CN115806971A - Method for removing host of blood sample pathogen microorganism metagenome - Google Patents

Abstract

The invention belongs to the technical field of biology, and particularly relates to a method for extracting host-free nucleic acid aiming at a pathogenic microorganism metagenome in a blood sample. The method comprises the following steps: 1) Adding a saponin solution into the whole blood sample, and incubating twice at room temperature; 2) Adding NaCl solution for differential oscillation cracking, and centrifuging to enrich and precipitate; 3) Resuspending the precipitate obtained in the step 2), adding HL-SAN reaction Buffer and HL-SAN DNase at one time, and uniformly mixing and incubating; 4) Adding PBS, mixing, and performing double centrifugation to enrich and precipitate; 5) Resuspending and precipitating the lysate, and transferring the lysate into a lysine Matrix E tube for wall breaking by a wall breaking instrument; 6) After the wall breaking is finished, placing the mixture in a high-speed centrifuge, and centrifuging to collect supernatant; 7) The supernatant was subjected to DNA nucleic acid extraction.

Description

Method for removing host of blood sample pathogen microorganism metagenome

Technical Field

The application belongs to the technical field of in vitro diagnosis, and particularly relates to a method for removing a host of a metagenome of a pathogen microorganism in a blood sample.

Technical Field

Compared with the traditional culture identification method, the metagenome sequencing has the advantages of short period, wide coverage, simple operation and the like for detecting microbial pathogens. In the face of clinical identification of many unknown microbial infections, the advantage of complete coverage of metagenomic sequencing is more and more obvious. The infection of the patient is not often caused by single microorganism, and the relative abundance information among the microorganisms obtained by metagenome sequencing can provide a correct diagnosis and treatment scheme for a clinician and provide valuable data support.

Nanopore sequencing is a relatively quick and convenient metagenome research method at present, but in practice, the problem that clinical samples contain a large amount of host DNA can be faced.

Unlike clinical infection samples such as sputum and alveolar lavage fluid, sample processing and metagenomic testing of blood samples is more complex. About 7X 10 in whole blood ⁶ the/mL human cells directly use more than 90% of sequencing data obtained by three-generation target sequencing to be human sequences. How to remove the human DNA background efficiently and keep the microorganism in the sample solution to the maximum extentThe content of the substance and the improvement of the target enrichment efficiency and the detection sensitivity of pathogenic bacteria are the key points of the clinical pathogenic microorganism metagenome nanopore sequencing of the blood sample. The prior art does not have a very effective pretreatment method aiming at blood infection samples, and the application is provided based on the pretreatment method.

Disclosure of Invention

In order to solve the technical problems, the method for pretreating the blood sample is explored and optimized, so that an incomplete de-hosting method for the pathogenic microorganism metagenome in the blood sample is obtained. Effectively improves the detection rate of the metagenome pathogens of the blood specimen and ensures the detection sensitivity of the clinical metagenome pathogenic microorganisms.

The technical scheme adopted by the application is as follows:

the application provides a method for extracting the host-free nucleic acid of a pathogen microorganism metagenome of a blood sample, which comprises the following steps:

1) Adding a saponin solution into the whole blood sample, and incubating twice at room temperature;

2) Adding NaCl solution for differential oscillation cracking, and then centrifuging to enrich and precipitate;

3) Resuspending the precipitate in the step 2), adding HL-SAN reaction Buffer and HL-SAN DNase once, mixing uniformly and incubating;

4) Adding PBS, mixing, and performing double centrifugation to enrich and precipitate;

5) Resuspending the lysate, and transferring into a lysine Matrix E tube for wall breaking;

6) After the wall breaking is finished, placing the mixture in a high-speed centrifuge, and centrifuging to collect supernatant;

7) The supernatant was subjected to DNA nucleic acid extraction.

Further, the final concentration of the saponin in the step 1) is 0.1-0.2%;

preferably, the double incubation is: adding saponin solution into whole blood sample, incubating at room temperature for 5-10min, adding sterile water, and incubating for 0.5-1min.

Further, the final concentration of the NaCl solution in the step 2) is 0.15-0.2M; preferably, the centrifugation is: centrifuging at 12000-14000g for 3-5min with a high-speed centrifuge, and collecting the precipitate.

Further, the HL-SAN reaction Buffer composition in the step 3) comprises 2 to 2.5g/100ml MgCl ₂ And 29-30g/100ml NaCl; the final concentration of the HL-SAN DNase is 24-30U/ml.

Further, the step 3) is specifically: PBS resuspension step 2) precipitation, adding HL-SAN reaction Buffer and HL-SAN DNase at one time, mixing well, placing on a metal bath, and incubating for 10-15min at 35-40 ℃ under 800-1000 rpm.

Further, the step 4) specifically comprises: adding 0.8-1ml of PBS into the product after the reaction in the step 3), reversing and uniformly mixing, centrifuging for 3-5min at 12000-14000g, and enriching and precipitating; adding 0.8-1ml PBS again into the sediment to resuspend the sediment in the step 4), centrifuging for 3-5min at 12000-14000g, and enriching the sediment.

Further, in the step 5), the wall breaking instrument is a clean mail wall breaking instrument; the lysate is Zymo Lysis solution;

preferably, the step 5) is specifically: suspending the precipitate obtained in the step 4) by using a Zymo Lysis solution lysate, and transferring the precipitate into a lysine Matrix E tube for wall breaking by using a net signal wall breaking instrument; the wall breaking condition is 15-20m/s, and the bead beating is carried out for 30-120s.

Further, the step 6) specifically includes: and (4) placing the tube subjected to wall breaking in the step (5) in a high-speed centrifuge, centrifuging for 3-5min at 15000-17000g, and collecting supernatant.

Further, the step 7) specifically comprises:

a. adding protease K into the supernatant obtained in the step 6), uniformly mixing by vortex, and incubating for 10-15min at the temperature of 55-60 ℃ under the condition of 800-1000 rpm;

b. after instantaneous centrifugation, buffer BCL is added, mixed evenly and incubated for 3-5min at 70 ℃;

c. adding absolute ethyl alcohol after instantaneous centrifugation, transferring into an adsorption column, centrifuging at 10000-12000rpm for 1-2min, and discarding the filtrate;

d. adding Buffer WA into the adsorption column, centrifuging at 10000-12000rpm for 1-2min, and discarding the filtrate;

e. dividing into two times, respectively adding Buffer WB, centrifuging at 10000-12000rpm for 1-2min, and discarding the filtrate;

f. suspending the above solution in water without nuclease, dropping on the column membrane, standing at room temperature for 1-2min, and centrifuging at 10000-12000rpm for 1-2min to obtain nucleic acid.

Compared with the prior art, the beneficial technical effects of this application include at least:

according to the method, host nucleic acid interference is reduced by incomplete host removal, enrichment of microbial genomes is achieved under the condition that a subsequent on-machine library is built, the influence on pathogen DNA is minimized, and the pathogen detection rate and detection sensitivity of the blood sample are effectively improved.

The method system of the application has the advantages of various aspects, including: in the link of differential lysis host removal, the differential lysis of host cells by saponin and NaCl is adopted; in the process of removing host DNA, enzyme is used for digesting exposed DNA; in the step of breaking the walls of the microbial cells, the wall breaking of the cell walls of bacteria, fungi and the like is implemented by adopting a physical (glass bead mechanical wall breaking method) and chemical (lysate) combined wall breaking method.

In addition, under the framework of the flow path, the application carries out brand-new optimization on the use conditions of key components in the system, particularly on the aspect of the use concentration of saponin in the blood sample. In the past, saponin with higher concentration is often adopted in a host aiming at other types of infection samples, and the application tests the removal effect of the humanized background and the influence on microorganisms under different final concentrations of the saponin. Compared with the method without removing the host, the method has the advantages that the ratio of human sources to the total blood host background is obviously reduced by removing the total blood host background by using the final concentration of 0.1-0.2% saponin, the enrichment of microbial genomes is realized, the influence on the microbes is minimal, and the detection rate of the blood specimen metagenome pathogens is effectively improved.

Drawings

FIG. 1 the effect of different saponin concentrations on common blood microorganisms;

FIG. 2 shows the absorbance of the supernatant after treatment with different concentrations of saponin;

FIG. 3 shows the extraction concentration of the supernatant after different saponin concentration treatments;

FIG. 4 shows the number of cells remaining after the treatment with different concentrations of saponin;

FIG. 5 shows the concentrations of extracted nucleic acids after host removal for different saponin concentrations;

FIG. 6 shows the content of human origin determined by qPCR after elimination of the host at different saponin concentrations;

FIG. 7 shows the ratio of non-host to host at different saponin concentrations;

FIG. 8 shows the detection of target bacteria after host removal of different saponin concentrations;

FIG. 9 is a case of human-based proportion of non-host-deprived versus host-deprived.

Detailed Description

Embodiments of the present application will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present application and should not be construed as limiting the scope of the present application. The examples, in which specific conditions are not specified, were carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by manufacturers, and are all conventional products available on the market.

Definitions of some terms, unless defined otherwise below, all technical and scientific terms used in the detailed description of the present application are intended to have the same meaning as commonly understood by one of ordinary skill in the art. While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to better explain the present application.

The term "about" in the present application denotes an interval of accuracy that can be understood by a person skilled in the art, which still guarantees the technical effect of the feature in question. The term generally denotes a deviation of ± 10%, preferably ± 5%, from the indicated value.

As used in this application, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude additional unrecited elements or method steps. The term "consisting of 8230A" is considered to be a preferred embodiment of the term "comprising". If in the following a certain group is defined to comprise at least a certain number of embodiments, this should also be understood as disclosing a group which preferably only consists of these embodiments.

Furthermore, the terms first, second, third, (a), (b), (c), and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments described herein are capable of operation in other sequences than described or illustrated herein.

The method for extracting the de-hosting nucleic acid of the metagenome of the pathogenic microorganism of the blood sample generally comprises the following steps:

1) Adding a saponin solution into the whole blood sample, and incubating twice at room temperature;

2) Adding NaCl solution for differential oscillation cracking, and then centrifuging to enrich and precipitate;

3) Resuspending the precipitate in the step 2), adding HL-SAN reaction Buffer and HL-SAN DNase once, mixing uniformly and incubating;

4) Adding PBS, mixing, and performing double centrifugation to enrich and precipitate;

5) Resuspending the lysate, and transferring into a lysine Matrix E tube for wall breaking;

6) After the wall breaking is finished, placing the mixture in a high-speed centrifuge, and centrifuging to collect supernatant;

7) The supernatant was subjected to DNA nucleic acid extraction.

In some embodiments, the final concentration of saponin in step 1) is 0.1-0.2%; in some embodiments, the two incubations are: adding saponin solution into whole blood sample, incubating at room temperature for 5-10min, adding sterile water, and incubating for 0.5-1min.

In some embodiments, the final concentration of the NaCl solution in step 2) is 0.15 to 0.2M; in some embodiments, the centrifugation is: centrifuging at 12000-14000g for 3-5min in a high-speed centrifuge to collect the precipitate.

In some embodiments, the HL-SAN reaction Buffer composition in step 3) comprises 2 to 2.5g/100ml MgCl ₂ And 29-30g/100ml NaCl; the final concentration of the HL-SAN DNase is 24-30U/ml. In some preferred embodiments, the step 3) is specifically: PBS resuspension step 2) precipitationAdding HL-SAN reaction Buffer and HL-SAN DNase at one time, fully and uniformly mixing, placing on a metal bath, and incubating for 10-15min at 35-40 ℃ under 800-1000 rpm.

In some embodiments, the step 4) is specifically: adding 0.8-1ml of PBS into the reaction finished product in the step 3), reversing, uniformly mixing, centrifuging for 3-5min at 12000-14000g, and enriching and precipitating; adding 0.8-1ml PBS again to the sediment to resuspend the sediment in the step 4), centrifuging at 12000-14000g for 3-5min, and enriching the sediment.

In some embodiments, in step 5), the wall-breaking instrument is a net-mail wall-breaking instrument; the lysate is Zymo Lysis solution; in some preferred embodiments, the step 5) is specifically: suspending the precipitate obtained in the step 4) by using a Zymo Lysis solution lysate, and transferring the precipitate into a lysine Matrix E tube for wall breaking by using a net signal wall breaking instrument; the wall breaking condition is 15-20m/s, and the bead beating is carried out for 30-120s.

In some embodiments, the step 6) is specifically: placing the tube subjected to wall breaking in the step 5) in a high-speed centrifuge, centrifuging for 3-5min at 15000-17000g, and collecting supernatant.

In some embodiments, step 7) is specifically:

a. adding protease K into the supernatant obtained in the step 6), uniformly mixing by vortex, and incubating for 10-15min at 55-60 ℃ under the condition of 800-1000 rpm;

b. after instantaneous centrifugation, adding Buffer BCL, mixing uniformly, and incubating at 70 ℃ for 3-5min;

c. adding absolute ethyl alcohol after instantaneous centrifugation, transferring into an adsorption column, centrifuging at 10000-12000rpm for 1-2min, and discarding the filtrate;

d. adding Buffer WA into the adsorption column, centrifuging at 10000-12000rpm for 1-2min, and discarding the filtrate;

e. dividing into two times, respectively adding Buffer WB, centrifuging at 10000-12000rpm for 1-2min, and discarding the filtrate;

f. suspending the above solution in water without nuclease, dropping on the column membrane, standing at room temperature for 1-2min, and centrifuging at 10000-12000rpm for 1-2min to obtain nucleic acid.

The application is illustrated below with reference to specific examples.

Example 1 establishment of the basic methodology of the present application

Optimization example 1, saponin and NaCl differential lysis optimization

The method has the advantages of efficiently removing the human DNA background, maximally retaining the microbial content in the sample solution, improving the target enrichment efficiency and detection sensitivity of pathogenic bacteria, and being the key for clinical pathogenic microorganism detection of blood samples. The application discusses the removal effect of the human background in the blood sample by the differential cracking method of saponin and NaCl.

The specific method comprises the following steps:

1) Selecting a whole blood sample of a normal person as a test object;

2) Fully and uniformly mixing the samples, and taking the average volume of 2 equal parts;

3) Centrifuging at 12000-14000g for 3-5min in a high-speed centrifuge, and collecting precipitate;

4) The steps are determined after optimization:

PBS resuspension was supplemented to 1 pellet from the same sample. Adding prepared saponin solution, incubating at room temperature for 10-15min, adding nuclease-free water and NaCl solution, centrifuging at high speed at 12000-14000g for 3-5min, and collecting precipitate; after the PBS is supplemented into the other precipitate for re-suspension, directly carrying out wall breaking operation of the subsequent step 8);

5) Supplementing PBS in the precipitate in the step 4) for resuspension, adding HL-SAN buffer and HL-SAN enzyme, fully and uniformly mixing, and reacting for 10-15min at 35-40 ℃ and 800-1000rpm on a metal bath;

6) Supplementing PBS solution into the reaction product in the step 5), centrifuging at 12000-14000g for 3-5min by a high-speed centrifuge, collecting the precipitate, and repeating the step for 1 time;

7) Supplementing PBS in the precipitate in the step 6) for resuspension;

8) Transferring the heavy suspension into a wall breaking pipe, and performing wall breaking treatment by using a wall breaking instrument;

9) Placing the wall-broken product in a high speed centrifuge, and centrifuging at 15000-17000g for 3-5min;

10 Absorbing 300-400ul of supernatant fluid to extract nucleic acid according to the flow of the finished product kit;

11 Carrying out Qubit quantification on the extracted nucleic acid, and determining the concentration;

12 Extracted nucleic acids for pedestrian QPCR validation;

wherein, human _ F (5 '-3'): TGAAGCCGTGGAAGG;

wherein, human _ R (5 '-3'): ACAAGAGAGCCAAGTGTCG;

wherein, human _ Probe (5 'FAM-3' BHQ): TACCACGTCCATCTTTGATGGCTCCTAT

The specific optimization result is shown in the table below, and through comparison between host removal and non-host removal, the method can effectively remove the human nucleic acid in the whole blood sample by adopting a saponin and NaCl differential cracking method, and can maximally retain the content of microorganisms in the sample solution.

Optimization example 2 optimization of nucleic acid extraction stage

In the process of extracting nucleic acid, the efficient lysate can effectively lyse cells to release intracellular nucleic acid, and the application correspondingly explores and tests the extraction effect under different lysates.

The method comprises the following specific steps:

1) Selecting a clinical whole blood sample as a test target;

2) Fully and uniformly mixing the samples, and taking the average volume of 6 equal parts;

3) Centrifuging at 12000-14000g for 3-5min in a high-speed centrifuge, and collecting precipitate;

4) Adding 500-600ul PBS heavy suspension precipitate into 3 precipitates of the same strain as a control group, and adding the same amount of ZYMO Lysis solution heavy suspension precipitate into the other 3 precipitates in parallel as an experimental group;

5) Transferring the heavy suspension obtained in the step 5) into a wall breaking pipe, and performing wall breaking treatment by using a wall breaking instrument;

6) Placing the wall-broken product in a high-speed centrifuge, and centrifuging at 15000-17000g for 3-5min;

7) Sucking 300-400ul of supernatant fluid to extract nucleic acid according to the flow of the finished product kit;

8) Carrying out Qubit quantification on the extracted nucleic acid, and determining the concentration;

the results are shown in the following table, and compared with the traditional control group reagent, the yield of nucleic acid extraction is obviously improved after the lysine solution is added by screening of the experimental group. The process confirms that the precipitation is resuspended and the subsequent wall breaking is carried out by using ZYMO Lysis solution (D4300-1-40/D4300-1-150) after the host is not completely removed.

Optimization example 3, wall breaking Link optimization

In order to improve the cell wall breaking efficiency and the nucleic acid yield, in the cell wall breaking link, a physical (glass bead mechanical wall breaking method) and chemical (lysate) combined wall breaking method is adopted, the type of a wall breaking instrument is optimized and screened, different wall breaking conditions are set to determine the yield of nucleic acid extraction, and the MP wall breaking condition is used as a control group.

The method comprises the following specific steps:

1) Selecting staphylococcus aureus, escherichia coli and candida albicans as test strains;

2) Uniformly mixing the cultured strains, averaging 15 equal volumes, and repeating each condition for 3 times;

3) Centrifuging at 12000-14000g for 3-5min in a high-speed centrifuge, and collecting precipitate;

4) 500-600ul PBS heavy suspension precipitation, and transfer into the broken wall tube;

5) Breaking the cell wall of 3 samples of the control group by using an MP cell wall breaking instrument; wherein the wall breaking condition is 5-6m/s, and the wall breaking time is 140-420s;

6) Repeating the rest 12 samples in each 3 parts, and breaking the cell wall by using a net envelope wall breaking instrument; wherein, the wall breaking condition is set to be 15-20m/s; the wall breaking time is respectively 20s, 30s, 120s and 300s;

7) Centrifuging the wall-broken product obtained in the steps 5) and 6) at a high speed for 3-5min at 15000-17000 g;

8) Sucking 300-400ul of supernatant fluid to extract nucleic acid according to the flow of the finished product kit;

9) QPCR validation of the extracted nucleic acids against staphylococcus aureus, escherichia coli and candida albicans, respectively:

wherein the primer Forward primer sequence of the staphylococcus aureus is ACTGTAACTTTGGCACTGG;

wherein the primer Reverse primer sequence of the staphylococcus aureus is GCAGATACCTCATTACTTACCTGC;

wherein the primer Forward primer sequence of the Escherichia coli is CGATAATCGCCAGATGGC;

wherein the primer Reverse primer sequence of the Escherichia coli is CCTAAGTTGCAGGAGATGG;

wherein the primer Forward primer sequence of the Candida albicans is GGGTTTGCTTGAAAGACGGTA;

wherein the primer Reverse primer sequence of the Candida albicans is TTGAAGATATACGTGGTGGACGTTA;

the comparison results of the QPCR of the extracted nucleic acids under different wall-breaking conditions are shown in the following table, and it can be seen that, compared with the conditions of the control group, the QPCR results of 3 bacteria are at the same level as the test group under the conditions of 30s and 120s in the test group. The process of the application determines that the wall breaking condition of the net information is 30-120S, and the optimal condition is 30S.

Experimental example and establishment of basic method System of the present application

Through the exploration and optimization of the above aspects, the application determines the basic method system as follows:

the extraction method of the blood pathogenic microorganism metagenome removal host nucleic acid comprises the following steps:

s1, pretreatment of a sample: the sample is inverted and mixed evenly, and then blood is sucked and placed in a centrifuge tube;

s2, differential lysis to remove the host: adding saponin solution for incubation, and adding sterile water for incubation again; adding NaCl, shaking uniformly, centrifuging, discarding the supernatant, and resuspending in a PBS solution;

specifically, the method comprises the following steps:

s21, adding a blood sample (0.8-1.2 mL) into a saponin solution, shaking and uniformly mixing, and incubating at room temperature for 10-15min;

s22, performing instantaneous centrifugation after incubation is finished, adding nuclease-free water, quickly reversing and uniformly mixing, and incubating at room temperature for 30-60S;

s23, immediately adding MNaCl solution with the final concentration of 0.15-0.2, and reversing and uniformly mixing;

s24, centrifuging at 12000-14000g for 3-5min, removing supernatant, and then suspending the precipitate in 150-250ul PBS.

S3, removing host DNA: s3, removing host DNA: adding 150-250 mu LHL-SAN buffer and 5-10 mu L HL-SAN DNase into the solution obtained in the S2 at one time, and incubating for 10-15min at 35-40 ℃ and 800-1000rpm in a constant-temperature oscillation metal bath; the HL-SAN buffer is a self-prepared reagent comprising about 5.5M NaCl and 100mM MgCl ₂ The final concentration of the HL-SAN DNase is 24-30U/ml.

S4, cleaning: adding 800-1000 μ L PBS, mixing, centrifuging at 12000-14000g for 3-5min, and removing supernatant; repeating the steps again;

s5, breaking the walls of microbial thalli: performing wall breaking treatment on the solution obtained in the step S4 by using an MP wall breaking instrument and a lysate;

specifically, the method comprises the following steps:

s51, removing the supernatant, and adding 400-500 mu L of Zymo Lysis solution for resuspension;

s52, transferring the sample into a lysine Matrix E tube, performing bead beating for 30-120s under the condition of a clean signal wall breaking instrument of 15-20m/S, centrifuging for 3-5min at 15000-17000g, and collecting 150-250 mu L of liquid;

s6, nucleic acid extraction: and (3) carrying out DNA extraction and purification on the solution obtained in the step (S5) by adopting a commercial nucleic acid extraction kit, and detecting the quality.

Example 2 analytical optimization of the lysis of Saponin concentration in blood samples

In order to test the most reasonable use concentration of saponin in the system, the application comprehensively tests the influence of different saponin concentrations on microorganisms and human cells in blood samples.

2.1 testing the effect of different saponin concentrations on common microorganisms in blood samples.

2.1.1 species of selected microorganism: staphylococcus aureus (Staphylococcus aureus, ATCC BAA 1747), escherichia coli (Escherichia coli, ATCC 43888), pseudomonas aeruginosa (Pseudomonas aeruginosa, ATCC 27853), enterobacter cloacae (ATCC 13047), klebsiella pneumoniae (Klebsiella pneumoniae, ATCC BAA-1705), candida Albicans (ATCC 10231).

2.1.2 cultivation of microorganisms:

2.1.2.1 dipping a small amount of the bacterial liquid in an air-dried chocolate flat plate for scribing;

2.1.2.2 sealing the marked flat plate with a sealing film, putting the sealed flat plate into an incubator, and culturing at 37 ℃ overnight for 15h;

2.1.2.3 picking single colony after the colony grows well, and performing recovery culture in a liquid culture medium BHI for 3-5h;

2.1.2.4 taking 50-100 mu L of the suspension to be cultured in 1mL of a new liquid culture medium BHI overnight for 15h;

2.1.3 setting of final concentration gradient of saponin: 1%,0.5%,0.05% and control PBS;

2.1.4 Experimental flow: the cultured bacteria were diluted 10-fold and 100-fold, respectively. Respectively taking 100 μ L of each diluted bacterium, adding 20 μ L of prepared saponin solution, and incubating at room temperature for 10min.10000g for 10min, and taking the supernatant to determine the nucleic acid concentration by using the Qubit4.0 (Invitrogen). Each final saponin concentration of each bacterium was replicated 3 times.

2.1.5 the results of the experiment are shown in FIG. 1, and it can be seen that the final concentration of saponin increases to affect the bacteria more seriously and different bacteria react to saponin differently, regardless of the concentration and species of bacteria. Within the range of 0.05-0.5%, the effect on the test pathogens is relatively small.

2.2 testing the effect of different saponin concentrations on human cells in blood samples.

2.2.1 setting of final concentration gradient of saponin: 0.5%,0.1%,0.05%,0.0125% and the control, nucleic acid-Free Water (nuclear-Free Water);

2.2.2 Experimental procedure:

taking 100-150 μ L of normal human whole blood, centrifuging at 3000-4000rpm for 10-15min, and removing supernatant. PBS was supplemented to 100-150. Mu.L. Adding prepared saponin solution, and incubating at room temperature for 10-15min. Centrifuging at 8000-10000g for 5-10min, collecting supernatant, and measuring absorbance, hemoglobin (Hb) and O ₂ Binding to generate oxygenated hemoglobin (HbO) ₂ ) And combines with CO to generate carboxyhemoglobin (HbCO), wherein 414nm is a characteristic absorption peak of hemoglobin, 540nm is a characteristic absorption peak of carboxyhemoglobin, and 576nm is a characteristic absorption peak of oxyhemoglobin. In addition, 100. Mu.L of the supernatant was extracted using DP316 extraction kit (Tiangen), and the extracted Qubit value was determined. In addition, the pellet was resuspended in 1mL of PBS and the number of normal unbroken cells per unit volume was counted using a biomicroscope (Olympus, CX23LEDRFS 1C) to calculate the number of cells remaining after saponin treatment. Each treatment was performed in triplicate.

2.2.3 results of the experiment

FIG. 2 shows the absorbance of the supernatant after treatment with different concentrations of saponin; FIG. 3 shows the concentrations of the supernatant after different saponin concentration treatments; FIG. 4 shows the number of cells remaining after treatment with different concentrations of saponin.

It can be seen that the greater the amount of hemoglobin released in the supernatant with the increase in the concentration of saponin, the higher the haemolysis of the blood (figure 2); the statistical results of fig. 3 and 4 also confirm this conclusion.

Most of nucleic acid extracted from a blood sample comes from human sources, and in order to meet the requirements of subsequent library establishment and realization of the conditions of reducing host nucleic acid interference, realizing the enrichment of microbial genomes and minimizing the influence on pathogen DNA under the conditions of subsequent library establishment, the final concentration of saponin is preliminarily set to be between 0.1 and 0.5 percent.

2.3 the effect of different saponin concentration treatments on mixed bacterial human cells in blood was tested using qPCR.

2.3.1 species of selected microorganism: staphylococcus aureus (Staphylococcus aureus, ATCC BAA 1747), escherichia coli (Escherichia coli, ATCC 43888), pseudomonas aeruginosa (ATCC 27853), enterobacter cloacae (ATCC 13047), klebsiella pneumoniae (Klebsiella pneumoniae, ATCC BAA-1705), candida Albicans (ATCC 10231), streptococcus pyogenes (Streptococcus pyogenes, ATCC 19615).

2.3.2 cultivation of microorganisms: same as 2.1.2

2.3.3 setting final concentration gradient of saponin: 0.1 percent and 0.2 percent; the control was extracted directly without going through a host removal procedure.

2.3.4 human qPCR primers:

Human_F(5’-3’)：TGAAGCCGTGCGGAAGG；

Human_R(5’-3’)：ACAAGAGAGCCAAGTGTCG；

Human_Probe(5’FAM-3’BHQ)：TACCACGTCATCTCCTTTGATGGCTCCTAT

2.3.5 Experimental procedure:

each 200. Mu.L of blood was individually inoculated with 7 kinds of bacteria (100 cfu/mL) and one negative control (immiscible bacteria), and subjected to both off-host and off-host operations at different saponin concentrations, followed by simultaneous extraction with DP 316. The host removal procedure is the same as described above. After extraction, the nucleic acid concentration is determined by using the Qubit4.0, and meanwhile, five groups of extracted nucleic acids are selected to determine the human content by using the human probe primer qPCR.

2.3.6 results of the experiment

FIG. 5 shows the concentrations of extracted nucleic acids after being subjected to host removal at different saponin concentrations, and FIG. 6 shows the content of human origin determined by qPCR after being subjected to host removal at different saponin concentrations.

It can be seen that, aiming at different participating bacteria, the final concentrations of the saponin of 0.2 percent and 0.1 percent can obviously reduce the interference of host nucleic acid, and the enrichment of microbial genomes is realized under the condition of meeting the requirement of subsequent on-machine library construction. The final concentration of saponin 0.2% is about 0.2% of the same volume treated relative to the non-host. The final concentration of saponin 0.1% is about 5% of the same volume treated relative to the non-host.

2.4 three-generation on-machine testing was performed on mixed bacteria blood samples treated with 0.2% saponin and 0.1% saponin at final concentrations to the host.

2.4.1 species of selected microorganisms: staphylococcus aureus (Staphylococcus aureus, ATCC BAA 1747), escherichia coli (Escherichia coli, ATCC 43888), klebsiella pneumoniae (Klebsiella pneumoniae, ATCC BAA-1705), pseudomonas aeruginosa (Pseudomonas aeruginosa, ATCC 27853), enterobacter cloacae (Enterobacter cloacae, ATCC 13047), streptococcus pyogenes (Streptococcus pyogenes, ATCC 19615);

2.4.2 culture of microorganisms: the same as 2.1.2.

2.4.3 setting of final concentration gradient of saponin: 0.1 percent and 0.2 percent;

2.4.4 Experimental protocol:

mixing the above 6 bacteria (50-100 cfu/mL each) with 0.8-1.2mL of blood, performing dereliation and non-dereliation under different saponin concentrations, and extracting with Tiangen minigenome extraction kit. And (4) establishing a library and computer-installing by using an SQK-PBK004 kit of an ONT manufacturer. The host removal process is the same as above;

2.4.5 results of the experiment:

FIG. 7 shows the ratio of non-host bacteria after removal of host cells with different saponin concentrations, and FIG. 8 shows the detection of target bacteria after removal of host cells with different saponin concentrations.

Therefore, the treatment of the final concentration of 0.1 percent and 0.2 percent of saponin can improve the non-host reads after the machine is operated, and the detection of 6 added bacteria is enhanced. The process of the application finally determines that the final concentration of the saponin in the blood sample is 0.1-0.2%.

Example 3 clinical sample testing

By adopting the flow confirmed by the application, the incomplete host-removing performance test of the clinical sample is carried out.

Performing incomplete host removal and nucleic acid extraction treatment on a clinical sample according to the flow confirmed by the application, and taking the incomplete host removal as a reference; and (3) building a library and computer by using an SQK-PBK004 quick library building kit of the ONT. Comparing the human reads proportion of the two clinical samples.

As a result, as shown in FIG. 9, it can be seen that the host nucleic acid was mostly removed by the present protocol above 90%, and the detected results were consistent with those of the medium, and strains that could not be detected by the partial culture could also be identified by the present invention. Therefore, the method can realize effective enrichment of microbial genomes under the condition of meeting the requirement of on-machine library construction, and simultaneously reduces the influence on pathogen DNA to the minimum.

Finally, it should be noted that: the above embodiments are only used for illustrating the technical solutions of the present application, and not for limiting the same; although the present application has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art will understand that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present application.

Claims (10)

1. A method for extracting a decolonization nucleic acid of a metagenome of a pathogenic microorganism aiming at a blood sample is characterized by comprising the following steps:

1) Adding saponin solution into the whole blood sample, and incubating twice at room temperature;

2) Adding NaCl solution for differential vibration cracking, and centrifuging to enrich and precipitate;

3) Resuspending the precipitate in the step 2), adding HL-SAN reaction Buffer and HL-SAN DNase at one time, mixing uniformly and incubating;

4) Adding PBS, mixing, and performing double centrifugation to enrich and precipitate;

5) Resuspending and precipitating the lysate, and transferring the lysate into a lysine Matrix E tube for wall breaking by a wall breaking instrument;

6) After the wall breaking is finished, placing the mixture in a high-speed centrifuge, and centrifuging to collect supernatant;

7) The supernatant was subjected to DNA nucleic acid extraction.

2. The method of claim 1, wherein the final saponin concentration in step 1) is 0.1-0.2%.

3. The method according to any one of claims 1-2, wherein in step 1), the double incubation is: adding saponin solution into whole blood sample, incubating at room temperature for 5-10min, adding sterile water, and incubating for 0.5-1min.

4. The method according to any one of claims 1 to 3, wherein the final concentration of the NaCl solution in step 2) is 0.15-0.2M; preferably, the centrifugation is: centrifuging at 12000-14000g for 3-5min with a high-speed centrifuge, and collecting the precipitate.

5. The process according to any one of claims 1 to 4, wherein the HL-SAN reaction Buffer composition in step 3) comprises 2 to 2.5g/100ml MgCl ₂ And 29-30g/100ml NaCl; the final concentration of the HL-SAN DNase is 24-30U/ml.

6. The method according to any one of claims 1 to 5, wherein step 3) is in particular: and (3) resuspending the precipitate in the step 2) by PBS, adding HL-SAN reaction Buffer and HL-SAN DNase at one time, fully and uniformly mixing, placing on a metal bath, and incubating for 10-15min at 35-40 ℃ under 800-1000 rpm.

7. The method according to any one of claims 1 to 6, wherein step 4) is in particular: adding 0.8-1ml of PBS into the reaction finished product in the step 3), reversing, uniformly mixing, centrifuging for 3-5min at 12000-14000g, and enriching and precipitating; adding 0.8-1ml PBS again into the precipitate for resuspension, and centrifuging at 12000-14000g for 3-5min to enrich the precipitate.

8. The method according to any one of claims 1 to 7, wherein in step 5), the lysate is Zymo Lysis solution;

preferably, the step 5) is specifically: suspending the precipitate obtained in the step 4) by using a Zymo Lysis solution lysate, and transferring the precipitate into a lysine Matrix E tube for wall breaking by using a net signal wall breaking instrument; the wall breaking condition is 15-20m/s, and the bead beating is carried out for 30-120s.

9. The method according to any one of claims 1 to 8, wherein step 6) is in particular: and (5) placing the tube subjected to wall breaking in the step 5) in a high-speed centrifuge, centrifuging for 3-5min at 15000-17000g, and collecting supernatant.

10. The method according to any one of claims 1 to 9, wherein step 7) is in particular:

a. adding protease K into the supernatant obtained in the step 6), uniformly mixing by vortex, and incubating for 10-15min at 55-60 ℃ under the condition of 800-1000 rpm;

b. after instantaneous centrifugation, buffer BCL is added, mixed evenly and incubated for 3-5min at 70 ℃;

c. adding anhydrous ethanol after instantaneous centrifugation, transferring into an adsorption column, centrifuging at 10000-12000rpm for 1-2min, and removing the filtrate;

d. adding Buffer WA into the adsorption column, centrifuging at 10000-12000rpm for 1-2min, and discarding the filtrate;

e. dividing into two times, respectively adding Buffer WB, centrifuging at 10000-12000rpm for 1-2min, and discarding the filtrate;

f. suspending the above solution in water without nuclease, dropping on the column membrane, standing at room temperature for 1-2min, and centrifuging at 10000-12000rpm for 1-2min to obtain nucleic acid.

Images