CN115807029A - Application of rice OsBGAL1 gene in regulation and control of seed germination - Google Patents

Abstract

The invention discloses application of a rice OsBGAL1 gene in regulation and control of seed germination. Experiments of the invention show that the knockout of the OsBGAL1 gene can obviously accelerate the germination of rice seeds. The invention can provide gene resources for solving the problems of slow germination, irregular germination of seeds and the like in the direct seeding process of rice seeds and cultivating new rice varieties, and has wide application prospect.

Description

Application of rice OsBGAL1 gene in regulation and control of seed germination

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to application of a rice OsBGAL1 gene in regulation and control of seed germination.

Background

Rice is one of the main food crops in China, more than half of the world population eats the rice, and the basic civil problem is directly influenced by the yield of the rice. Differences in rice seed germination capacity and speed can affect emergence consistency and uniformity, and further affect yield formation. Meanwhile, with the rapid development of economy and urbanization, the rice direct seeding technology which reduces labor force, reduces cost, is convenient for mechanization and simplification and is convenient to operate is more and more emphasized. The key to overcoming the promotion of the direct seeding technology is the germination of the seeds.

OsBGAL1 belongs to the gene family of beta-galactosidase (beta-galactosidase). The beta-galactosidase degrades galactan and polysaccharide containing galactose in cell walls, participates in a series of physiological and biochemical processes, such as plant growth, fruit ripening, flower senescence, fiber development and the like, and is also related to seed germination. At present, most of research progresses related to beta-galactosidase family genes relate to growth periods such as pollen development and fruit ripening, only one relevant literature report exists for the OsBGAL1 gene at present, the gene is relatively highly expressed in seedling roots, buds and leaf sheaths of 15-30 days old plants, but no report is found about the function and application of the OsBGAL1 gene in regulation of rice seed germination.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the prior art and provides application of a rice OsBGAL1 gene in regulation and control of seed germination.

Experiments show that the rice OsBGAL1 gene is related to rice seed germination, and the OsBGAL1 gene and the protein coded by the gene can be used for regulating and controlling the phenotype of seed germination and dormancy, so that the rice OsBGAL1 gene or the protein can be applied to plant breeding, and the expression quantity of the OsBGAL1 gene is regulated and controlled to regulate and control seed dormancy or germination.

Therefore, the first purpose of the invention is to provide the application of the OsBGAL1 gene in regulating and controlling seed germination.

Preferably, the OsBGAL1 gene is a gene encoding a protein with an amino acid sequence shown as SEQ ID NO. 2. The amino acid sequence of the protein is shown as SEQ ID NO.2, or the protein is an amino acid sequence which is formed by replacing, deleting or/and adding one or more amino acid residues in the amino acid sequence shown as SEQ ID NO.2 and has the same function. The OsBGAL1 gene has a sequence shown in SEQ ID NO.1, or a gene sequence which is obtained by replacing, deleting and/or adding one or more nucleotides in the sequence shown in SEQ ID NO.1 and codes a protein shown in SEQ ID NO.2 and has the same function.

Preferably, the nucleotide sequence of the OsBGAL1 gene is shown in SEQ ID NO. 1. The OsBGAL1 gene sequence has the full length of 2526bp and encodes 841 amino acids.

Preferably, the application is the application of knocking out OsBGAL1 gene in accelerating seed germination and improving germination rate. The plant species involved in the seeds include rice, wheat, corn, sorghum, millet and other cereal crops, and also include other important commercial crops such as cotton, rape or tomato.

Preferably, the seeds are seeds of gramineous plants.

Preferably, the seeds are rice seeds.

The invention also provides a method for obtaining improved rice capable of accelerating seed germination and improving germination rate, which comprises the following steps: the method comprises the steps of constructing a knockout vector of OsBGAL1 gene by using a CRISPR/Cas9 genome editing system, wherein the nucleotide sequence of the OsBGAL1 gene is shown in SEQ ID No.1, and two specific target sequences for constructing the knockout vector are target 1: GGTGACGTACAAGAAGGGCGG and target 2: CGGAGAAGAGAATCCTCCTCTGG; then transferring the knockout vector into rice cells and integrating the rice cells into a chromosome, and screening cells, tissues or organs which successfully knock out the OsBGAL1 gene to regenerate plants.

Compared with the prior art, the invention has the following beneficial effects:

(1) The OsBGAL1 gene and the encoding protein thereof can be used for controlling rice seed germination. The OsBGAL1 gene knockout strain shows a seed germination accelerating phenotype. Therefore, the method can provide gene resources for solving the problems of slow germination, irregular germination of seeds and the like in the direct seeding process of rice seeds and cultivating new rice varieties. The invention has great significance for solving the problems of difficult seed germination and the like in the direct seeding process of rice and has wide application prospect in plant breeding.

(2) The OsBGAL1 gene is related to rice seed development, provides a material for researching and controlling expression regulation of embryo-related genes, and is also beneficial to research on a plant seed development mechanism.

Drawings

FIG. 1 shows the transcription expression of OsBGAL1 gene in the embryo of rice seed in the germination process.

FIG. 2 is a biological statistical analysis of the germination rates of WT, osbgal1-12, osbgal-26; wherein the graph a is a germination rate real object graph of rice seeds germinating in water for 6 days; and the figure b is a statistical result graph of the germination rate of the rice seeds.

Detailed Description

The following examples are further illustrative of the present invention and are not intended to be limiting thereof.

Example 1: construction of OsBGAL1 gene knockout vector and acquisition of rice gene knockout plant

1. Construction of OsBGAL1 homozygous mutant plant

A gene knockout mutant plant is obtained by editing OsBGAL1 gene in wild rice (Nipponbare) by using a CRISPR/Cas9 genome editing system. The CRISPR-Pv 2.0 website (http:// CRISPR. Hzau. Edu. Cn/cgi-bin/CRI SPR 2/CRISPR) is used for analyzing the exon sequence of a target gene OsBGAL1 (gene ID: os03t0165400-01, the CDS sequence of which is shown as SEQ ID NO.1 and has the full length of 2526bp, and the coded protein sequence is shown as SEQ ID NO.2 and has 841 amino acids), two specific target sequences are selected, and are respectively the target 1: GGTGACGTACAAGAAGGGCGG and target 2: CGGAGAAGAGAATCCTCCTCTGG. Two expression cassettes U6 a-target 1-sgRNA and U3-target 2-sgRNA connected with the sgRNA are obtained by overlapping PCR respectively. The two expression cassettes are connected into a pYLCRISPR/Cas9Pubi-H vector by utilizing the non-overlapping characteristic of the cleavage site and the recognition site of BsaI enzyme, so as to generate a pCRISPR-OsBGAL1 vector containing an OsBGAL1 specific target spot, and the pCRISPR-OsBGAL1 vector is transformed into DH5 alpha competent cells. After plasmids are extracted from the positive clones, the plasmids are sent to a company for sequencing, and pCRISPR-OsBGAL1 plasmids with correct results are selected to obtain gene knockout mutant plants through a method of infecting rice calluses by agrobacterium and regeneration.

2. Identification of OsBGAL1 homozygous mutant plant

Extracting the total genome DNA of a single T0 generation transgenic plant, taking the total genome DNA as a template, carrying out PCR amplification on a sequence containing target spots 1 and 2 by using primers (F: CAGCATCAGCAGTTCACTGTCCTC; R: CACACACTACCAAGCCTCCTATCT TTAGCCTTCTCTTC) positioned at two end flanks of an OsBGAL1 target spot, recovering a single and clear amplification product of a target band, and sending the product to a company for sequencing. After sequencing, a DSDecodeM website (http:// skl. Scau. Edu. Cn/dsde code /) is used for decoding and analyzing a sequencing result, and independent homozygous OsBGAL1 gene knockout mutation lines OsBGAL1-12 and OsBGAL1-26 with different mutation sites are selected for subsequent experiments.

Example 2: qPCR technology for analyzing expression of OsBGAL1 in mRNA level in rice seed germination process

RNA extraction is carried out according to instructions of a plant extraction kit (containing DNase) for the Baitach polysaccharide and polyphenol; synthesizing a reverse transcription cDNA first chain, calculating the volume of a required 1000ng RNA template, mixing the template with a solution of a kit, slightly shaking and uniformly mixing, and centrifuging for 5min at 37 ℃ for a short time to remove residual DNA of an RNA genome; after the above reaction, first strand cDNA synthesis was performed, and the above genome DNA-free reaction solution was added with the reagent in the kit and centrifuged briefly, and then heated at 42 ℃ for 15min and 85 ℃ for 5min until inactivation of Star Script II RT Mix, to obtain a cDNA solution. After the reaction is completed, diluting the obtained cDNA by 10 times; specific amplification primers are designed by using Primer Premier 5, and the upstream primers and the downstream primers of OsBGAL1 are respectively as follows: f: AAGCACACAGA AAGCGATGC, R: cactccatccaggaccaac; the reference gene, eF1a (F: GT CAAGTTTGCTGAGCTGTG, R: CAGCATCACCGTTTCTTGAGGA) in rice seeds was used as a control. Seeds of a wild rice plant WT, osBGAL1 gene knockout mutant plants OsBGAL1-12 and OsBGAL1-26 are respectively placed in a transparent square germination box covered with two layers of wet filter paper and are placed in an incubator at 28 ℃ with light/dark of 12h/12h for culture. Detecting the transcription expression quantity of OsBGAL1 gene (figure 1) in the rice germination process. The result shows that the expression quantity of OsBGAL1 continuously increases and then decreases along with the imbibition of rice seeds, and the expression quantity reaches the highest value when the imbibition lasts for 48 hours; the expression quantity of OsBGAL1 in rice seed embryos of OsBGAL1 knock-out mutant strains OsBGAL1-12 and OsBGAL1-26 is lower than that of wild seeds.

Example 3: osBGAL1 phenotype analysis-transgenic plant seed germination analysis test

Seeds of wild rice plants WT, osBGAL1 gene knockout mutant plants OsBGAL1-12 and OsBGAL1-26 are respectively put into a transparent square germination box covered by two layers of wet filter paper, and are cultured in an incubator at 28 ℃ with light/dark of 12h/12 h. 4 biological replicates were set, 100 rice seeds per replicate. And (3) observing the germination condition of the seeds at variable time, taking the fact that the embryo completely breaks through the seed coat as a standard, and calculating the germination rate, wherein the germination rate = germination number/total number 100%. Experiments show that the seeds of the OsBGAL1 gene knockout mutant strain have a higher germination rate than wild seeds (figure 2), and the early germination rate is higher and more orderly.

Claims (7)

1. Application of OsBGAL1 gene in regulating seed germination.
2. 2. The use according to claim 1, wherein the OsBGAL1 gene is a gene encoding a protein having an amino acid sequence shown in SEQ ID No. 2.
3. 3. The use according to claim 1, wherein the nucleotide sequence of OsBGAL1 gene is shown in SEQ ID No. 1.
4. 4. The use according to claim 1, wherein the OsBGAL1 gene is knocked out for accelerating seed germination and improving germination rate.
5. 5. The use according to claim 1, wherein the seed is a seed of a gramineous plant.
6. 6. The use of claim 1, wherein the seed is a rice seed.
7. 7. A method for obtaining improved rice with accelerated seed germination and improved germination rate is characterized by comprising the following steps: constructing a knockout vector of OsBGAL1 gene by using a CRISPR/Cas9 genome editing system, wherein the nucleotide sequence of the OsBGAL1 gene is shown as SEQ ID NO.1, and two specific target sequences for constructing the knockout vector are target 1: ggtgacgtacagaagggcgg and target 2: CGGAGAAGAGAATCCTCCTCTGG; then transferring the knockout vector into rice cells and integrating the rice cells into a chromosome, and screening cells, tissues or organs which successfully knock out the OsBGAL1 gene to regenerate plants.

Images