the digital PCR reaction system is as follows: 2 XProbe Master Mix 20. Mu.L, 10. Mu.M upstream and downstream primers each 0.8. Mu.L, 10. Mu.M detection Probe 0.4. Mu.L, PCR promoter 1. Mu.L, sulfurous acidSalt-transformed template DNA 5. Mu.L, ddH 2 O 12 μL；
3) Preparing PCR micro-reaction liquid drops capable of independently performing PCR amplification reaction by using the digital PCR reaction system prepared in the step 2) through a micro-fluid preparation system;
4) Carrying out one-step digital PCR amplification reaction on the PCR micro-reaction liquid drops prepared in the step 3);
5) And 4) collecting signals of the products obtained after the digital PCR amplification reaction in the step 4), and judging whether the sample to be detected contains the methylated human Septin9 gene according to the existence of fluorescent signals.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211451405.8A CN115807091B (en) | 2022-11-20 | 2022-11-20 | Septin9 gene methylation detection kit based on microfluidic chip type digital PCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211451405.8A CN115807091B (en) | 2022-11-20 | 2022-11-20 | Septin9 gene methylation detection kit based on microfluidic chip type digital PCR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115807091A CN115807091A (en) | 2023-03-17 |
| CN115807091B true CN115807091B (en) | 2024-03-08 |
Family
ID=85483572
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211451405.8A Active CN115807091B (en) | 2022-11-20 | 2022-11-20 | Septin9 gene methylation detection kit based on microfluidic chip type digital PCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115807091B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105603061A (en) * | 2015-12-11 | 2016-05-25 | 宁云山 | Method, probe, primer and kit for detecting methylation of human Septin 9 gene based on digital PCR technology |
| CN106834426A (en) * | 2015-12-04 | 2017-06-13 | 博尔诚（北京）科技有限公司 | Composition and application thereof for detecting cancer of pancreas |
| CN113981083A (en) * | 2021-10-29 | 2022-01-28 | 江苏康为世纪生物科技股份有限公司 | Nucleic acid combination and kit for colorectal cancer gene methylation detection |
| CN115449550A (en) * | 2022-07-26 | 2022-12-09 | 福建医科大学附属第一医院 | Locked nucleic acid modified septin9 gene methylation detection method |
-
2022
- 2022-11-20 CN CN202211451405.8A patent/CN115807091B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834426A (en) * | 2015-12-04 | 2017-06-13 | 博尔诚（北京）科技有限公司 | Composition and application thereof for detecting cancer of pancreas |
| CN105603061A (en) * | 2015-12-11 | 2016-05-25 | 宁云山 | Method, probe, primer and kit for detecting methylation of human Septin 9 gene based on digital PCR technology |
| CN113981083A (en) * | 2021-10-29 | 2022-01-28 | 江苏康为世纪生物科技股份有限公司 | Nucleic acid combination and kit for colorectal cancer gene methylation detection |
| CN115449550A (en) * | 2022-07-26 | 2022-12-09 | 福建医科大学附属第一医院 | Locked nucleic acid modified septin9 gene methylation detection method |
Non-Patent Citations (3)
| Title |
|---|
| A novel microfluidic chip-based digital PCR method for enhanced sensitivity in the early diagnosis of colorectal cancer via mSEPT9;Qunfang Huang等;Clinica Chimica Acta;20240114;第554卷;1-8 * |
| 血浆Septin9基因甲基化检测在胃肠道病变中的临床应用价值评价;王炳龙等;临床检验杂志;第39卷(第3期);182-187 * |
| 陈超.新技术与精准医学.上海交通大学出版社,2017,154-157. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115807091A (en) | 2023-03-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021128519A1 (en) | Combination of dna methylation biomarkers, and detection method therefor and kit thereof | |
| EP2768980B1 (en) | Composite biomarkers for non-invasive screening, diagnosis and prognosis of colorectal cancer | |
| CN110129436A (en) | The Serial No. of DNA methylation is analyzed | |
| JP2009022268A (en) | Method for detecting prostate cancer | |
| WO2021073029A1 (en) | Method, kit and system for auxiliary diagnosis of bladder cancer based on connecting driver gene mutations and adn methylation, and uses thereof | |
| JP2008206511A (en) | Characterizing prostate cancer | |
| JP2024020392A (en) | Composition for diagnosing liver cancer by using cpg methylation changes in specific genes, and use thereof | |
| Guo et al. | Quantitative detection of cytokeratin 20 mRNA in urine samples as diagnostic tools for bladder cancer by real-time PCR | |
| CN110734978B (en) | Application of DLX1, HOXC6 and PCA3 in preparation of prostate cancer markers and kit thereof | |
| KR102637032B1 (en) | Composition for diagnosing bladder cancer using CpG methylation status of specific gene and uses thereof | |
| CN117431321A (en) | Nucleic acid composition for detecting prostatic cancer or precancerous lesions, kit and application | |
| CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN115807091B (en) | Septin9 gene methylation detection kit based on microfluidic chip type digital PCR | |
| CN113430272B (en) | Reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer or precancerous lesion and application of reagent and kit | |
| EP3625370A1 (en) | Composite epigenetic biomarkers for accurate screening, diagnosis and prognosis of colorectal cancer | |
| CN114807350A (en) | Biomarker for judging benign and malignant thyroid nodules, polygene joint inspection kit and application | |
| US11542559B2 (en) | Methylation-based biomarkers in breast cancer screening, diagnosis, or prognosis | |
| CN110791567A (en) | Single-site DNA methylation detection kit | |
| CN115786502B (en) | Use of an agent for detecting the methylation level of a target region for the preparation of a diagnostic product for bladder cancer | |
| CN113005199B (en) | Primer composition for detecting microsatellite instability, kit and application | |
| WO2024031860A1 (en) | Multi-gene dna methylation co-detection kit for colorectal cancer diagnosis and use thereof | |
| CN117512117A (en) | Primer probe combination for detecting esophageal cancer gene methylation by digital PCR, kit and application thereof | |
| WO2023083348A1 (en) | Methylation detection reagent and kit for esophageal cancer diagnosis | |
| CN117604095A (en) | Methylation detection reagent and kit for esophageal cancer diagnosis | |
| CN117210566A (en) | Human ONECUT2 and CCNA1 gene methylation rapid detection composition and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |