CN115786535A

CN115786535A - Probe primer and probe for marking spinal tail white shrimp gill nephrogenic cells and application

Info

Publication number: CN115786535A
Application number: CN202211244396.5A
Authority: CN
Inventors: 葛倩倩; 李健; 李吉涛; 王佳佳
Original assignee: Yellow Sea Fisheries Research Institute Chinese Academy of Fishery Sciences; Qingdao National Laboratory for Marine Science and Technology Development Center
Current assignee: Yellow Sea Fisheries Research Institute Chinese Academy of Fishery Sciences; Qingdao National Laboratory for Marine Science and Technology Development Center
Priority date: 2022-10-12
Filing date: 2022-10-12
Publication date: 2023-03-14

Abstract

The invention relates to a probe primer for marking palaemon carinicauda branchia nephrogenic cells, a probe and application, and belongs to the technical field of aquatic organisms. The invention also provides a kit for marking the branchial nephrogenic cells of palaemon carinicauda, which comprises the RNA probe. The invention also provides application of the RNA probe in marking the branchia nephrogenic cells of the palaemon carinicauda. The method positions the nephrogenic cells of the spinal tail white shrimp gill tissue by the fluorescence in situ hybridization of the NAR6 gene, and provides theoretical and technical support for exploring the function of the nephrogenic cells and cell separation culture research.

Description

Probe primer and probe for marking gill nephrogenic cells of palaemon carinicauda and application of probe primer and probe

Technical Field

The invention belongs to the technical field of aquatic organisms, and particularly relates to a probe primer and a probe for marking branchia nephrogenic cells of exopalaemon carinicauda and application of the probe primer and the probe.

Background

The branchia of the crustacean is directly contacted with a water body, is an important organ for breathing, excretion, osmotic pressure regulation and ion exchange, is easily affected by the environment and invaded by pathogens, can remarkably change in the process of adapting to the external complex environment, and is an important component in the process of establishing the adaptability of the crustacean. Therefore, the detailed morphological structure and cell classification of the branchia of the crustacean are clear, which are important bases for analyzing the complex physiological functions of the crustacean and are beneficial to further understanding the influence of the environment and diseases on the crustacean. Wherein, according to different amplification degrees of the branchia surface, the crustacean branchia is divided into leaf branchia, branch branchia and filiform branchia. The branchia of shrimps belongs to a branch branchia, and the branchia shaft carries two rows of bent branchia sheets which are subdivided into a plurality of branchia small sheets. The gills of crayfish and lobster belong to filiform gills, and the gill axis generates a large number of tubular filaments which are transversely arranged. The branchia of brachyury, true shrimp and partial askew belong to leaf branchia, and leaf branchial sheets are distributed on two sides of the flat central axis. Although the classification is carried out according to the appearance characteristics, the method is restricted, and no conclusion is made on the specific morphological and structural characteristics of the branchia of the crustacean, such as cell composition and corresponding functions.

The Exopalaemon carinicauda belongs to the order of ten-legged, true shrimps, brachiocephalidae and white shrimps, and the branchia of the Exopalaemon carinicauda belongs to typical leaf gills, has strong environmental adaptability, has wide tolerance range on environmental stress factors which obviously influence the homeostasis such as salinity, alkalinity, pH, ammonia nitrogen and the like, and is a good experimental material for researching the morphological structure and the function of the leaf gills of crustaceans. According to the existing research reports, the cell types of the leaf gill mainly comprise column cells, septal cells, sessile blood cells, nephrogenic cells and the like, and certain researches on the cell localization, functions and cell marker genes of the column cells, the septal cells and the sessile blood cells have been carried out at present. The column cells, i.e. epithelial cells, are distributed below the gill platelet cuticle and often appear in pairs, the basal side contains a large number of microtubules, the top plasma membrane part contains a large number of mitochondria, which mainly play roles in supporting and ion transporting,there are studies showing that V-H ⁺ The ATPase, carbonic anhydrase plasma transporter gene is its marker gene. The septal cell is usually located between a pair of columnar cells and contains a plurality of mitochondria, golgi apparatus, rough endoplasmic reticulum and the like, and research shows that Na ⁺ /K ⁺ ATPase is a marker gene for it. The sessile blood cells exist in the blood lymph space of the gill tissue, play an immune role in the gill similarly to blood cells, and are presumed to be common blood cell marker genes such as prophenoloxidase, lectin and the like. At present, few researches on crustacean branchial nephrogenic cells are carried out, and researches report that the crustacean branchial nephrogenic cells are similar to podocytes of other tissues, podocytes in insect blood sinuses and podocytes of kidney glomeruli of vertebrates and have an excretion function, but the functions of the crustacean branchial nephrogenic cells are to be further verified due to unknown marker genes and unknown cell positioning.

It is worth noting that in the early stage, by means of a single-cell transcriptome sequencing technology, the proportion of the palaemon carinicauda nephroblasts is obviously increased after alkalinity stress, and partial cells are converted into ion transport functions, so that the nephrocytoma is a cell type playing a key role in responding to the alkalinity stress. Based on single cell transcriptome sequencing, some genes with specific high expression in nephrogenic cells are obtained, wherein the expression of the neuronic acetylcholinergic receptor subunit alpha-6 (NAR 6) gene is most remarkable. Therefore, the probe is designed by utilizing the kidney protocell marker gene, the distribution of the kidney protocells is determined, and a foundation is provided for researching the kidney protocell in vitro culture and a key molecular mechanism of the kidney protocell in response to environmental stress in the future.

Disclosure of Invention

The invention aims to solve the technical problem of providing a probe primer for marking the branchia nephrogenic cells of palaemon carinicauda, a probe and application, namely, the probe primer is designed on an NAR6 gene sequence specifically expressed on the branchia nephrogenic cells of palaemon carinicauda by using a fluorescence in-situ hybridization technology, the probe is prepared, and the branchia nephrogenic cells of palaemon carinicauda are positioned.

The invention is realized by the following technical scheme:

the invention provides a probe primer for marking palaemon carinicauda branchia nephrogenic cells, which has the following sequence:

F:5’-tggaccacttcggagaaaacc-，3’

R:’-taatacgactcactatagggtaagagattcggggggtg-3', the T7 promoter sequence is underlined.

The invention also provides an RNA probe for marking the palaemon carinicauda branchia nephrogenic cells, and the sequence of the RNA probe is shown as SEQ.ID NO 3.

The invention also provides a kit for positioning the branchia nephrogenic cells of palaemon carinicauda, which comprises the RNA probe.

The preparation method of the RNA probe comprises the following steps:

1) Synthetic carincaeus carinata NAR6 gene linearization template

2) In a 0.2ml centrifuge tube, 1. Mu.g of linearized template, 1. Mu.l of Fluorescein-NTP, 2. Mu.l of 5 XBuffer, 0.5. Mu.l of 10U RNase I, 1. Mu.l of T7 polymerase, H ₂ The samples were sequentially added with O to 10. Mu.l.

3) The product was placed in a 37 ℃ water bath for 2h.

4) After a water bath, 2. Mu.l DNase I and 18. Mu.l DEPC H were added to the product ₂ O, water bath at 37 ℃ for 15min.

5) The RNA probe was purified after water bath and stored at-80 ℃.

The invention also provides an application of the RNA probe in marking the branchia nephrogenic cells of palaemon carinicauda, which comprises the following specific steps:

1) Taking palaemon carinicauda gill tissue, rinsing with PBS, fixing in a 4-percent PFA RNA-free centrifuge tube, and storing at 4 ℃ overnight;

2) Washing the fixed sample by PBS, settling and dehydrating in 30% sucrose solution, standing overnight at 4 ℃, and then putting the sample into a frozen section embedding medium OCT to freeze at-80 ℃;

3) Making a gill tissue frozen section of the sample in a freezing microtome;

4) Washing the slices of step 3) with PBS after 4% PFA fixation;

5) Preparing a hybridization solution, adding a palaemon carinicauda NAR6 RNA probe for hybridization after prehybridization, wherein the final concentration of the probe is 1 mu g/ml, and incubating overnight at 70 ℃;

6) After overnight incubation in the step 5), washing with wash solution, TNT, glycine-HCl and TNT;

7) Incubating for 2-3h with blocking solution at room temperature, adding anti-fluoroesein-POD, and incubating overnight at 4 deg.C;

8) The section in the step 7) is washed by TNT, and is added with Try-Cy3 dye to be incubated for 10-20min at 37 ℃;

9) Staining nuclei with DAPI, adding anti-quencher, and mounting. And finally, observing a fluorescent staining result under a laser confocal microscope to realize the expression positioning of the NAR6 gene of the palaemon carinicauda at the mRNA level, thereby realizing the positioning of the gill nephrogenic cells of the palaemon carinicauda.

Further, the hybridization solution in the step 5) is prepared by using 25ml of Formamide, 20 XSSC 10ml, dextran sulfate 5g and 50 XDenhardt's 1ml, and adding RNase-free water to a constant volume of 50ml;

further, the prehybridization in the step 5) is carried out at 68-70 ℃ for 15min after adding the hybridization solution.

Further, wash solution in the step 6) is prepared by 20 XSSC 10ml, formamide 100ml,20% Tween 20.5 ml, adding RNase-free water to a volume of 200ml;

the TNT in step 6) was prepared by 100ml of 1M Tris-HCl (pH7.5), 30ml of 5M NaCl, 20% Tween 20, and adding RNase-free water to a constant volume of 1L.

The preparation method of the Glycine-HCl in the step 6) is that 7.5g of Glycine is added with water to 1L, and concentrated HCl is dripped to adjust the pH value to 2.0;

the preparation method of the blocking solution in the step 7) is that goat serum with the volume ratio of 2% and 2mg/ml BSA are added into TNT;

compared with the prior art, the invention has the beneficial effects that:

the method positions the nephrogenic cells of the palaemon carinicauda gill tissue by the fluorescent in-situ hybridization of the NAR6 gene, provides theoretical and technical support for exploring the function of the nephrogenic cells and research on cell separation culture, and is favorable for further researching the saline-alkali adaptation mechanism of the palaemon carinicauda; in addition, the invention has certain application reference in gene positioning and function research of in-situ hybridization of branchia tissues of other crustaceans.

Drawings

FIG. 1 is a schematic view of HE staining of paraffin sections of gill nephrogenic cells of palaemon carinicauda according to example 1 of the present invention, and the nephrogenic cells are shown by black arrows;

FIG. 2 is a schematic diagram of fluorescence in situ hybridization analysis of the brine shrimp NAR6 gene in gill tissue in example 2 of the present invention. Blue fluorescence is cell nucleus, yellow fluorescence is NAR6 gene positive signal.

Detailed Description

The method for designing and preparing the fluorescence in situ hybridization probe of the specific gene NAR6 of the palaemon carinicauda branchia nephrogenic cell for specifically locating and identifying the nephrogenic cell is further described by combining the specific examples.

According to the method, a paraffin section HE staining technology is firstly used for observing specific positions and morphological structures of the nephrogenic cells in gill tissues, and mRNA level positioning is further carried out on the nephrogenic cells of the gill through a spinal white shrimp gill tissue frozen section and a spinal white shrimp NAR6 gene fluorescence in-situ hybridization experiment; in addition, the invention has certain application prospect in the aspects of gene positioning and function research by fluorescence in situ hybridization of other crustacean branchia tissue nephrogenic cells.

The preparation method of the hybridization solution comprises the steps of 25ml of Formamide, 20 times 10ml of SSC, 5g of dextran sulfate, 1ml of 50 times Denhardt's, and adding RNase-free water to the volume of 50ml;

wash solution is prepared by 20 × SSC 10ml, formamide 100ml,20% Tween 20.5 ml, adding RNase-free water to a constant volume of 200ml;

the TNT was prepared by 100ml of 1M Tris-HCl (pH 7.5), 20% Tween 205ml of 5M NaCl, and adding RNase-free water to a volume of 1L.

The preparation method of the Glycine-HCl comprises the steps of adding 7.5g of Glycine, adding water to 1L, and dropwise adding concentrated HCl to adjust the pH value to 2.0;

the preparation method of the blocking solution comprises the steps of adding 2% sheep serum and 2mg/ml BSA in the TNT according to the volume ratio;

the hybridization solution added with the RNA probe of the NAR6 gene of the exopalaemon carinicauda is prepared by diluting the probe to the final concentration of 1 mu g/ml.

Example 1

A method for positioning nephrogenic cells in palaemon carinicauda gill tissues by using paraffin section HE staining comprises the following specific steps:

(1) Sampling: fresh palaemon carinicauda gill tissue is taken off in a whole piece by scissors and is placed into Bouin's fixing liquid (75 ml of bitter saturated acid solution, 5ml of glacial acetic acid and 25ml of 40% formaldehyde) for fixing for 24h.

(2) Dehydrating and wax dipping: the sample was placed in an alcohol gradient to dehydrate: the method comprises the following steps of stirring 75% alcohol for 4h,85% alcohol for 2h,90% alcohol for 2h,95% alcohol for 1h, absolute ethyl alcohol for 30min twice, alcohol benzene for 10min, dimethylbenzene for 10min twice, and paraffin wax for 65 ℃ for 1h for three times.

(3) Embedding: and (3) putting the melted wax into an embedding box, and putting the gill tissue into an embedding frame before the wax is solidified. And 5, cooling in a-20 ℃ freezing table, taking the wax block out of the embedding frame after the wax is solidified, and trimming the wax block.

(4) Slicing: the repaired wax block was sliced in a paraffin slicer to a thickness of 6 μm. The slices float on warm water at 42 ℃ of a spreading machine to spread the tissues, the glass slides pick up the tissues, the slices are baked in an oven at 60 ℃ and are stored at normal temperature for later use.

(5) Paraffin section dewaxing to water: sequentially placing the slices into xylene I20 min-xylene II 20 min-absolute ethyl alcohol I5 min-absolute ethyl alcohol II 5min-75% alcohol 5min, and washing with tap water.

(6) Hematoxylin staining: and (3) dyeing the slices in hematoxylin dyeing solution for 3-5min, washing with tap water, differentiating the differentiation solution, washing with tap water, returning blue to the blue solution, and washing with running water.

(7) Eosin staining: the slices are dehydrated for 5min respectively by 85 percent and 95 percent gradient alcohol, and are dyed for 5min in eosin dye solution.

(8) Dewatering and sealing: placing the slices in anhydrous alcohol I5 min-anhydrous alcohol II 5 min-anhydrous alcohol 5 III 5 min-xylene I5 min-xylene II 5min in sequence, transparency, and sealing with neutral gum. Observation under an optical microscope (see FIG. 1).

Example 2

1. Probe design and Synthesis

A fluorescent in-situ hybridization probe primer for an NAR6 gene of gill tissue nephrogenic cells of palaemon carinicauda is disclosed, and the primer sequence is as follows: SEQ NO 1CCACTTCGGAGA-A3A’ACC，SEQ.NO 2:5’-TAATACGACTCACTATAGGGTAAGAAGATTCGGAGGGGGTG-3', the T7 promoter sequence is underlined; the above primers were used to synthesize probes. The method comprises the following specific steps: (1) Performing PCR amplification of 20 μ l reaction system, performing 1.5% agarose gel electrophoresis on the obtained product, performing ligation transformation, cutting gel and recovering to obtain a linearized template, and sequencing to confirm the correctness of the sequence, wherein the sequence is SEQ ID NO. 3. After the sequencing was correct, 1. Mu.g of linearized template product was obtained by PCR amplification and gel recovery in 100. Mu.l reaction system.

(2) Amplifying the linear template: adding the following components into a PCR centrifuge tube in sequence: linearized template 1. Mu.g, fluoroscein-NTP 1. Mu.l, 5 XBuffer 2. Mu.l, 10U RNase I0.5. Mu.l, T7 polymerase 1. Mu.l, and DEPC H ₂ O is added to 10. Mu.l.

(3) Sealing with a sealing film, and carrying out water bath at 37 ℃ for 2h.

(4) After the water bath, centrifugation was performed, and 2. Mu.l DNase I and 18. Mu.l DEPC H were added ₂ O, water bath at 37 ℃ for 15min.

(5) RNA probes were purified using Sigma kit according to the instructions and stored for a long period at-80 ℃.

NAR6 RNA probe nucleic acid sequence shown as SEQ ID NO: 3:

tggaccacttcggagaaaaccatttgctgatattccccggcggcactgttctgtgggtacctccaggtttattcagggtggagtgtccgctggattttacctattggccctatgacagccaaaagtgccatttgcatattggctcttggacttaccatggatggcagatagatttacagttaatgtataacaccacagataaggaggtacttctgggagcttattgggaaccgtcccacgagtggaagttcctctctgggaccatgcaacgtcacgagtcttacttcgcctgttgcccggaaccttacgtcagcatcctcgtcactctcaacctgaagcgaatttcggcgacgttcgtggggacggtggtcattccagcttgcgcaatatcggcgttgaccttgatccagttcctgttgcctgtaagagagaagaagagagtggtagttggatgctgctgcctcctgttgaccgttttggaaatcatctacttgggaacgtccatcccgcacctgtctacttcgacccccattatagtcaagttctacggccaaacgttgatcgtggtgacagtcagtgtggccgtgactgccctcatactacgactgactgacactgagcaccctgcagcctcaacaccccctccgaatcttctta

2. fluorescence in situ hybridization

The method for carrying out fluorescence in situ hybridization positioning on the palaemon carinicauda branchia nephrogenic cell NAR6 gene by using the probe comprises the following specific steps:

(1) And (4) fixing the sample. Whole gill samples of palaemon carinicauda were taken with DEPC-treated scissors, placed in RNase-free centrifuge tubes, and 4% PFA fixative at least 10 sample volumes was added and stored overnight at 4 ℃.

(2) Sample embedding and section preparation: washing the fixed and preserved sample with PBS 3 times, dehydrating in 30% sucrose solution, precipitating sugar overnight at 4 deg.C, embedding the sample in OCT, freezing at-80 deg.C, cutting frozen section with thickness of about 8 μm with a freezing microtome, air drying at room temperature overnight, and preserving at-20 deg.C as in situ hybridization sample.

(3) Fluorescence in situ hybridization:

1) The first day: frozen sections were washed 3 times with PBS and then 3 times with PBST (PBST: PBS +0.3% Triton) for 15 minutes each. After washing, hybridization solution was prepared by adding 10% Dextran sulfate at 80 ℃ for 5min to facilitate probe binding, and incubating at 68-70 ℃ for 15min. After that, the hybridization solution was changed, 1ug/ml of NAR6 fluorescent probe was added thereto, and incubated overnight at 70 ℃.

2) The next day: sections were rinsed 3 times for 30 minutes each at 70 ℃ with wash solution (1 × SSC,50% formamide,0.1% Tween-20). Then rinsed 3 times with TNT for 10 minutes each. The original peroxidase was then inactivated by soaking with 100mM Glycine-HCl (adjusted to pH2.0 and 0.1% Tween 20 was added) for 10 min. Then rinsed 3 times with TNT for 10 minutes each. Finally, the cells were incubated with blocking solution (TNT with2% goat serum, 2mg/ml BSA) at room temperature for 2-3h, and anti-Fluoresin-POD antibody was added to the blocking solution at a volume ratio of 1.

3) And on the third day: sections were rinsed 4 times with TNT for 10 minutes each at room temperature. After rinsing, the cells were incubated for 5 minutes with 1 Xplus Amplification dilution antibody, 20. Mu.l of Cy3 and 40ul 50% Dextran sulfate were added to 1ml of Amplification dilution to prepare a fluorescent developing solution, and the developing solution was uniformly dropped on the tissue to develop color under closed light. All the steps after the color development are carried out in a cassette. Sections were rinsed 4 times 5 minutes each with TNT. DAPI was diluted 1000-fold with PBS and added dropwise to the sample for staining nuclei, followed by rinsing 4 times with TNT. After addition of the anti-quencher, the gel was blocked with neutral gum and observed by confocal laser microscopy (see FIG. 2). Both HE staining results and fluorescence in situ hybridization results show that the branchia nephrogenic cells of the palaemon carinicauda are positioned at the central axis of the branchia filaments and close to the branchia platelets.

Claims

1. A probe primer for marking the branchia nephrogenic cells of the exopalaemon carinicauda is characterized by comprising the following sequences:

F:5’-TG G A C C A C T T C G G A G A-A3A’ A C C，

R:’-TAATACGACTCACTATAGGGTAAGAAGATTCGGAGGGGGTG-3’。

2. an RNA probe for marking the branchial nephrogenic cells of the exopalaemon carinicauda, wherein the probe is constructed by using the primer of claim 1, and the sequence of the RNA probe is shown as SEQ ID NO 3.

3. A kit for localizing plenopus caricatus gill nephrogenic cells, comprising the RNA probe of claim 1.

4. Use of the RNA probe of claim 2 for labeling gill nephrogenic cells of palaemon carinicauda.

5. The application according to claim 4, wherein the specific steps of the application are as follows:

1) Collecting branchial tissue of palaemon carinicauda, rinsing with PBS, fixing in 4-% (w/w) PFA RNA-free centrifuge tube, and storing at 4 deg.C overnight;

3) Preparing the sample prepared in the step 2) into a gill tissue frozen section in a freezing microtome;

4) Washing the slices of step 3) with PBS after 4% PFA fixation;

5) Preparing a hybridization solution, adding the RNA probe of claim 2 for hybridization after prehybridization, wherein the final concentration of the RNA probe is 1 mu g/ml, and incubating overnight at 70 ℃;

6) After overnight incubation in the step 5), washing with wash solution, TNT, glycine-HCl and TNT in sequence;

7) Incubating the washed section obtained in the step 6) with a confining liquid for 2-3h at room temperature, and adding anti-fluoroesein-POD to incubate at 4 ℃ overnight;

8) Washing the section treated in the step 7) by TNT, adding a Try-Cy3 dye, and incubating for 10-20min at 37 ℃;

9) Staining the slices treated in the step 8 with DAPI, adding an anti-quenching agent, and sealing the slices; and finally, observing a fluorescent staining result under a laser confocal microscope to realize the expression positioning of the NAR6 gene of the palaemon carinicauda at the mRNA level, thereby realizing the positioning of the gill nephrogenic cells of the palaemon carinicauda.

6. The use according to claim 5, wherein the hybridization solution in step 5) is prepared by using Formamide 25ml,20 XSSC 10ml, dextran sulfate 5g,50 XDenhardt's 1ml, and adding RNase-free water to 50ml.

7. The use according to claim 5, wherein the prehybridization in step 5) is carried out by incubating at 68-70 ℃ for 15min after adding the hybridization solution to the sample.

8. The use of claim 5, wherein the wash solution in step 6) is prepared by 20 XSSC 10ml, formamide 100ml,20% Tween 20.5 ml, adding RNase-free water to 200ml.

9. The use of claim 5, wherein the TNT is prepared in step 6) by 1M Tris-HCl 100ml,5M NaCl 30ml,20% Tween 205ml, with RNase-free water to 1L.

10. The use according to claim 5, wherein the preparation method of Glycine-HCl in the step 6) is 7.5g of Glycine, water is added to 1L, and concentrated HCl is added dropwise to adjust the pH to 2.0; the preparation method of the blocking solution in the step 7) comprises the step of adding 2% by volume of goat serum and 2mg/ml BSA into TNT.