CN115786199A

CN115786199A - Method for producing dsRNA (double-stranded ribonucleic acid) by fermenting escherichia coli

Info

Publication number: CN115786199A
Application number: CN202211493696.7A
Authority: CN
Inventors: 肖建辉; 唐雪明; 秦斌钰; 马樱芳; 黄永奎; 张恩
Original assignee: Guiyi Technology Shanghai Co ltd
Current assignee: Guiyi Technology Shanghai Co ltd
Priority date: 2022-11-25
Filing date: 2022-11-25
Publication date: 2023-03-14

Abstract

The invention discloses a method for producing double-stranded RNA (dsRNA) by fermenting escherichia coli, wherein the dsRNA is produced by fermenting the escherichia coli, glucose supplementation speed of a fermentation tank is controlled in a fermentation culture stage, different glucose supplementation speeds are controlled in different cell growth stages, and meanwhile, after induction, the temperature is lowered in stages, the glucose supplementation speed is lowered in stages, the acetic acid accumulation amount in the fermentation process is reduced, and the fermentation level is improved. The fermentation period is short, the thallus density is low, and the yield is high; and the method has simple process, easy extraction and low environmental pollution, reduces the production cost and is beneficial to popularization and application of industrial production.

Description

Method for producing dsRNA (double-stranded ribonucleic acid) by fermenting escherichia coli

Technical Field

The invention relates to a method for producing dsRNA by fermenting escherichia coli, belonging to the technical field of fermentation.

Background

RNA interference (RNAi) refers to a phenomenon of sequence-specific gene silencing induced by double-stranded RNA in molecular biology by inhibiting gene expression by blocking translation or transcription of a specific gene. When double-stranded RNA homologous with endogenous mRNA coding regions is introduced into cells, the mRNA is degraded to silence gene expression, and the method is an effective means for researching the functions of various biological genes. RNAi technology is widely applied as a new gene repression method in the fields of functional genomics, microbiology, gene expression regulation and control mechanism research and the like.

At present, the methods for in vitro preparation of siRNA have advantages and disadvantages, and the chemical synthesis method can prepare high-quality siRNA, but has high price and long customization period; the in vitro transcription method for synthesizing siRNA has relatively low cost, but the scale and the amount of the experiment are limited. The double-stranded RNA sample is prepared by fermenting escherichia coli, a large amount of long-chain double-stranded RNA can be efficiently and quickly produced in a short time, the preparation period required by chemical synthesis is shortened, high cost is reduced, and the scale limitation of in vitro transcription is broken through. However, the dsRNA produced by the existing fermented escherichia coli is low in yield, the dsRNA proportion in the fermented product is low, and the difficulty in later purification is large.

Disclosure of Invention

In order to solve the technical problems, the invention provides a method for producing dsRNA by fermenting escherichia coli.

The first purpose of the invention is to provide a method for producing dsRNA by fermenting Escherichia coli, which comprises the following steps:

s1, preparing a seed solution of escherichia coli expressing dsRNA;

s2, inoculating the seed liquid into a fermentation culture medium for fermentation; in the fermentation process, the dissolved oxygen is controlled to be 30-40%, the fermentation temperature is controlled to be 36-38 ℃, sugar supplement is carried out according to the sugar supplement speed of 1-3 g/L/h when the dissolved oxygen is recovered for the first time, and the sugar supplement speed is gradually increased to 5-7 g/L/h within 2-4 h;

s3, fermenting to OD ₆₀₀ Reaching 18-22, inducing with 0.4-1.0 mmol/L IPTG inducer for 5-10 h, and canning; wherein, after the addition of the inducerAnd regulating and controlling the cooling, dissolved oxygen reduction and sugar supplement speed reduction, wherein the cooling is reduced to 30-35 ℃, the dissolved oxygen reduction is reduced to 20% -30%, the sugar supplement speed reduction is reduced by 1-2 g/L/h per hour, and the sugar supplement speed is adjusted to 1-3 g/L/h after 3-5 hours.

Further, the temperature reduction is gradient temperature reduction, the temperature is reduced to 34-36 ℃ after the inducer is added, and the temperature is reduced to 30-33 ℃ after the inducer is added for 1-3 h.

Further, the fermentation culture medium comprises 4-6 g/L, KH of glucose ₂ PO ₄ 8-12 g/L of citric acid monohydrate and 3-5 g/L, mgSO ₄ ·7H ₂ O 1～3g/L、(NH ₄ ) ₂

SO

₄ 1 to 3g/L, and 0.5 to 1.5mL/L of microelement mother liquor, wherein the microelement mother liquor comprises CoCl ₂ ·6H ₂ O 0.10～0.15g/L，CuSO ₄ ·5H ₂ O 0.10～0.15g/L，FeSO ₄ ·7H ₂ O 5～7g/L，MnSO ₄ ·H ₂ O 0.3～0.5g/L，ZnSO ₄ ·7H ₂ O 3～5g/L。

Further, the escherichia coli is an escherichia coli engineering strain expressing coat protein genes of tobacco mosaic virus.

Further, the pH is controlled between 6.8 and 7.2 during the whole fermentation process.

Furthermore, before inoculation, the stirring is controlled at 140-160 rpm, the air flow is controlled at 0.4-0.6 VVM, and the pressure is controlled at 0.04-0.06 MPa.

Further, the pH was adjusted by ammonia.

Further, in the step S2, the sugar supplementing speed is increased every half hour.

Further, the seed liquid is prepared by the following method: streaking and inoculating an escherichia coli strain to an LB solid culture medium for culture to obtain a single colony; selecting a single colony, inoculating the single colony into an LB liquid culture medium, and culturing to obtain a first-stage seed solution; inoculating the first-stage seed liquid into a second-stage seed culture medium for culture to obtain a second-stage seed liquid.

Further, the secondary seed culture medium comprises 8-12 g/L, KH of glucose ₂ PO ₄ 12～16g/L、K ₂ HPO ₄ ·3H ₂ O10-14 g/L, citric acid monohydrate 0.8-1.2 g/L, mgSO ₄ ·7H ₂ O 0.8～1.2g/L、(NH ₄ ) ₂

SO

₄ 4 to 6g/L, and 0.5 to 1.5mL/L of microelement mother liquor, wherein the microelement mother liquor comprises CoCl ₂ ·6H ₂ O 0.10～0.15g/L，CuSO ₄ ·5H ₂ O 0.10～0.15g/L，FeSO ₄ ·7H ₂ O 5～7g/L，MnSO ₄ ·H ₂ O 0.3～0.5g/L，ZnSO ₄ ·7H ₂ O 3～5g/L。

The invention has the beneficial effects that:

at present, dsRNA belongs to high-density fermentation, and if the density of thalli is continuously improved and the acetic acid concentration is easily improved, the target dsRNA can be inhibited, and the nucleic acid concentration of the thalli can be improved simultaneously through induction, so that the concentration ratio of the target dsRNA is reduced, and the purification difficulty of the target dsRNA is increased. According to the invention, the dsRNA is produced by adopting escherichia coli fermentation, the glucose supplementation speed of the fermentation tank is controlled in the fermentation culture stage, different glucose supplementation speeds are controlled in different stages of cell growth, and meanwhile, after an inducer is added, the temperature is reduced in stages and the glucose supplementation speed is reduced in stages, so that the acetic acid accumulation in the fermentation process is reduced, the fermentation level is improved, the concentration ratio of the target dsRNA can be improved, and the subsequent nucleic acid purification yield is facilitated.

Drawings

FIG. 1 is a high performance liquid chromatogram of a sample from example 4;

FIG. 2 is a high performance liquid chromatogram of the sample of example 5;

FIG. 3 is the electrophoresis chart of the content change of the target dsRNA fermentation process in example 5, wherein lane M is DL5000 Marker, and lanes 1-4 correspond to 4h, 6h, 8h and 10h after induction, respectively;

FIG. 4 is a plasmid map of the recombinant vector pT7B-TMV.

Detailed Description

The present invention is further described below in conjunction with specific examples to enable those skilled in the art to better understand the present invention and to practice it, but the examples are not intended to limit the present invention.

1. Reagent: glucose, KH ₂ PO ₄ 、K ₂ HPO ₄ ·3H ₂ O, citric acid monohydrate, mgSO ₄ ·7H ₂ O、(NH ₄ ) ₂ SO ₄ Yeast powder, peptone, ampicillin, isopropyl-beta-D-thiogalactoside (IPTG).

2. Materials: SW-CJ-IFD type single-person single-side purification workbench, suzhou purification Equipment Co., ltd; LRH-150F biochemical medium box, shanghai-Hengscientific instruments, inc.; MQL-S2R shake culture box, shanghai Min spring instruments Inc.; 500L, 100L, 50L fermentors, shanghai Baoxing Biochemical Equipment Co., ltd; D-30M High Pressure Homogenizer; CA-01 Industrial Water chiller, shenzhen Kommensen refrigeration facility, inc.; OST-550 oilless air compressor, austus Industrial and trade Co., ltd, taizhou; PE-15AZ screw air compressor, peken (Shanghai) compressor, inc.; LDR0.064-0.8 full-automatic electric heating steam generator, shanghai Yannuo boiler manufacturing, inc.; UV2000 type UV-vis spectrophotometer, you Nike (shanghai) instruments ltd; s-10 biosensor analyzer, shenzhen Welsmann science and technology Limited; IG0321 small high-speed centrifuge, monatin biotechnology limited; LDZM-80L-I vertical high pressure steam sterilizer, shanghai Shen An medical instruments factory; LC-20AD liquid chromatograph, shimadzu corporation.

3. Main reagent and culture medium

3.1 ampicillin (Amp, 100 mg/mL) 10mL of sterile water was dissolved in 1g of ampicillin sodium, and the solution was sterilized by filtration through a 0.22 μm filter and stored at-20 ℃.

3.2, LB solid culture medium, 10g of peptone, 5g of yeast powder, 10g of NaCl and 20g of agar, and the volume is up to 1L. After sterilization and cooling, amp mother liquor is added to ensure that the final mass concentration is 50mg/L.

3.3, LB liquid culture medium, 10g of peptone, 5g of yeast powder and 10g of NaCl, and the constant volume is 1L. And adding Amp mother liquor during inoculation to ensure that the final mass concentration is 50mg/L.

3.4 IPTG (0.6 mmol/L) 1000mL of sterile water is dissolved in 100g of IPTG, filtered and sterilized by a 0.22 μm filter membrane, and stored at 4 ℃ for later use.

3.5And a secondary seed culture medium: 10g/L (mono-matched) glucose KH ₂ PO ₄ 14g/L、K ₂ HPO ₄ ·3H ₂ O12 g/L, citric acid monohydrate 1g/L, mgSO ₄ ·7H ₂ O1 g/L (single preparation), ammonium sulfate 5g/L, microelement mother liquor 1mL/L, and water in balance, and the pH value is 5-6.

3.6, fermentation medium: glucose 5g/L (mono-matched), KH ₂ PO ₄ 10g/L citric acid monohydrate 4g/L, mgSO ₄ ·7H ₂ O2 g/L (single preparation), ammonium sulfate 2g/L, microelement mother liquor 1mL/L, and water in balance, and the pH is 2-3.

3.7, microelement mother liquor (single preparation): coCl ₂ ·6H ₂ O 0.12g/L，CuSO ₄ ·5H ₂ O 0.12g/L，FeSO ₄ ·7H ₂ O6g/L，MnSO ₄ ·H ₂ O 0.4g/L，ZnSO ₄ ·7H ₂ O 4g/L。

3.8, feed medium: 60% glucose.

4. Fermentation control process

4.1, pH control: adjusting pH to 7.0 with ammonia water before inoculation, and controlling pH to 7.0 with ammonia water after inoculation

4.2, dissolved oxygen control: 30-40% before induction; 20-30% after induction.

4.3, temperature control: 37 ℃ before induction and 33 ℃ after induction.

4.4, sugar supplement process control: the dissolved oxygen rises again for the first time to supplement sugar, the sugar supplementing speed is 1-3 g/L/h, the sugar supplementing speed is increased to 5-7 g/L/h (increased once in half an hour) within 2-4h according to the growth condition of thalli, when the fermentation OD600 detection reaches more than 20 (about 16 h), the fermentation OD600 detection is induced by 0.4-1.0 mmol/L IPTG inducer, the sugar supplementing speed is reduced by 1-2 g/L/h per hour after the inducer is added, the sugar supplementing speed is adjusted to 1-3 g/L/h after 4 hours, and the fermentation can be placed in a tank after continuous induction for 6 hours. The double-stranded RNA content can reach 0.8g/L, the sugar supplementing speed is improved by one time without reducing, and the proportion of the double-stranded RNA in the total nucleic acid is improved from 7.5 percent to 23.37 percent. Meanwhile, the wet weight of the bacteria is reduced by 30 percent.

4.5, induction control: when fermenting OD ₆₀₀ Detecting to above 20, inducing with 0.6mmol/L IPTG inducer.

5. Pretreatment of fermentation liquor

Repeatedly homogenizing the fermentation liquid with a high pressure homogenizer for 2-3 times, adding 0.1mL (10% SDS solution) into 1mL of the obtained homogenized liquid, mixing, adding 0.2mL (10% potassium chloride solution), mixing, centrifuging with a 1000rpm centrifuge, collecting supernatant, precipitating with ethanol of twice volume, centrifuging at 1000rpm, and collecting precipitate; then adding 1mL of pure water for redissolving, centrifuging by a centrifuge of 1000rpm, collecting supernatant samples, and measuring the content and the proportion of nucleic acid of each component by using NanoDrop and liquid chromatography.

6. Detection method

6.1 Total nucleic acid content in the sample was measured using NanoDrop.

6.2, measuring the content and the proportion of each component of the nucleic acid in the sample by using the high performance liquid chromatography.

7. Strain construction

The invention takes coat protein (cp) gene of Tobacco Mosaic Virus (TMV) as an example to construct an escherichia coli engineering strain expressing TMV (cp) -dsRNA. The specific construction process is as follows:

1) Preparation of TMV genome (RNA): TMV-infected tobacco was used as a sample, and RNA was extracted with reference to a viral genome DNA/RNA extraction kit (cat # DP 315) of Tiangen Biochemical technology (Beijing) Ltd.

2) Synthesis of cDNA: taking RNA extracted from the step 1) as a template, oligo (dT) 20 as a primer and referring to a Norzanas Reverse transcription reagent Hiscript III Reverse Transcriptase (cargo number R302-01), and carrying out Reverse transcription to obtain cDNA.

3) PCR amplification of the cp gene: the length of the selected target gene is 482bp, TMV-F and TMV-R are used as primers, and the 5' direction respectively contains a T7 promoter (oblique line part), and the sequence is shown in the following table:

primer name	Sequence (5 '-3')
		TMV-F	TAATACGACTCACTATAGGGTCTTACAGTATCACTACTCC
TMV-R	TAATACGACTCACTATAGGGCAAGTTGCRGGACCAGAGGT

PCR amplification System (50. Mu.L): amplification was performed with Takara's DNA polymerase, as specified in the following table:

and (3) amplification procedure: 94 ℃ for 30s;55 ℃ for 10s; at 72 ℃ for 1min for 30 cycles.

The TMV-cp gene obtained by amplification is recovered by agarose gel electrophoresis, sent to Huada gene for sequencing, and compared to obtain the correct sequence.

4) Construction of recombinant vector expressing TMV (cp) -dsRNA: the L4440 vector backbone containing the double T7 promoter was amplified in reverse direction using the L4440 vector as a template and primers pL4440-F and pL4440-R (sequences shown in the following table), and the amplification system and procedure were referred to step 3) above. After amplification, dpnI enzyme is added for digestion treatment at 37 ℃ for 15min to remove an L4440 vector, the obtained vector skeleton is mixed with the purified TMV-cp fragment obtained in the step 3) according to a molar ratio of 1:3, the obtained vector skeleton is connected with a Seamless Cloning Kit (product number D7010S) in Biyunsday, E.coli DH5 alpha competent cells are transformed by heat shock at 42 ℃, the obtained cells are coated on an ampicillin (Amp) resistant plate and cultured overnight at 37 ℃, colony PCR and sequencing verification are carried out after selection, and a positive transformant is the escherichia coli recombinant vector expressing TMV (cp) -dsRNA and is named as pT7B-TMV, as shown in FIG. 4.

Primer name	Sequence (5 '-3')
		pL4440-F	CCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGT
pL4440-R	CCTATAGTGAGTCGTATTAATTTCGATAAGCCAGG

5) Construction of recombinant E.coli strains expressing TMV (cp) -dsRNA: the positive transformant obtained above is transformed into E.coli HT115 (DE 3) competent cells, spread on a tetracycline and ampicillin double-resistant plate, and cultured overnight to obtain the target engineered strain E.coli HT115 (DE 3)/pT 7B-TMV.

Example 1:

taking a strain of the frozen escherichia coli engineering strain, streaking and inoculating the strain to an LB solid culture medium, and culturing at 37 ℃ to obtain a single colony; selecting a single colony, inoculating the single colony into a triangular flask of 50ml LB liquid culture medium, and culturing overnight at the stirring speed of 200rpm and the temperature of 37 ℃ to obtain a first-stage seed solution; inoculating the first-stage seed solution into a triangular flask containing 50ml of second-stage seed culture medium according to the inoculation amount of 1% by volume, and culturing overnight at the stirring speed of 200rpm and the temperature of 37 ℃ to obtain a second-stage seed solution; A5L fermentation tank is filled with 3L of fermentation medium, and 100ml of secondary seed liquid is inoculated into the fermentation tank for culture:

adjusting the pH of the fermentation liquor to 7.0 with ammonia water before fermentation inoculation and seed transfer, and controlling the fermentation pH to 7.0 with ammonia water in the whole fermentation process. Controlling dissolved oxygen: calibrating the dissolved oxygen electrode to be 100% before inoculation or before seed transfer (initial parameters: stirring 150rpm, ventilation 0.5VVM, pressure 0.05 Mpa), controlling the dissolved oxygen of fermentation by adjusting stirring and ventilation flow after fermentation is started, controlling the dissolved oxygen to be 30-40% before IPTG induction, and controlling the dissolved oxygen to be 20-30% after IPTG induction. Temperature ofControlling: 37 ℃ before induction and 30 ℃ after induction. Sugar supplement control: the dissolved oxygen rises again for the first time (the dissolved oxygen rises to more than 80 percent suddenly, the residual sugar is zero at the moment), the sugar supplementing speed is 2g/L/h, the sugar supplementing speed is increased to 6g/L/h (increased once in half an hour) within 2-4h according to the growth condition of thalli, and when OD is fermented ₆₀₀ Detecting to reach above 20 (about 16 h), inducing with 0.6mmol/L IPTG inducer, and keeping inducing for 10 h. And (3) centrifugally collecting thalli after the thalli are placed in a tank, wherein the wet weight of the thalli is 98g/L, the dsRNA content is 0.22g/L, and the percentage of the dsRNA accounts for 8.1 percent of the total nucleic acid.

Example 2:

adjusting the pH of the fermentation liquor to 7.0 with ammonia water before fermentation inoculation and seed transfer, and controlling the fermentation pH to 7.0 with ammonia water in the whole fermentation process. Controlling dissolved oxygen: calibrating the dissolved oxygen electrode to be 100% before inoculation or before seed transfer (initial parameters: stirring 150rpm, ventilation 0.5VVM, pressure 0.05 Mpa), controlling the dissolved oxygen of fermentation by adjusting stirring and ventilation flow after the start of fermentation, controlling the dissolved oxygen to be 30-40% before IPTG induction, and controlling the dissolved oxygen to be 20-30% after IPTG induction. Temperature control: 37 ℃ before induction and 33 ℃ after induction. Sugar supplement control: the dissolved oxygen rises again for the first time (the dissolved oxygen rises to more than 80 percent suddenly, and the residual sugar is zero at the moment), the sugar supplement speed is started to be 2g/L/h, the sugar supplement speed is increased to be 6g/L/h (increased once in half an hour) within 2-4h according to the growth condition of thalli, and when OD is fermented ₆₀₀ Detecting to reach above 20 (about 16 h), inducing with 0.6mmol/L IPTG inducer, and keeping inducing for 10 h. And (3) centrifugally collecting thalli after tank placing, wherein the wet weight of the thalli is 110g/L, the dsRNA content is 0.26g/L, and the dsRNA accounts for 9.5 percent of the total nucleic acid.

Example 3:

taking a strain of the frozen escherichia coli engineering strain, streaking and inoculating the strain to an LB solid culture medium, and culturing at 37 ℃ to obtain a single colony; selecting a single colony, inoculating the single colony into a triangular flask of 50ml LB liquid culture medium, and culturing overnight at the stirring speed of 200rpm and the temperature of 37 ℃ to obtain a first-stage seed solution; inoculating the first-stage seed solution into a triangular flask containing 50ml of second-stage seed culture medium according to the inoculation amount of 1% by volume, and culturing overnight at the stirring speed of 200rpm and the temperature of 37 ℃ to obtain a second-stage seed solution; A5L fermenter was charged with 3L of fermentation medium, and 100ml of secondary seed solution was inoculated into the fermenter for cultivation:

adjusting the pH of the fermentation liquor to 7.0 with ammonia water before fermentation inoculation and seed transfer, and controlling the fermentation pH to 7.0 with ammonia water in the whole fermentation process. Controlling dissolved oxygen: calibrating the dissolved oxygen electrode to be 100% before inoculation or before seed transfer (initial parameters: stirring 150rpm, ventilation 0.5VVM, pressure 0.05 Mpa), controlling the dissolved oxygen of fermentation by adjusting stirring and ventilation flow after the start of fermentation, controlling the dissolved oxygen to be 30-40% before IPTG induction, and controlling the dissolved oxygen to be 20-30% after IPTG induction. Temperature control: 37 ℃ before induction and 33 ℃ after induction. Sugar supplement control: the dissolved oxygen rises again for the first time (the dissolved oxygen rises to more than 80 percent suddenly, and the residual sugar is zero at the moment)) to start sugar supplement, the sugar supplement speed is 2g/L/h, the sugar supplement speed is increased to 6g/L/h (increased once in half an hour) within 2-4h according to the growth condition of thalli, and when OD is fermented ₆₀₀ Detecting to reach above 20 (about 16 h), inducing with 0.6mmol/L IPTG inducer, and keeping inducing for 16 h. And (3) placing the strain in a tank, and centrifugally collecting the strain, wherein the wet weight of the strain is 123g/L, the dsRNA content is 0.23g/L, and the dsRNA accounts for 7.8 percent of the total nucleic acid.

Example 4:

adjusting the pH of the fermentation liquor to 7.0 with ammonia water before fermentation inoculation and seed transplantation, and controlling the fermentation pH to 7.0 with ammonia water in the whole fermentation process. Controlling dissolved oxygen: calibrating the dissolved oxygen electrode to be 100% before inoculation or before seed transfer (initial parameters: stirring 150rpm, ventilation 0.5VVM, pressure 0.05 Mpa), controlling the dissolved oxygen of fermentation by adjusting stirring and ventilation flow after the start of fermentation, controlling the dissolved oxygen to be 30-40% before IPTG induction, and controlling the dissolved oxygen to be 20-30% after IPTG induction. Temperature control: the temperature is reduced to 35 ℃ after the inducer is added at 37 ℃ before the induction, and the temperature is reduced to 33 ℃ after the inducer is added for 2 h. Sugar supplement control: the dissolved oxygen rises again for the first time (the dissolved oxygen rises to more than 80 percent suddenly, and the residual sugar is zero at the moment), the sugar supplement speed is started to be 2g/L/h, the sugar supplement speed is increased to be 6g/L/h (increased once in half an hour) within 2-4h according to the growth condition of thalli, and when OD is fermented ₆₀₀ Detection reached 20 (about 16 h) or more and induction was carried out with 0.4mmol/L IPTG inducer. After the inducer is added, the sugar supplementing speed is reduced by 1g/L/h per hour, after 4 hours, the sugar supplementing speed is adjusted to 2g/L/h, and after continuous induction for 6 hours, the pot is placed. The wet weight of the thallus is 85g/L, the dsRNA content is 0.46g/L, and the dsRNA accounts for 18.8 percent of the total nucleic acid. The results are shown in FIG. 1.

Example 5:

adjusting the pH of the fermentation liquor to 7.0 with ammonia water before fermentation inoculation and seed transfer, and controlling the fermentation pH to 7.0 with ammonia water in the whole fermentation process. Controlling dissolved oxygen: before inoculation or transfer (initial)Parameters are as follows: stirring at 150rpm, ventilation of 0.5VVM, and pressure of 0.05 Mpa) calibrating dissolved oxygen electrode to 100%, controlling fermentation dissolved oxygen by adjusting stirring and ventilation flow after fermentation, controlling dissolved oxygen at 30-40% before IPTG induction, and controlling dissolved oxygen at 20-30% after IPTG induction. Temperature control: the temperature is reduced to 35 ℃ after the inducer is added at 37 ℃ before the induction, and the temperature is reduced to 33 ℃ after the inducer is added for 2 h. Sugar supplement control: the dissolved oxygen rises again for the first time (the dissolved oxygen rises to more than 80 percent suddenly, the residual sugar is zero at the moment), the sugar supplementing speed is 2g/L/h, the sugar supplementing speed is increased to 6g/L/h (increased once in half an hour) within 2-4h according to the growth condition of thalli, and when OD is fermented ₆₀₀ Detection reached 20 (about 16 h) or more and induction was carried out with 0.6mmol/L IPTG inducer. After the inducer is added, the sugar supplementing speed is reduced by 1g/L/h per hour, after 4 hours, the sugar supplementing speed is adjusted to 2g/L/h, and after continuous induction for 6 hours, the pot is placed. The wet weight of the thallus is 82g/L, the dsRNA content is 0.57g/L, and the dsRNA accounts for 23.4 percent of the total nucleic acid. The results are shown in FIGS. 2 and 3.

Example 6:

adjusting the pH of the fermentation liquor to 7.0 with ammonia water before fermentation inoculation and seed transfer, and controlling the fermentation pH to 7.0 with ammonia water in the whole fermentation process. Controlling dissolved oxygen: calibrating the dissolved oxygen electrode to be 100% before inoculation or before seed transfer (initial parameters: stirring 150rpm, ventilation 0.5VVM, pressure 0.05 Mpa), controlling the dissolved oxygen of fermentation by adjusting stirring and ventilation flow after the start of fermentation, controlling the dissolved oxygen to be 30-40% before IPTG induction, and controlling the dissolved oxygen to be 20-30% after IPTG induction. Temperature control: the temperature is reduced to 35 ℃ after the inducer is added at 37 ℃ before the induction, and the temperature is reduced 2h after the inducer is addedAnd the temperature is between 33 ℃. Sugar supplement control: the dissolved oxygen rises again for the first time (the dissolved oxygen rises to more than 80 percent suddenly, and the residual sugar is zero at the moment), the sugar supplement speed is started to be 2g/L/h, the sugar supplement speed is increased to be 6g/L/h (increased once in half an hour) within 2-4h according to the growth condition of thalli, and when OD is fermented ₆₀₀ Detection reached 20 (about 16 h) or more and induction was carried out with 1.0mmol/L IPTG inducer. After the inducer is added, the sugar supplementing speed is reduced by 1g/L/h per hour, after 4 hours, the sugar supplementing speed is adjusted to 2g/L/h, and after continuous induction for 6 hours, the pot is placed. 79g/L of thalli, 0.49g/L of dsRNA content, accounting for 22.3 percent of total nucleic acid.

The target dsRNA has similar or even identical properties with the self-DNA and RNA of bacteria, and the like, thereby causing difficulty in large-scale nucleic acid purification. The higher the proportion of the fermented nucleic acid, the higher the yield of the nucleic acid purification in the later period. The lower the relative fermented nucleic acid ratio, the lower the later nucleic acid purification yield, and the greater the difficulty of geometric fold increase.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.

Claims

1. A method for producing dsRNA by fermenting Escherichia coli is characterized by comprising the following steps:

s1, preparing a seed solution of escherichia coli expressing dsRNA;

s3, fermenting to OD ₆₀₀ Reaching 18-22, inducing with 0.4-1.0 mmol/L IPTG inducer for 5-10 h, and canning; wherein, the temperature reduction, the dissolved oxygen reduction and the sugar supplement speed reduction are regulated and controlled after the inducer is added, the temperature reduction is reduced to 30-35 ℃, the dissolved oxygen reduction is reduced to 20-30 percent, and the sugar supplement speed reduction is every smallThe sugar supplementing speed is reduced by 1-2 g/L/h, and the sugar supplementing speed is adjusted to 1-3 g/L/h after 3-5 h.

2. The method according to claim 1, wherein the temperature reduction is a gradient temperature reduction, the temperature is reduced to 34-36 ℃ after the inducer is added, and the temperature is reduced to 30-33 ℃ after the inducer is added for 1-3 h.

3. The method of claim 1, wherein the fermentation medium comprises glucose 4-6 g/L, KH ₂ PO ₄ 8-12 g/L of citric acid monohydrate and 3-5 g/L, mgSO ₄ ·7H ₂ O 1～3g/L、(NH ₄ ) ₂ SO ₄ 1-3 g/L, and 0.5-1.5 mL/L of microelement mother liquor, wherein the microelement mother liquor comprises CoCl ₂ ·6H ₂ O 0.10～0.15g/L，CuSO ₄ ·5H ₂ O0.10～0.15g/L，FeSO ₄ ·7H ₂ O 5～7g/L，MnSO ₄ ·H ₂ O 0.3～0.5g/L，ZnSO ₄ ·7H ₂ O 3～5g/L。

4. The method of claim 1, wherein the E.coli is an engineered E.coli strain expressing coat protein gene of tobacco mosaic virus.

5. The method according to claim 1, wherein the pH is controlled between 6.8 and 7.2 throughout the fermentation.

6. The method of claim 1, wherein the stirring is controlled at 140 to 160rpm, the aeration is controlled at 0.4 to 0.6VVM, and the pressure is controlled at 0.04 to 0.06MPa before the inoculation.

7. The method of claim 6, wherein the pH is controlled by ammonia.

8. The method of claim 1, wherein in step S2, the rate of glucose replenishment is increased every half hour.

9. The method of claim 1, wherein the seed liquid is prepared by: inoculating colibacillus strains to an LB solid culture medium in a streaking manner to obtain single colonies through culture; selecting a single colony, inoculating the single colony into an LB liquid culture medium, and culturing to obtain a first-stage seed solution; inoculating the first-stage seed liquid into a second-stage seed culture medium for culture to obtain a second-stage seed liquid.

10. The method of claim 9, wherein the secondary seed medium comprises glucose 8-12 g/L, KH ₂ PO ₄ 12～16g/L、K ₂ HPO ₄ ·3H ₂ O10-14 g/L, citric acid monohydrate 0.8-1.2 g/L, mgSO ₄ ·7H ₂ O0.8～1.2g/L、(NH ₄ ) ₂ SO ₄ 4 to 6g/L, and 0.5 to 1.5mL/L of microelement mother liquor, wherein the microelement mother liquor comprises CoCl ₂ ·6H ₂ O 0.10～0.15g/L，CuSO ₄ ·5H ₂ O 0.10～0.15g/L，FeSO ₄ ·7H ₂ O 5～7g/L，MnSO ₄ ·H ₂ O0.3～0.5g/L，ZnSO ₄ ·7H ₂ O 3～5g/L。