CN115807091A - Septin9 gene methylation detection kit based on microfluidic chip type digital PCR - Google Patents
Septin9 gene methylation detection kit based on microfluidic chip type digital PCR Download PDFInfo
- Publication number
- CN115807091A CN115807091A CN202211451405.8A CN202211451405A CN115807091A CN 115807091 A CN115807091 A CN 115807091A CN 202211451405 A CN202211451405 A CN 202211451405A CN 115807091 A CN115807091 A CN 115807091A
- Authority
- CN
- China
- Prior art keywords
- septin9
- septin9 gene
- digital pcr
- methylation
- detection kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 73
- 101150042012 SEPTIN9 gene Proteins 0.000 title claims abstract description 63
- 230000011987 methylation Effects 0.000 title claims abstract description 62
- 238000007069 methylation reaction Methods 0.000 title claims abstract description 62
- 238000007847 digital PCR Methods 0.000 title claims abstract description 53
- 239000000523 sample Substances 0.000 claims abstract description 45
- 238000006243 chemical reaction Methods 0.000 claims abstract description 44
- 239000013612 plasmid Substances 0.000 claims abstract description 40
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 17
- LSNNMFCWUKXFEE-UHFFFAOYSA-N Sulfurous acid Chemical compound OS(O)=O LSNNMFCWUKXFEE-UHFFFAOYSA-N 0.000 claims abstract description 13
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 10
- 108091029523 CpG island Proteins 0.000 claims abstract description 7
- 108020004707 nucleic acids Proteins 0.000 claims abstract description 6
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 6
- 102000039446 nucleic acids Human genes 0.000 claims abstract description 6
- 108700039691 Genetic Promoter Regions Proteins 0.000 claims abstract description 4
- 238000000605 extraction Methods 0.000 claims abstract description 3
- 102000012060 Septin 9 Human genes 0.000 claims description 20
- 230000003321 amplification Effects 0.000 claims description 16
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 16
- 108020004414 DNA Proteins 0.000 claims description 14
- 239000000126 substance Substances 0.000 claims description 11
- 238000000034 method Methods 0.000 claims description 10
- 108050002584 Septin 9 Proteins 0.000 claims description 9
- 238000012408 PCR amplification Methods 0.000 claims description 7
- 238000010367 cloning Methods 0.000 claims description 7
- 238000003752 polymerase chain reaction Methods 0.000 claims description 6
- 101000632056 Homo sapiens Septin-9 Proteins 0.000 claims description 5
- 239000012295 chemical reaction liquid Substances 0.000 claims description 5
- 238000002360 preparation method Methods 0.000 claims description 5
- 238000010791 quenching Methods 0.000 claims description 3
- 230000000171 quenching effect Effects 0.000 claims description 3
- 125000006853 reporter group Chemical group 0.000 claims description 3
- 201000010099 disease Diseases 0.000 claims description 2
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims description 2
- 238000012545 processing Methods 0.000 claims description 2
- 230000001225 therapeutic effect Effects 0.000 claims 1
- 230000035945 sensitivity Effects 0.000 abstract description 9
- 108091028043 Nucleic acid sequence Proteins 0.000 abstract 1
- 239000002773 nucleotide Substances 0.000 abstract 1
- 125000003729 nucleotide group Chemical group 0.000 abstract 1
- 206010009944 Colon cancer Diseases 0.000 description 12
- 208000001333 Colorectal Neoplasms Diseases 0.000 description 12
- 238000004925 denaturation Methods 0.000 description 9
- 230000036425 denaturation Effects 0.000 description 9
- 239000000203 mixture Substances 0.000 description 9
- 238000011529 RT qPCR Methods 0.000 description 8
- 238000000137 annealing Methods 0.000 description 8
- 238000005516 engineering process Methods 0.000 description 6
- 206010028980 Neoplasm Diseases 0.000 description 5
- 201000011510 cancer Diseases 0.000 description 4
- 230000000694 effects Effects 0.000 description 4
- 238000011156 evaluation Methods 0.000 description 4
- 108090000623 proteins and genes Proteins 0.000 description 4
- 238000000746 purification Methods 0.000 description 4
- LSNNMFCWUKXFEE-UHFFFAOYSA-M Bisulfite Chemical compound OS([O-])=O LSNNMFCWUKXFEE-UHFFFAOYSA-M 0.000 description 3
- 238000007400 DNA extraction Methods 0.000 description 3
- 210000004369 blood Anatomy 0.000 description 3
- 239000008280 blood Substances 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 238000003745 diagnosis Methods 0.000 description 3
- 238000010790 dilution Methods 0.000 description 3
- 239000012895 dilution Substances 0.000 description 3
- 238000011304 droplet digital PCR Methods 0.000 description 3
- 230000003252 repetitive effect Effects 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 238000000246 agarose gel electrophoresis Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 230000002708 enhancing effect Effects 0.000 description 2
- 210000005259 peripheral blood Anatomy 0.000 description 2
- 239000011886 peripheral blood Substances 0.000 description 2
- 238000011002 quantification Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 230000009897 systematic effect Effects 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 241000270617 Cheloniidae Species 0.000 description 1
- 108091029430 CpG site Proteins 0.000 description 1
- 230000007067 DNA methylation Effects 0.000 description 1
- 108700025716 Tumor Suppressor Genes Proteins 0.000 description 1
- 102000044209 Tumor Suppressor Genes Human genes 0.000 description 1
- 230000001640 apoptogenic effect Effects 0.000 description 1
- 238000009534 blood test Methods 0.000 description 1
- 210000001124 body fluid Anatomy 0.000 description 1
- 239000010839 body fluid Substances 0.000 description 1
- 238000010276 construction Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 238000001839 endoscopy Methods 0.000 description 1
- 230000004049 epigenetic modification Effects 0.000 description 1
- 230000002550 fecal effect Effects 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 208000024200 hematopoietic and lymphoid system neoplasm Diseases 0.000 description 1
- 230000006607 hypermethylation Effects 0.000 description 1
- 238000003384 imaging method Methods 0.000 description 1
- 230000005764 inhibitory process Effects 0.000 description 1
- 230000003902 lesion Effects 0.000 description 1
- 239000003550 marker Substances 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 230000001035 methylating effect Effects 0.000 description 1
- 238000000386 microscopy Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 230000001338 necrotic effect Effects 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 230000001737 promoting effect Effects 0.000 description 1
- 238000003762 quantitative reverse transcription PCR Methods 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 239000000439 tumor marker Substances 0.000 description 1
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a Septin9 gene methylation detection kit based on microfluidic chip type digital PCR. The Septin9 gene methylation detection kit comprises upstream and downstream primers and a detection probe aiming at methylation of CpG islands in a V2 transcript promoter region of Septin9 gene, wherein the nucleotide sequences of the upstream and downstream primers are respectively shown as SEQ ID NO. 1-2, and the nucleotide sequence of the detection probe is shown as SEQ ID NO. 3. The Septin9 gene methylation detection kit also comprises 2 XProbe Master Mix and ddH 2 O, a nucleic acid extraction reagent, a sulfite conversion reagent, a methylated plasmid standard and an unmethylated plasmid standard. The Septin9 gene methylation detection kit has the advantages of high sensitivity, strong specificity, good repeatability, wide linear range and strong mixed sample detection capability.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a Septin9 gene methylation detection kit based on microfluidic chip type digital PCR.
Background
Recent data from the national cancer center showed that 40.8 new cases and 19.6 death cases of colorectal cancer (CRC) occurred in 2016, and CRC also occurred in the third and fourth malignant tumor morbidity in fujian province. Therefore, colorectal cancer is one of the major burdens in the development of the economy and society of our country. Currently, the common CRC detection methods mainly include endoscopy, imaging, blood tumor marker detection, and Fecal Occult Blood Test (FOBT). Colorectal microscopy combined with pathological examination is the gold standard for diagnosing CRC, however limited by invasive examination and complications, with low compliance. FOBT and tumor markers are not suitable for early diagnosis of CRC due to inefficiency, low sensitivity and non-specificity. Therefore, it is necessary to develop a simple, sensitive and specific CRC diagnosis means.
Methylation of gene promoter is the most studied epigenetic modification, wherein, methylation of Septin9 gene promoter is the CRC diagnostic marker which is the most widely used in clinic at present. Research finds that Septin9 gene is used as tumor suppressor gene, and the methylation of promoter region inhibits the normal expression of the gene, thereby losing the cancer suppressor function and promoting the development of CRC. During colorectal cancer development, septin9 DNA is released from necrotic and apoptotic cancer cells into the peripheral blood, and thus CRC can be diagnosed by detecting the degree of methylation of the Septin9 gene (methylated Septin9, mSEPT 9) in the peripheral blood. However, the concentration of target molecules in body fluids is very low, and the sensitivity of detection of free DNA methylation depends on the methylation level of single CpG sites, which has been a major obstacle for cancer diagnosis based on methylated DNA fragments.
Effective methylated gene detection means are key to clinical application. MethyLight is a fluorescent-based real-time quantitative PCR (quantitative real-time PCR) method, and is widely used for methylation detection of tumor genes due to simple operation and relative quantification. In recent years, a kit for detecting mSEPT9 based on qPCR has been developed abroad, and the technology not only has higher sensitivity and specificity, but also overcomes the sensitivity difference caused by lesion positions. However, the qPCR technique has its limitations, such as low sensitivity, poor precision and repeatability, etc. when detecting low concentration samples. Compared with the qPCR technology, the methylation detection method based on the digital PCR (digital PCR, dPCR) technology can reduce background interference and pollution, can reduce the influence of PCR inhibition factors, has higher sensitivity and better accuracy and repeatability, and can realize absolute quantification. However, the common droplet dPCR technology has the key difficulties of tedious operation, easy pollution generation and the like.
Disclosure of Invention
The invention aims to overcome the defects of low sensitivity, complex operation, easy pollution generation and the like in detecting Septin9 gene methylation in the prior art, and provides a Septin9 gene methylation detection kit based on microfluidic chip digital PCR, which enhances the specificity of a reaction system by introducing a locked nucleic acid modified primer and a probe, optimizes the concentration of the primer and the probe, and optimizes the denaturation time and annealing/extension temperature of the microfluidic chip digital PCR, thereby further improving the amplification efficiency of the system and enhancing a fluorescent signal.
In order to realize the purpose, the technical scheme adopted by the invention is as follows:
a Septin9 gene methylation detection kit based on microfluidic chip type digital PCR comprises upstream and downstream primers and a detection probe aiming at methylation of CpG islands in a promoter region of a Septin9 gene V2 transcript, wherein the sequences of the upstream and downstream primers and the detection probe are as follows:
septin9 upstream primer: 5'-GTAGTTAGTTTAGTATTTATTTTC/iXNA _ G/-3',
septin9 downstream primer: 5'-CCCACCAACCATCATAT/iXNA _ C/-3',
septin9 detection probe: 5'-TTAGTTG/iXNA _ C/G/iXNA _ C/GTTGAT/iXNA _ C/G-3'.
Furthermore, the 5 'end of the septin9 detection probe is labeled with a fluorescence reporter group FAM, and the 3' end is labeled with a quenching group MGB.
Furthermore, the Septin9 gene methylation detection kit also comprises 2 XProbe Master Mix and ddH 2 O, nucleic acid extraction reagent, sulfite conversion reagent, methylated plasmid standard substance and unmethylated plasmid standard substanceAnd (5) preparing a standard product.
Furthermore, the methylated plasmid standard substance is a plasmid containing a methylation specific sequence of the Septin9 gene, and the unmethylated plasmid standard substance is a plasmid containing a methylation specific sequence of the Septin9 gene.
Furthermore, the methylation specific sequence of the Septin9 gene is GTAGTTAGTTTAGTAT TTATTTTCGAAGTTCGAAATGATTTTATTTAGTTGCGCGTTGATCGCGGGGTTCGATATGATGGTTGGTGGG, and the non-methylation specific sequence of the Septin9 gene is GTAGTTAGTTTAGTATTTATTTTTGAAGTTTGAAATGATTTTATTTAGTTGTGTGTTGATTGTGGGGTTTGATATGATGGTTGGTGGG.
Furthermore, the methylation specific sequence of the Septin9 gene is obtained by cloning from HeLa cell ATCC CCL-2 (methylation of Septin9 gene region), and the non-methylation specific sequence of the Septin9 gene is obtained by cloning from Jurkat cell SCSP-513 (methylation of Septin9 gene region).
The Septin9 gene methylation detection kit is applied to preparation of products for detecting Septin9 gene methylation.
A method for detecting Septin9 gene methylation by using the Septin9 gene methylation detection kit based on microfluidic chip digital PCR is used for non-disease diagnosis and treatment purposes, and comprises the following steps:
1) And (3) processing the detected sample: extracting genome DNA of an object to be detected, and performing sulfite treatment to obtain a DNA template converted by sulfite of a detected sample;
2) Preparing a digital PCR reaction system: the formula of the digital PCR reaction system is as follows: 2 XProbe Master Mix 20 uL, 10 uM upstream and downstream primers 0.8 uL, 10 uM detection Probe 0.4 uL, PCR promoter 1 uL, sulfite-converted template DNA 5 uL, ddH 2 O 12 μL；
3) Preparing PCR micro-reaction liquid drops capable of independently carrying out PCR amplification reaction by using the digital PCR reaction system prepared in the step 2) through a microfluid preparation system;
4) Carrying out digital PCR amplification reaction on the PCR micro-reaction liquid drop prepared in the step 3);
5) And (3) collecting signals of the products after the digital PCR amplification reaction in the step 4), and judging whether the detected sample contains methylated human Septin9 genes according to the existence of fluorescent signals.
The invention has the following remarkable advantages:
the invention enhances the specificity of a reaction system by introducing the primer modified by locked nucleic acid and the probe, and simultaneously optimizes the concentration of the primer and the probe, the denaturation time and the annealing/extension temperature of the microfluidic chip type digital PCR, thereby further improving the amplification efficiency of the system and enhancing the fluorescent signal. The invention can eliminate non-specific products generated by non-methylated alleles, the improved new technology has higher sensitivity and specificity, and methylated and non-methylated Septin9 gene sequences can be distinguished from low-concentration free DNA.
Drawings
FIG. 1 is a sequence diagram of the sequencing of methylated and unmethylated plasmid standards. A. B, non-methylated plasmid standard substance; C. and D, methylating the plasmid standard substance.
FIG. 2 is a qPCR amplification chart for primer and probe specificity verification.
FIG. 3 is a digital PCR amplification plot of microfluidic chips with different denaturation times and different annealing/extension temperatures. A, different denaturation times; b, different annealing/extension temperatures.
FIG. 4 is a digital PCR amplification plot of microfluidic chip with different primer concentrations and different probe concentrations. A, different primer concentrations; b, different probe concentrations.
FIG. 5 is the linear range of the Septin9 methylation detection kit of the microfluidic chip type digital PCR.
FIG. 6 shows the specificity of Septin9 methylation detection kit of microfluidic chip digital PCR.
FIG. 7 shows the lowest detection limit of Septin9 methylation detection kit for microfluidic chip digital PCR.
FIG. 8A is a repetitive day 1 detection result of the Septin9 methylation detection kit of microfluidic chip digital PCR; FIG. 8B is a repetitive day 2 detection result of the Septin9 methylation detection kit of microfluidic chip digital PCR; drawing (A)8C is a repeated day 3 detection result of the Septin9 methylation detection kit of the microfluidic chip type digital PCR; FIG. 8D is a repeated day 4 detection result of the Septin9 methylation detection kit of microfluidic chip digital PCR; FIG. 8E shows the repetitive day 5 detection results of the Septin9 methylation detection kit of microfluidic chip-based digital PCR; 1:10 7 copies/mL；2：10 4 copies/mL。
FIG. 9 shows the detection ability of the Septin9 methylation detection kit of microfluidic chip digital PCR on mixed samples.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The experimental materials involved in the invention are as follows:
blood/cell/tissue genomic DNA extraction kit, purchased from TIANGEN, cat # DP304.HeLa cells, purchased from ATCC cell bank, number ATCC CCL-2, whose Septin9 gene region has been methylated. Jurkat cells, purchased from the China academy of sciences type culture Collection cell Bank, accession number SCSP-513, were unmethylated in the Septin9 gene region. Bisulfite conversion reagent set, available from Zymo Research, cat # D5003.Taq PCR Master Mix, available from Sangon Biotech, cat # B639295. pMD 18-T Vector Cloning Kit, available from TaKaRa, cat # 6011.Trans1-T1 Phage Resistant chemically competent cells, purchased from TransGen Biotech, inc., cat # D501. Plasmid mini-prep kit, purchased from TIANGEN, cat # DP103.2 XProbe Master Mix, available from Vazyme, cat # Q112-02.PCR promoter purchased from small sea turtle science, cat # E014-01.
Example 1
1. Design of primers and probes
Searching a CpG island sequence (NM-001113493) on a promoter of a v2 transcript of a human Septin9 gene on an NCBI database, and converting by using a Methprimer to obtain a CpG island sequence after sulfite treatment; and predicting the hypermethylation sites of the CpG island by using the Methprimer and the Methbank together. Primers and probes were designed using oligo7 with the sulfurized DNA (sulfite-treated CpG island sequence) as the template strand. The design principle is as follows: the methylated sequences are amplified through primers, and then the methylated sequences are specifically identified through the combination of a detection probe and CG sites on the methylated sequences. In order to improve the recognition capability and the discrimination capability of the primer on mismatched bases, the invention carries out locked nucleic acid modification on the primer and the probe, and the sequences of the primer and the probe are shown in Table 1.
TABLE 1 Septin9 Gene detection primers and probes
Wherein, the 5 'end of the detection probe is marked with a fluorescence reporter group FAM, and the 3' end is marked with a quenching group MGB.
2. Construction of plasmid standards
Extracting HeLa cell ATCC CCL-2 genome DNA by adopting a blood/cell/tissue genome DNA extraction kit, performing sulfite conversion and purification by adopting a bisulfite conversion method reagent kit, and performing PCR amplification by taking the sulfite conversion and purification as a template. The PCR amplification system is as follows: taq PCR Master Mix 10. Mu.L, upstream and downstream primers 0.4. Mu.L, template DNA 5. Mu.L, water make up to 20. Mu.L; wherein, the upstream primer is 5'-GTAGTTAGTTTAGTATTTATTTTC-3', and the downstream primer is 5'-CCCACCAACCATCATAT-3'. The PCR amplification procedure was: 94. 3 min at the temperature; 94. 10s at 60 ℃ and 20 s at 72 ℃ and 15 s at 72 ℃ for 35 cycles; 72. deg.C for 5 min. The product was recovered and ligated into T-Vector using pMD 18-T Vector Cloning Kit and transformed into Trans1-T1 Phage resist chemically competent cells. After being cultured overnight at a constant temperature of 37 ℃, single colonies are picked for PCR and agarose gel electrophoresis identification. The sequence of the product is verified by colony sequencing, namely a methylation specific sequence GTAGTTAGTTTAGTATTTATTTTCGAAGTTCGAAATGATTTTATTTAGTTGCGCGTTGATCGCGGGGTTCGATATGATGGTTGGTGGG of the Septin9 gene cloned from the HeLa cell is obtained, and a plasmid is extracted to obtain a methylation plasmid standard product (figure 1). The concentration of methylated plasmid standards was quantified using a Nanodrop2000 microspectrophotometer and the plasmid concentration was converted to copies/mL. And carrying out gradient dilution on the plasmid to establish methylated plasmid standards with different concentrations.
Extracting Jurkat cell SCSP-513 genome DNA by adopting a blood/cell/tissue genome DNA extraction reagent, performing sulfite conversion and purification by adopting a bisulfite conversion method reagent set, and performing PCR amplification by taking the sulfite conversion and purification as a template. The PCR amplification system is as follows: taq PCR Master Mix 10. Mu.L, upstream and downstream primers 0.4. Mu.L, template DNA 5. Mu.L, water make up to 20. Mu.L; wherein, the upstream primer is 5'-GTAGTTAGTTTAGTATTTATTTTC-3', and the downstream primer is 5'-CCCACCAACCATCATAT-3'. The PCR amplification procedure was: 94. 3 min at the temperature; 94. 10s at 60 ℃ and 20 s at 72 ℃ and 15 s at 72 ℃ for 35 cycles; 72. deg.C for 5 min. The product was recovered and ligated into T-Vector using pMD 18-T Vector Cloning Kit and transformed into Trans1-T1 Phage resist chemically competent cells. After being cultured overnight at a constant temperature of 37 ℃, single colonies are picked for PCR and agarose gel electrophoresis identification. The product sequence was verified by colony sequencing, i.e., the unmethylated specific sequence GTAGTTAGTTTAGTATTTATTTTTGAAGTTTGAAATGATTTTATTTAGTTGTGTGTTGATTGTGGGGTTTGATATGATGGTTGGTGGG of Septin9 gene cloned from Jurkat cells was obtained, and the plasmid was extracted to obtain the methylated plasmid standard (FIG. 1). The concentration of methylated plasmid standards was quantified using a Nanodrop2000 microspectrophotometer and the plasmid concentration was converted to copies/mL. The plasmid is subjected to gradient dilution, and non-methylated plasmid standards with different concentrations are established.
3. Verification of primer and Probe specificity
RT-qPCR technology was used to check and verify the specificity of the primers and probes in Table 1. A40. Mu.L reaction was used: 2 XProbe Master Mix 20 uL, upstream and downstream primers (10 uM) each 1.2 uL, detection Probe (10 uM) 0.4 uL, 0.01 ng/uL-10 ng/uL template (methylated plasmid standard or non-methylated plasmid standard) 5 uL, ddH 2 O12.2. Mu.L. The test was performed on a qPCR instrument. The reaction conditions are as follows: 95 ℃ for 30s, 60 ℃ for 30s,45 cyclesAnd (4) a ring. The results show that the detection method has better specificity, and the primers and the probes are feasible (figure 2).
4. Optimizing micro-fluidic chip type digital PCR detection reaction condition and reaction system
Preparing a digital PCR reaction system: the initial formula of the digital PCR reaction system is as follows: 2 × Probe Master Mix 20 μ L, upstream and downstream primers (10 μ M) each 0.8 μ L, detection Probe (10 μ M) 0.8 μ L, PCR promoter 1 μ L,10 μ L 7 copies/mL template (methylated plasmid Standard) 5. Mu.L, ddH 2 O12. Mu.L. Preparing the prepared digital PCR reaction system into PCR micro-reaction liquid drops capable of independently carrying out PCR amplification reaction through a microfluid preparation system, and carrying out one-step digital PCR amplification reaction, wherein the initial reaction conditions are as follows: preheating at 50 deg.C for 10 min, and pre-denaturing at 95 deg.C for 5 min; denaturation at 95 ℃ 30s, annealing/extension at 60 ℃ 30s,45 cycles. And (3) collecting signals of products after one-step digital PCR amplification reaction, and judging whether the detected sample contains methylated human Septin9 genes and the quantity and content of the methylated human Septin9 genes according to the existence of fluorescent signals.
On the basis of initial conditions, changing the annealing/extension temperature to 52-62 ℃ to carry out digital PCR amplification on the microfluidic chip, and selecting the optimal temperature according to the clustering effect of the positive microdroplets; and changing the denaturation time to be 5-30 s to perform digital PCR amplification on the microfluidic chip, and selecting the optimal denaturation time according to the total digital PCR amplification duration and the positive microdroplet clustering effect. On the basis of an initial system, the final concentration of the diluted primer in a reaction system is 0.1-0.5 mu M for amplification, and the optimal primer concentration is judged according to the clustering effect of positive microdroplets; the final concentration of the diluted probe in the reaction system is 0.1-0.5. Mu.M for amplification, and the optimal probe concentration is judged according to the positive microdroplet clustering effect. The results showed that the optimum annealing/elongation temperature was 60 ℃ and the optimum denaturation time was 5 s (FIG. 3); the optimal final concentration of the primer in the reaction system was 0.2. Mu.M, and the optimal final concentration of the probe in the reaction system was 0.1. Mu.M (FIG. 4).
The optimized microfluidic chip type digital PCR detection system and the reaction conditions are as follows:
reaction system: 2 XProbe Master Mix 20 uL, upstream and downstream primers (10 uM) 0.8 uL eachL, 0.4. Mu.L of detection probe (10. Mu.M), 1. Mu.L of PCR promoter, 5. Mu.L of template, ddH 2 O 12 μL；
Reaction conditions are as follows: preheating at 50 deg.C for 10 min, and pre-denaturing at 95 deg.C for 5 min; denaturation at 95 ℃ 5 s, annealing/extension at 60 ℃ 30s,45 cycles.
5. Microfluidic chip type digital PCR Septin9 methylation detection method evaluation
And (3) performing systematic method performance evaluation on the optimized microfluidic chip type digital PCR detection system by using the self-constructed plasmid standard product, wherein the systematic method performance evaluation comprises index evaluation of precision, minimum detection limit, specificity, linear range and the like. Diluting the constructed standard substance by times in a dilution range of 10 7 copies/mL-10 1 copies/mL, detecting methylated plasmid standard substances with different concentrations, and indicating that the linear range of the standard curve is 10 7 -10 2 copies/mL，R 2 Up to 0.9992 (fig. 5); methylated, unmethylated plasmid standards and blank control (ddH) 2 O), and simultaneously amplifying in the same dPCR reaction, wherein the result shows that the detection method has better specificity (figure 6); the optimized microfluidic chip type digital PCR reaction system is used for detecting methylated plasmid standard substances with different low concentrations, and the result shows that the lowest detection limit is 10 3 copies/mL (FIG. 7); within the detection range, take the height (10) 7 copies/mL, low (10) 4 copies/mL) 2 concentrations of plasmid standard substance, 5 times per day, and 5 days continuously, the result shows 10 7 The coefficient of variation between copies/mL in and between batches was 6.35% and 10.70%, 10% 4 The coefficient of variation was 3.50% and 3.57% within and between copies/mL (FIGS. 8A-8E); the methylated and unmethylated plasmid standards were mixed at different concentrations, and the results showed that the actual mutation ratio and the microfluidic chip-based digital PCR detection gave a ratio consistency (R) 2 =0.9939，P<0.0001 Preferably (FIG. 9).
Claims (8)
1. A Septin9 gene methylation detection kit based on microfluidic chip type digital PCR is characterized in that: the kit comprises upstream and downstream primers and a detection probe aiming at methylation of CpG islands in a V2 transcript promoter region of Septin9 gene, wherein the sequences of the upstream and downstream primers and the detection probe are as follows:
septin9 upstream primer: 5'-GTAGTTAGTTTAGTATTTATTTTC/iXNA _ G/-3',
septin9 downstream primer: 5'-CCCACCAACCATCATAT/iXNA _ C/-3',
septin9 detection probe: 5'-TTAGTTG/iXNA _ C/G/iXNA _ C/GTTGAT/iXNA _ C/G-3'.
2. The Septin9 gene methylation detection kit based on microfluidic chip-based digital PCR of claim 1, wherein: the 5 'end of the septin9 detection probe is labeled with a fluorescence reporter group FAM, and the 3' end of the detection probe is labeled with a quenching group MGB.
3. The Septin9 gene methylation detection kit based on microfluidic chip-based digital PCR according to claim 1, characterized in that: the Septin9 gene methylation detection kit also comprises 2 XProbe Master Mix and ddH 2 O, a nucleic acid extraction reagent, a sulfite conversion reagent, a methylated plasmid standard and an unmethylated plasmid standard.
4. The Septin9 gene methylation detection kit based on microfluidic chip-based digital PCR of claim 3, wherein: the methylated plasmid standard substance is a plasmid containing a methylation specific sequence of a Septin9 gene, and the unmethylated plasmid standard substance is a plasmid containing a methylation specific sequence of the Septin9 gene.
5. The Septin9 gene methylation detection kit based on microfluidic chip-based digital PCR of claim 4, wherein: the methylation specific sequence of the Septin9 gene is GTAGTTAGTTTAGTATTTATTTTCGAAGTTCGAAATGATTTTATTTAGTTGCGCGTTGATCGCGGGGTTCGATATGATGGTTGGTGGG, and the non-methylation specific sequence of the Septin9 gene is GTAGTTAGTTTAGTATTTATTTTTGAAGTTTGAAATG ATTTTATTTAGTTGTGTGTTGATTGTGGGGTTTGATATGATGGTTGGTGGG.
6. The Septin9 gene methylation detection kit based on microfluidic chip-based digital PCR of claim 5, wherein: the methylation specific sequence of the Septin9 gene is obtained by cloning from HeLa cells ATCC CCL-2, and the non-methylation specific sequence of the Septin9 gene is obtained by cloning from Jurkat cells SCSP-513.
7. The use of the Septin9 gene methylation detection kit of claim 1 in the preparation of a product for detecting Septin9 gene methylation.
8. A method for detecting Septin9 gene methylation by using the Septin9 gene methylation detection kit based on microfluidic chip type digital PCR (polymerase chain reaction) of claim 1, which is characterized by comprising the following steps: the method is used for non-disease diagnostic therapeutic purposes; the method comprises the following steps:
and (3) processing the detected sample: extracting genome DNA of an object to be detected, and carrying out sulfite treatment to obtain a DNA template converted by sulfite of a detected sample;
preparing a digital PCR reaction system: the formula of the digital PCR reaction system is as follows: 2 XProbe Master Mix 20 uL, 10 uM upstream and downstream primers 0.8 uL, 10 uM detection Probe 0.4 uL, PCR promoter 1 uL, sulfite-converted template DNA 5 uL, ddH 2 O 12 μL；
Preparing PCR micro-reaction liquid drops capable of independently carrying out PCR amplification reaction by using the digital PCR reaction system prepared in the step 2) through a microfluid preparation system;
carrying out one-step digital PCR amplification reaction on the PCR micro-reaction liquid drop prepared in the step 3);
and (3) collecting signals of the products after the digital PCR amplification reaction in the step 4), and judging whether the detected sample contains methylated human Septin9 genes according to the existence of fluorescent signals.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211451405.8A CN115807091B (en) | 2022-11-20 | 2022-11-20 | Septin9 gene methylation detection kit based on microfluidic chip type digital PCR |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211451405.8A CN115807091B (en) | 2022-11-20 | 2022-11-20 | Septin9 gene methylation detection kit based on microfluidic chip type digital PCR |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115807091A true CN115807091A (en) | 2023-03-17 |
| CN115807091B CN115807091B (en) | 2024-03-08 |
Family
ID=85483572
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211451405.8A Active CN115807091B (en) | 2022-11-20 | 2022-11-20 | Septin9 gene methylation detection kit based on microfluidic chip type digital PCR |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115807091B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105603061A (en) * | 2015-12-11 | 2016-05-25 | 宁云山 | Method, probe, primer and kit for detecting methylation of human Septin 9 gene based on digital PCR technology |
| CN106834426A (en) * | 2015-12-04 | 2017-06-13 | 博尔诚（北京）科技有限公司 | Composition and application thereof for detecting cancer of pancreas |
| CN113981083A (en) * | 2021-10-29 | 2022-01-28 | 江苏康为世纪生物科技股份有限公司 | Nucleic acid combination and kit for colorectal cancer gene methylation detection |
| CN115449550A (en) * | 2022-07-26 | 2022-12-09 | 福建医科大学附属第一医院 | Locked nucleic acid modified septin9 gene methylation detection method |
-
2022
- 2022-11-20 CN CN202211451405.8A patent/CN115807091B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106834426A (en) * | 2015-12-04 | 2017-06-13 | 博尔诚（北京）科技有限公司 | Composition and application thereof for detecting cancer of pancreas |
| CN105603061A (en) * | 2015-12-11 | 2016-05-25 | 宁云山 | Method, probe, primer and kit for detecting methylation of human Septin 9 gene based on digital PCR technology |
| CN113981083A (en) * | 2021-10-29 | 2022-01-28 | 江苏康为世纪生物科技股份有限公司 | Nucleic acid combination and kit for colorectal cancer gene methylation detection |
| CN115449550A (en) * | 2022-07-26 | 2022-12-09 | 福建医科大学附属第一医院 | Locked nucleic acid modified septin9 gene methylation detection method |
Non-Patent Citations (2)
| Title |
|---|
| QUNFANG HUANG等: "A novel microfluidic chip-based digital PCR method for enhanced sensitivity in the early diagnosis of colorectal cancer via mSEPT9", CLINICA CHIMICA ACTA, vol. 554, 14 January 2024 (2024-01-14), pages 1 - 8, XP087461241, DOI: 10.1016/j.cca.2024.117781 * |
| 王炳龙等: "血浆Septin9基因甲基化检测在胃肠道病变中的临床应用价值评价", 临床检验杂志, vol. 39, no. 3, pages 182 - 187 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115807091B (en) | 2024-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20080254455A1 (en) | Detecting prostate cancer | |
| EP2768980B1 (en) | Composite biomarkers for non-invasive screening, diagnosis and prognosis of colorectal cancer | |
| CN110129436A (en) | The Serial No. of DNA methylation is analyzed | |
| WO2017143866A1 (en) | Kit and method for quantitative detection of dna methylation in rprm genes | |
| WO2021073029A1 (en) | Method, kit and system for auxiliary diagnosis of bladder cancer based on connecting driver gene mutations and adn methylation, and uses thereof | |
| JP2008206511A (en) | Characterizing prostate cancer | |
| CN110484621A (en) | A kind of method of liver cancer early warning | |
| KR102637032B1 (en) | Composition for diagnosing bladder cancer using CpG methylation status of specific gene and uses thereof | |
| CN109593847B (en) | Primer pair, kit and method for detecting stability of NR24 locus of microsatellite | |
| CN116970705B (en) | Nucleic acid product for methylation detection of urothelial oncogene, kit and application | |
| CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| US11535897B2 (en) | Composite epigenetic biomarkers for accurate screening, diagnosis and prognosis of colorectal cancer | |
| CN115807091B (en) | Septin9 gene methylation detection kit based on microfluidic chip type digital PCR | |
| CN114807350A (en) | Biomarker for judging benign and malignant thyroid nodules, polygene joint inspection kit and application | |
| US20210079482A1 (en) | Methylation-based biomarkers in breast cancer screening, diagnosis, or prognosis | |
| CN113005199B (en) | Primer composition for detecting microsatellite instability, kit and application | |
| CN115948561B (en) | Reagent and detection kit for esophageal squamous carcinoma diagnosis or auxiliary diagnosis and application thereof | |
| CN116064798B (en) | Endometrial cancer gene methylation detection reagent and application thereof | |
| CN112553318B (en) | Taqman probe-based deletion type alpha-thalassemia detection kit and detection method thereof | |
| CN115851937A (en) | Primer probe composition for multi-gene methylation joint detection of cervical cancer, kit and application | |
| CN117721203A (en) | Composition for detecting thyroid cancer and application thereof | |
| WO2023083348A1 (en) | Methylation detection reagent and kit for esophageal cancer diagnosis | |
| CN117512117A (en) | Primer probe combination for detecting esophageal cancer gene methylation by digital PCR, kit and application thereof | |
| CN117604095A (en) | Methylation detection reagent and kit for esophageal cancer diagnosis | |
| CN117587125A (en) | Application of reagent for detecting methylation in preparation of pancreatic cancer diagnosis product |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |