CN115785240B

CN115785240B - LaMYC7 protein, coding gene thereof and application thereof in regulation and control of plant terpenoid synthesis

Info

Publication number: CN115785240B
Application number: CN202210896330.8A
Authority: CN
Inventors: 石雷; 董燕梅; 夏菲; 李慧; 李靖锐; 张文颖; 白红彤
Original assignee: Institute of Botany of CAS
Current assignee: Institute of Botany of CAS
Priority date: 2022-07-28
Filing date: 2022-07-28
Publication date: 2024-02-02
Anticipated expiration: 2042-07-28
Also published as: CN115785240A

Abstract

The invention discloses an application of LaMYC7 protein and a coding gene thereof in regulating and controlling plant terpenoid synthesis. The invention discovers the LaMYC7 gene positioned at the nucleus, and discovers that the over-expression of the LaMYC7 gene in tobacco shows that the content of linalool and caryophyllene is obviously increased, and the resistance of the tobacco to pseudomonas syringae is increased. According to the invention, through the separation of the LaMYC7 and the identification and analysis of the gene function, the forward regulation of linalool and caryophyllene synthesis in the plant by the LaMYC7 is established so as to increase the resistance of the plant to pseudomonas syringae.

Description

LaMYC7 protein, coding gene thereof and application thereof in regulation and control of plant terpenoid synthesis

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a LaMYC7 gene of lavender and application thereof in regulation and control of synthesis of linalool and caryophyllene in plants.

Background

Plants are subjected to various stresses from the environment during their life cycle, including biotic (insect pests, pathogenic bacteria, etc.) and abiotic (salt, high temperature, drought, etc.) (Suzuki et al, 2014;Chisholm et al, 2006). Plants have evolved a variety of defense mechanisms in order to resist growth and survival stress (Atkinson and Urwin, 2012). Volatile organic compounds (Volatile OrganicCompounds, VOCs) discharged by plants can be used as powerful weapons for biological control, and provide technical support for green control of crop diseases and insect pests and sustainable development of agriculture (Brilli et al, 2019), wherein terpenes are an important class of VOCs. The plant synthesized (-) -thujaene and beta-caryophyllene promote lateral root formation, inducing plant resistance to microorganisms (Ditengou et al 2015;Yamagiwa et al, 2011; huang et al 2015). In addition, caryophyllene induces a defensive response through JA signaling, enhancing plant resistance to pseudomonas syringae DC3000 (Frank et al, 2021).

The whole lavender (Lavandula angustifolia) plant contains VOCs and is considered as a model plant for researching the regulation of terpenoid synthesis. At present, more than 75 volatile terpenes in lavender are identified et al.,2019； et al.,2019)。

Terpene biosynthesis begins with isopentenyl diphosphate (isopentenyl diphosphate, IPP) and its isomer dimethylallyl diphosphate (dimethylallyl diphosphate, DMAPP), synthesized via the mevalonate pathway in the cytoplasm (MVA) and the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway in the plastids (Liao et al, 2016). IPP and DMAPP combine head to head or tail to form geranyl diphosphate (geranyl diphosphate, GPP), neryl pyrophosphate (neryl pyrophosphate, NPP) or farnesyl diphosphate (farnesyl diphosphate, FPP), and then terpene synthase (terpene synthases, TPS) converts GPP, NPP and FPP to monoterpenes and sesquiterpenes (Dong et al, 2022).

Terpene biosynthesis is regulated by structural genes and transcription factors (transcription factors, TFs). TFs regulate gene expression by altering transcript levels (Vimolmanngkang et al, 2013; xi et al, 2019). Basic helix-loop-helix (bHLH) TF plays a key role in plant growth, stress, and biosynthesis of secondary metabolites (Mertens et al, 2016). MYC family members are bHLH TFs (Huang et al, 2015), some of which control terpenoid biosynthesis in plants (Yang et al, 2012), e.g., cpMYC2 and AtMYC2 regulate the synthesis of caryophyllene in arabidopsis (Hong et al, 2012; asam et al, 2020), while SlMYC1 controls terpenoid emissions in tomato (Solanum lycopersicum) (Xu et al, 2018). MYCs transcription factors have been characterized in Arabidopsis thaliana (Hong et al 2012; abe et al 2003), tomato (Xu et al 2018), sweet wormwood (Majida et al 2019) and other plants (Astam et al 2020;Lenka1 et al, 2015; yin et al 2017), but only LaMYC4 in lavender was cloned and characterized (Dong et al 2022, now named LaMYC 17).

Disclosure of Invention

In order to solve the problems, the invention provides a LaMYC7 protein, a coding gene thereof and application thereof in regulating and controlling plant terpenoid synthesis.

It is an object of the present invention to provide lavender LaMYC7 protein, which is:

1) A protein consisting of the amino acids shown in SEQ ID No. 2; or (b)

2) A protein derived from 1) which has equivalent activity and is obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID No. 2.

The invention also provides a gene for encoding the lavender LaMYC7 protein.

Preferably, the LaMYC7 gene has a nucleotide sequence shown in SEQ No. 1.

Another object of the present invention is to provide a vector, a host cell and an engineering bacterium comprising the gene.

The invention also provides application of the gene in regulating and controlling the synthesis of plant caryophyllene.

The invention also provides application of the gene in regulating and controlling plant terpenoid synthesis and increasing resistance of plants to pseudomonas syringae.

The invention also provides a method for increasing plant volatiles, in particular linalool, caryophyllene, comprising:

1) Transforming a plant cell with an overexpression vector containing the gene;

2) The transformed plant cells are grown into plants.

LaMYC7 was stably expressed in tobacco by leaf disc method, and it was found that the content of volatile matters in transgenic tobacco, especially linalool and caryophyllene, was increased. The present invention also provides a method of improving the bacterial resistance of a plant comprising:

1) Transforming a plant cell with an overexpression vector containing the gene;

2) The transformed plant cells are grown into plants.

LaMYC7 was overexpressed in tobacco, which was found to increase the resistance of tobacco to Pseudomonas syringae DC 3000.

In the above method, the transgenic plant is understood to include not only the T0 generation transgenic plant obtained by transforming the target plant with the LaMYC7 gene, but also the progeny thereof. For transgenic plants, including seeds, calli, whole plants or cells, the gene may be propagated in that species, or transferred to other species using conventional breeding techniques.

The invention constructs transcriptome by MeJA processing flowers and leaves of Lavender in the annual full-bloom stage, picks up differential genes, clones LaMYC7 genes of Lavender by RT-PCR technology, and has self-activating capability when the genes are positioned in cell nuclei. The LaMYC7 gene is over-expressed in tobacco, so that the content of linalool and caryophyllene is obviously increased, and the resistance of the tobacco to pseudomonas syringae is increased. According to the invention, through the separation of the LaMYC7 and the identification and analysis of the gene function, the forward regulation of linalool and caryophyllene synthesis in the plant by the LaMYC7 is established so as to increase the resistance of the plant to pseudomonas syringae.

Drawings

FIG. 1 shows the basic characterization of LaMYC 7. (a) altered levels of LaMYC7 transcription following topical application of MeJA; (b) expression level of LaMYC7 in different tissues of lavender; (c) level of LaMYC7 expression during lavender flowering; (d) LaMYC7 and arabidopsis bHLH clade analysis and subfamily classification; (e) LaMYC7 conserved domain analysis.

FIG. 2 shows LaMYC7 subcellular localization and self-activation detection. (a) Tobacco leaves were injected with control (comprising GFP) and fusion plasmid (LaMYC 7:: GFP) GV 3101; (b) Yeast cells (AH 109) were transformed with positive control vector (upper), fusion vector containing LaMYC7 (middle) and negative control vector (lower), respectively.

FIG. 3 shows the variation of LaMYC7 over-expressed linalool and caryophyllene content in tobacco. (a-d) mass spectra of linalool and caryophyllene in wild type, empty, overexpressed LaMYC7 lines #2, # 9; (e) linalool content; (f) caryophyllene content.

FIG. 4 shows analysis of transcript levels of LaMYC7 under different stress conditions.

Fig. 5 shows that LaMYC7 increases tobacco resistance to DC 3000. (a) Plant phenotype after wild WT, no load 2300 and LaMYC7 were sprayed with DC for 3000 days; (b) Wild type WT, idler 2300 and LaMYC7 were sprayed with DC for five days.

Detailed Description

In order to describe the technical content of the present invention in detail, specific examples are provided below. It should be noted that the following description is intended to further illustrate the present invention, but the scope of the method and protection of the present invention is not limited thereto.

The reagents and methods used in the examples below were prepared and run according to conventional methods unless otherwise specified; the reagents used are all commercially available.

Example 1: obtaining LaMYC7 Gene

1. Transcriptome data acquisition

According to the invention, annual potted seedlings of Lavender of 'Beijing Lavender No. 2' in full bloom stage are selected, sprayed with 8mM methyl jasmonate (MeJA), the same amount of aqueous solution without MeJA is selected for a control group, flowers and first pairs of leaves on inflorescences are taken out 12 hours after spraying, quick-frozen in liquid nitrogen, and stored at-80 ℃ for standby. And extracting total RNA of the sample according to the Magen total RNA extraction kit, and sending the total RNA to the Nor and organism for transcriptome sequencing after the total RNA is detected to be qualified. And analyzing flower and leaf differential genes of the MeJA treated group and the control group, selecting differential genes shared by flowers and leaves, and comparing the differential genes with the Arabidopsis sequences.

The result shows that: the differential gene LaMYC7 is up-regulated in flowers and leaves after MeJA treatment and mainly expressed in leaves and glandular hairs, and shows a decreasing trend along with the development of flowers, but the expression quantity is up-regulated in the full bloom stage (F4) and is equivalent to the expression quantity in the bud stage (FB 0); in addition, the phylogenetic tree analysis showed that LaMYC7 was located in group 2 and was closest to ATMYC2 of arabidopsis, presumably the gene was likely to regulate terpenoid synthesis in response to MeJA (fig. 1).

2. Obtaining LaMYC7 Gene

Extracting total RNA of Lavender No.2 (from northern resource plant key laboratory), performing reverse transcription to obtain cDNA as a template, performing PCR amplification by using primers MYC7F and MYC7R, performing gel cutting and recovery on the product, connecting the product with a cloning vector pBM16K, transforming escherichia coli DH5 alpha, performing PCR and sequencing to detect a positive cloning single colony, and storing 50% glycerol at-80 ℃ for later use. The primer sequences were as follows:

MYC7F:ATGACTGATCACCGGC

MYC7R:CTACCGAGATTCACCAAC

sequencing results showed that: the nucleotide sequence of the PCR product is shown as SEQ ID No.1, and the amino acid sequence of the protein encoded by the LaMYC7 gene is shown as SEQ ID No. 2.

3. LaMYC7 protein localization and self-activation detection

1. Construction of recombinant vector pCAMBIA2300-LaMYC7

The LaMYC7 gene shown in the sequence SEQ ID No.1 is used as a template, primers MYC7-2300-F and MYC7-2300-R are used for PCR amplification to obtain a PCR product, and a homologous recombination method is adopted to connect the full-length cDNA of the LaMYC7 with an expression vector pCAMBIA2300 to generate fusion protein (35S:: laMYC 7-GFP). The empty vector (pCAMBIA 2300) and the recombinant vector (35S:: laMYC 7-GFP) were transformed into Agrobacterium tumefaciens GV3101 by freeze-thawing. The primer sequences were as follows:

MYC7-2300-F：TCGATACACCAAATCGACTCTAGAAAATGACTGATCACCGGC

MYC7-2300-R：

CCCCGGGCCCCTGCAGAAGCCCGAGATTCACCAACTT

2. subcellular localization

Benshi tobacco (Nicotiana benthamiana) of 3-4 weeks old was selected, tobacco leaves were injected with bacterial liquid OD=0.6-0.8, transformed for 3d, and the leaves were removed and analyzed on a confocal laser scanning microscope (Leica TCS SP 5).

The results are shown in FIG. 2 a: from the figure, it can be seen that LaMYC7 protein is localized in the nucleus.

3. Self-activation detection

The LaMYC7 gene shown in the sequence SEQ ID No.1 is used as a template, primers MYC7-BK-F and MYC7-BK-R are used for PCR amplification to obtain a PCR product, and a homologous recombination method is used for connecting the full-length cDNA of the LaMYC7 with an expression vector pGBKT7 to generate fusion protein (pGBKT 7-LaMYC 7). The empty vector (pGBKT 7) and the recombinant vector (pGBKT 7-LaMYC 7) were transformed into yeast AH109 by a heat shock method. The primer sequences were as follows:

MYC7-BK-F:

GCATATGGCCATGGAGGCCGAATTCATGACTGATCACCGGC

MYC7-BK-R:

CGGCCGCTGCAGGTCGACGGATCCCTACCGAGATTCACCAAC

the results are shown in FIG. 2 b: from the figure, it can be seen that LaMYC7 protein has self-activating ability.

Example 2 LaMYC7 transgenic plant acquisition and regulatory volatile functional analysis

1. Transgenic plant acquisition

1. Transformation

The recombinant strain GV3101 obtained in step 1 of example 1 was used, and the transformed empty vector pCAMBIA2300 recombinant strain GV3101 was used as a control, and tobacco (N.tabacum) was infected by using the leaf disc method, specifically comprising the following steps:

(1) The recombinant vector-containing GV3101 agrobacterium was shaken to around od600=1, the bacterial solution was enriched, and the supernatant was discarded.

(2) The enriched bacterial solution was suspended in 1/2MS containing 200mM AS at 28℃in the absence of light for 2-3h.

(3) Cutting the sterile tobacco leaf into 1x1cm pieces, placing in the dyeing liquid for 15-20min, and shaking every 5 min.

(4) Co-cultivation: in an ultra clean bench, the excess bacterial liquid is sucked by sterile filter paper and placed in an MS culture medium containing 1mg/L6BA and 0.1mg/L NAA, and the culture is carried out in darkness for 3d at 8 ℃.

(5) Screening and culturing: after dark culture for 3d, washing with sterile water for 3 times and 1% of cephalosporin for 6min each, washing with water for 3 times, sucking off excessive water with sterile filter paper, placing in MS (6 BA,1mg/L; NAA 0.1mg/L; tim,100mg/L; K+,100 mg/L), irradiating with light, and replacing culture medium at 25+1deg.C for 2 weeks.

(6) Rooting: after 4-5 weeks of germination, the shoots were excised and rooting was cultured in 1/2MS (100 mg/L; K+,100 mg/L).

2. Authentication

Taking out the seedlings after rooting for 2 weeks, extracting DNA to identify positive seedlings, collecting seeds after maturation, screening positive seedlings on a 1/2MS culture medium plate added with 100mg/L K +, when normal seedlings grow in soil and grow to 4-5 leaves, extracting DNA to detect positive seedlings by PCR and fluorescence observation under a fluorescence microscope, selecting 5 positive seedlings, carrying out qPCR verification, and selecting two strains with higher expression quantity as follow-up detection plants.

2. Overexpression of LaMYC7 increases volatile content in tobacco

1. Volatile detection

2g of the bloomed tobacco flowers were ground in liquid nitrogen, placed in a 20mL headspace sample-loading vial, kept at 60℃for 40min, then incubated for 20min with DVB/CAR/PDMS sampling needle insertion, and then resolved at 250℃for 3min. 0.25 μg of 3-octanol was added to each sample as an internal standard.

2. Product identification

Substances were identified by comparison of the retention times obtained from NIST-14.0 and literature data with electron ionization mass spectrometry fragments and standards.

3. Calculation of linalool and caryophyllene content

And calculating the substance content in 2g of flower samples according to the peak area and the content of the internal standard 3-octanol by using the identified linalool and caryophyllene.

The results are shown in figure 3, where linalool and caryophyllene content were significantly higher in both the over-expressed LaMYC7 tobacco lines #2 and #9 than in wild-type and empty-transgenic tobacco plants.

EXAMPLE 3 LaMYC7 increases the bacterial resistance of tobacco plants

1. Different stress treatments

And selecting annual Lavender cutting seedlings of 'Beijing Lavender No. 2' to perform different stress treatments. Spraying lavender with Pseudomonas syringae pv.mat (Pst) DC3000 bacterial liquid concentration of bacterial liquid OD600 = 0.5, inoculating for 6 hours, and sampling; ultraviolet treatment, irradiating for 10min each day, continuously irradiating for 3d, and sampling; 8mM MeJA for 12 hours, and sampling; lavender was treated every three days with 300mM NaCl 2 times, and sampled every seventh day; cold (16 ℃) and drought were continued for 7d and samples were taken. All samples were immediately frozen in liquid nitrogen and then stored at-80℃until use.

2. LacYC 7 expression abundance under different stress conditions

And (3) extracting total RNA from samples processed in different stress conditions according to a Magen total RNA extraction kit, obtaining cDNA according to a Noruzan reverse transcription kit instruction after the detection quality is qualified, and detecting the transcription abundance of LaMYC7 in different stress conditions by using RT-qPCR, wherein 18srRNA and action are used as internal references.

As shown in fig. 4, the expression level of LaMYC7 was up-regulated under various stress conditions, and the expression level was significantly up-regulated after DC3000 treatment compared to the control.

3. Application of LaMYC7 in increasing plant resistance bacteria DC3000

Culturing DC3000 bacterial liquid at 28 ℃ and 180rpm overnight, enriching bacterial liquid with OD600 of about 1, suspending bacterial liquid with solution containing 10mM MgCl2 and 0.04% Silwet L-77, adjusting bacterial liquid concentration to OD600 = 0.6, and spraying tobacco plants. After 5d, 18 wells were obtained from Wild Type (WT), empty (2300) and over-expressed LaMYC7 (# 2, # 9) plants, respectively, with a punch, washed twice with an aqueous solution containing Rif, mixed well, spread on LB plates (50 mg/L Rif), cultured for 1-2d, and observed for plaque growth.

As shown in FIG. 5, the over-expressed LaMYC7 (# 2, # 9) plants have certain resistance to DC3000 bacterial liquid, and bacterial plaques on the inoculated flat plates after 5 days are significantly lower than those of wild type and empty-load plants.

The foregoing is merely a preferred embodiment of the present invention, and it should be noted that it will be apparent to those skilled in the art that several modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the scope of the invention.

Claims

1. Lavandula Lamyc7 protein, which is a protein consisting of the amino acids shown in SEQ ID No. 2.

2. A gene encoding the lavender LaMYC7 protein of claim 1.

3. The gene of claim 2, wherein the sequence is set forth in SEQ ID No. 1.

4. A vector comprising the gene of claim 2 or 3.

5. An engineered bacterium comprising the gene of claim 2 or 3.

6. Use of a gene according to claim 2 or 3 for regulating tobacco caryophyllene and/or linalool synthesis.

7. The use according to claim 6, wherein the gene is transferred into the tobacco genome and overexpressed in transgenic tobacco, increasing the content of caryophyllene and/or linalool in the tobacco.

8. A method of increasing tobacco linalool and/or caryophyllene comprising:

1) Transforming a tobacco cell with an overexpression vector comprising the gene of claim 2 or 3;

2) The transformed tobacco cells are grown into plants.