CN115772512A

CN115772512A - Adenine deaminase, adenine base editor containing adenine deaminase and application of adenine base editor

Info

Publication number: CN115772512A
Application number: CN202111044206.0A
Authority: CN
Inventors: 陈亮; 李大力; 张舜; 薛念念; 刘明耀
Original assignee: East China Normal University; Bioray Laboratories Inc
Current assignee: East China Normal University; Bioray Laboratories Inc
Priority date: 2021-09-07
Filing date: 2021-09-07
Publication date: 2023-03-10
Also published as: WO2023036189A1

Abstract

The invention discloses an adenine deaminase, an adenine base editor containing the adenine deaminase and application of the adenine deaminase. The adenine deaminase is mutated at one or more amino acids at position 29, 84, 108 and 145 of the amino acid sequence comprising SEQ ID NO. 1. The adenine base editor comprises nuclease and the adenine deaminase, can effectively destroy the non-specific combination of the adenine deaminase and a substrate base, narrows an editing window to 1-2 bases, and maintains higher editing activity; structural pocket changes caused by mutation also make adenine deaminase unable to recognize cytosine as a substrate, and finally completely eliminate independent cytosine editing events existing in ABE; and the lower indel is kept, the safety is improved, the application of the compound in the aspects of accurate medical treatment, animal disease model making, crop genetic breeding and the like can be promoted, and the compound has great application value.

Description

Adenine deaminase, adenine base editor containing adenine deaminase and application of adenine base editor

Technical Field

The invention belongs to the field of gene editing, and particularly relates to adenine deaminase, an adenine base editor containing the adenine deaminase and application of the adenine base editor.

Background

The nature of human genetic diseases is due to gene mutation, about 60% of genetic diseases are caused by single base mutation, and the traditional homologous recombination mediated by genome editing technology is very inefficient to correct the genetic diseases (0.1% -5%). A single Base editor (Base editor) derived based on a CRISPR system is an emerging high-efficiency Base editing technology in recent years, and has great application prospects in basic research and clinical disease treatment due to the advantages of no generation of DNA double-strand break, no need of recombination of templates, high-efficiency editing and the like.

The classical base editors are mainly divided into cytosine base editors and adenine base editors, wherein the cytosine base editors comprise a Cas9 protein spCas9n with impaired activity and derived from Streptococcus pyogenes (Streptococcus pyogenes), a rat-derived cytosine deaminase rAPOBEC1 and a uracil glycosidase inhibitor, wherein the Cas9 protein takes NGG as PAM to recognize and specifically bind DNA, and finally, under the actions of deaminase and DNA repair, the replacement of C/G-T/A is realized in the 20bp range of an upstream targeting sequence of NGG (21-23 bits), and an editing window is mainly positioned at 4-8 bits; the latter is to fuse TadA (adenine deaminase) from bacteria with spCas9, under the assistance of directed evolution and protein engineering technology, adenine base editor ABE7.10 which can act on single-stranded DNA is obtained through 7 rounds of evolution, the active editing area is mainly located at 4-7, the average editing efficiency of A/T-G/C caused by the system in human cells is about 53%, which is much higher than the efficiency of base mutation mediated by homologous recombination, the product purity is as high as 99.9% and extremely low indel (insertion or deletion) occurs, more importantly, about 47% of human pathogenic point mutation is formed by C.G mutation to T.A, while the adenine base editor is expected to correct nearly half of pathogenic point mutation, and shows the huge potential of ABE in mutant base modification and genetic disease treatment, and ABE is widely applied to preparation and gene treatment at present.

Aiming at the problems of low editing efficiency of ABE7.10, narrow editing window and the like, a large amount of optimization and transformation work is carried out in each laboratory, ABEmax is obtained by using a strategy of replacing a nuclear localization signal and optimizing codons, the highest editing efficiency from A to G is improved by 7.1 times compared with that of ABE7.10, a CP-ABEmax series constructed by fusing CP-Cas9 variants extends the editing window from 4-7 to 4-12, but the editing activity is still similar to ABEmax, and in addition, in order to further expand the targeting range of ABE, ABEs with different PAM selectivities are also developed, such as VQR-ABE (PAM: NGA), VRQR-ABE (PAM: NGA), cas9-ABE, (PAM: NNGRRT), saKKH-ABE (PAM: NNNRRT), VRER-ABE (PAM: NGCG), BExAmax (PAM: NGN), and NG-ABEmax (PAM: NG). With the help of molecular evolution technology, the recently reported ABE8e (Richter MF, et al. Phase-assisted evolution of an adenine base edition with improved results of domain compatibility and activity. Nat Biotechnology, 2020,38: thus, there is still a lack of highly accurate and highly active adenine base editors for the clinical application of precision medicine, while several groups of subjects report harmful cytosine editing of ABE (Li S, et al. Packaging sites inside cas9 for adenosine base editing and rna off-target activation. Nat Commun,2020,11 5827 kurt ic, et al. Crispr c-to-g base editors for inducing targeted DNA transitions in human cells. Nat Biotechnol,2021,39, kim HS, et al, adenine base reagents catalysis cytosine conversion in human cells, nat Biotechnol,2019, 37.

At present, no report that the editing window of the ABE can be narrowed to 1-2 bases exists, accurate adenine editing is realized, an effective base editor still lacks, meanwhile, harmful cytosine editing generated by the ABE is not completely eliminated, and the generated ABE safety problem needs to be solved urgently.

Disclosure of Invention

The invention aims to overcome the defect that in the prior art, adenine and cytosine editing of bystanders can be obviously reduced, and provides an accurate, efficient and high-safety adenine deaminase, an adenine base editor containing the adenine deaminase and application of the adenine base editor. The adenine base editor can greatly reduce the adenine of a bystander, almost completely remove cytosine editing of the bystander, and even can narrow an editing window to 1-2 bases, thereby having extremely high safety.

The inventor predicts several key catalytic sites in the TadA-8e through structural biology, and obtains a single-point mutant based on the TadA-8e through amino acid substitution on the basis, and unexpectedly discovers that part of the single-point mutants greatly destroy the nonspecific binding of adenine deaminase and substrate adenine, and simultaneously maintain higher editing activity; the double-point mutant is further obtained by amino acid substitution on the basis of the single-point mutant, and the double-point mutant is found to be capable of narrowing an editing window to 1-2 bases, and simultaneously maintain high editing activity, and structural pocket changes caused by mutation also enable adenine deaminase to be incapable of recognizing cytosine as a substrate, so that independent cytosine editing events existing in ABE are completely eliminated, and low indels are still maintained.

The invention solves the technical problems through the following technical scheme.

In a first aspect, the present invention provides an adenine deaminase comprising an amino acid sequence as set forth in SEQ ID NO. 1 with one or more amino acid mutations at positions 29, 84, 108 and 145.

Preferably, the one or more amino acid mutations comprise:

the 108 th amino acid residue N is mutated into Q; or the like, or, alternatively,

the 145 th amino acid residue L is mutated into T; or the like, or a combination thereof,

the 145 th amino acid residue L is mutated into Q; or the like, or, alternatively,

the 84 th amino acid residue F is mutated into T; or the like, or, alternatively,

the 84 th amino acid residue F is mutated into T, and the 108 th amino acid residue N is mutated into Q; or the like, or a combination thereof,

the 108 th amino acid residue N is mutated into Q, and the 145 th amino acid residue L is mutated into T; or the like, or, alternatively,

the 108 th amino acid residue N is mutated into Q, and the 29 th amino acid residue P is mutated into M; or the like, or, alternatively,

amino acid residue N at position 108 was mutated to Q and amino acid residue P at position 29 was mutated to W.

In the invention, the nucleotide sequence of adenine deaminase with the amino acid sequence shown as SEQ ID NO. 1 is shown as SEQ ID NO. 2.

In the present invention, the adenine deaminase further comprises one or more amino acid mutations at other sites as shown in SEQ ID NO. 1, and the resulting mutant has the same or similar function or biological activity as the adenine deaminase of the first aspect.

In some embodiments of the invention, the adenine deaminase further comprises a nuclear localization signal sequence; the nuclear localization signal sequence may be conventional in the art, for example, the nuclear localization signal sequence shown in SEQ ID NO. 3.

A second aspect of the invention provides an adenine base editor comprising a nuclease and an adenine deaminase as described in the first aspect.

In some embodiments of the invention, the nuclease is a Cas protein and variants thereof;

in some preferred embodiments of the invention, the Cas protein is saccharomyces cerevisiae-derived spCas9, staphylococcus aureus-derived SaCas9, pilospiraceae-derived LbCas12a, or acidococci-derived enacas 12a; the Cas protein variant is VQR-spCas9, VRER-spCas9, sprY, spNG, saCas9-KKH or SaCas9-NG.

In some embodiments of the invention, the adenine base editor significantly reduces bystander adenine editing and bystander cytosine editing.

In some embodiments of the invention, the adenine base editor can greatly narrow the editing range, edit 1-2 bases accurately, while keeping indel events low.

A third aspect of the invention provides a fusion protein comprising an adenine deaminase according to the first aspect.

In some embodiments of the invention, the fusion protein further comprises a nuclease as defined in the second aspect.

In the present invention, the sequence composition encoding the fusion protein may be promoter-adenine deaminase-nuclease-polyA, as long as it provides editing efficiency of a > G not lower than ABE8 e; wherein the promoter and the polyA may be conventional in the art.

The promoter may be CMV, or other types of spectroscopic and tissue specific promoters, such as CAG, PGK, EF1 α; muscle specific promoter Ctsk; liver-specific promoter Lp1, and the like.

The polyA can be bovine growth hormone polyadenylation signal BGH polyA or polyadenylation signals of other biological sources.

The sequence composition is CMV-adenine deaminase-Cas 9n-BGH polyA, for example.

The fourth aspect of the present invention provides an adenine base editing system comprising: sgRNA and an adenine base editor as described in the second aspect.

In some embodiments of the invention, the target sequence of the sgRNA is represented by the nucleotide sequence of SEQ ID nos. 4 to 15.

A fifth aspect of the invention provides a pharmaceutical composition comprising an adenine deaminase according to the first aspect, an adenine base editor according to the second aspect, a fusion protein according to the third aspect or an adenine base editing system according to the fourth aspect.

A sixth aspect of the present invention provides a base editing method for non-therapeutic purposes, the base editing method comprising:

expressing the adenine deaminase of the first aspect, the adenine base editor of the second aspect, the fusion protein of the third aspect, or the adenine base editing system of the fourth aspect in a target cell to allow base editing in the target cell, preferably further comprising adding a sgRNA having a target sequence as shown in the nucleotide sequence of SEQ ID nos. 4 to 15.

In some embodiments of the invention, the source of the target cell is an isolated cell line.

In some preferred embodiments of the invention, the isolated cell line is 293T cell, HELA cell, U2OS cell, NIH3T3 cell or N2A cell.

In the present invention, the non-therapeutic purpose is to evaluate the adenine deaminase, adenine base editor, fusion protein or the adenine base editing system of the present invention by detecting the editing occurring in a target cell in a laboratory, for example. Conversely, the function of the target cell can be studied by base editing.

In the present invention, the base editing method may also be for therapeutic purposes. In the present invention, the treatment refers to the treatment of a disease in a subject, such as a human, including inhibiting the onset or progression of the disease, alleviating the symptoms of the disease, or curing the disease.

In the present invention, the target cell may be a eukaryotic cell, a prokaryotic cell, or an ancient cell different from a prokaryotic cell.

Preferably, the target cell may express the fusion protein according to the third aspect.

More preferably, the target cell may be a plant cell, a human cell or an animal cell.

The seventh aspect of the present invention provides the use of the adenine deaminase of the first aspect, the adenine base editor of the second aspect, the fusion protein of the third aspect or the adenine base editing system of the fourth aspect for the preparation of a base-edited medicament or for the preparation of a medicament for gene therapy.

An eighth aspect of the present invention provides use of the adenine deaminase of the first aspect, the adenine base editor of the second aspect, the fusion protein of the third aspect or the adenine base editing system of the fourth aspect for constructing animal models and breeding crops.

A ninth aspect of the invention provides use of an adenine deaminase according to the first aspect, an adenine base editor according to the second aspect, a fusion protein according to the third aspect or an adenine base editing system according to the fourth aspect for the preparation of a base editing tool.

On the basis of the common knowledge in the field, the above preferred conditions can be combined randomly to obtain the preferred embodiments of the invention.

The reagents and starting materials used in the present invention are commercially available.

The positive progress effects of the invention are as follows:

the adenine base editor can effectively destroy the nonspecific combination of adenine deaminase and a substrate base, narrow an editing window to 1-2 bases and maintain higher editing activity; structural pocket changes caused by mutation also make adenine deaminase unable to recognize cytosine as a substrate, and finally completely eliminate independent cytosine editing events existing in ABE; and the lower indel is kept, the safety is improved, the application of the method in the aspects of accurate medical treatment, animal disease model making, crop genetic breeding and the like can be promoted, and the method has great application value.

Drawings

FIG. 1 shows the crystal structure of ABE8e binding substrate DNA (PDB: 6 VPC).

FIG. 2 is a diagram showing the comparison result of A > G base editing of 21 ABE8e mutants at the FANCF site1 site on 293T.

FIG. 3 is a diagram showing the comparison result of A4 and C6 base editing of 21 ABE8e mutants at the FANCF site1 site on 293T.

FIG. 4 is a diagram showing the base editing comparison results of A > G, C > T, C > A generated by ABE8e and ABE8e-N108Q at 4 targets on 293T.

FIG. 5 is a schematic diagram showing the A > G base editing comparison results of 19 ABE8e combined mutations at ABE-site3 and ABE-site10 sites on 293T.

FIG. 6 is a graph showing the comparison of the editing efficiency of the A base and the C base realized by ABE9s and ABE9.1s at the ABE-site10 and HEK-site7 sites on 293T.

FIG. 7 is a graph showing the comparison of A > G editing efficiency achieved by ABE-site16, ABE-site17, ABE-site13 and ABE-site8 endogenous targets on 293T by ABE9s, ABE9.1s, ABE9.2s, ABE9.3s and ABE9.4s.

FIG. 8 is a graph showing the comparison of indels generated by ABE-site16, ABE-site17, ABE-site13 and ABE-site8 endogenous targets on 293T by ABE9s, ABE9.1s, ABE9.2s, ABE9.3s and ABE9.4s.

Detailed Description

The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. Experimental procedures without specifying specific conditions in the following examples were selected in accordance with conventional procedures and conditions, or in accordance with commercial instructions.

In the mutants used in the examples, codons encoding mutation sites are shown in table 1.

TABLE 1TadA Single Point mutation sequences

The targets used in the examples and their sequences are shown in Table 2.

Table 2 targets and sequences used

Name of target point	Sequence (5 '-3')	SEQ ID NO
			FANCF site1	GGAATCCCTTCTGCAGCACC	4
EGFR-library-sg4	AAGATCAAAGTGCTGGGCTC					5
			HBG-sg1	CTTGTCAAGGCTATTGGTCA	6
EMX1-sg2p	GACATCGATGTCCTCCCCAT	7
			HBG-sg8	CAGGACAAGGGAGGGAAGGA	8
ABE-site3	GTCAAGAAAGCAGAGACTGC	9
			ABE-site10	GAACATAAAGAATAGAATGA		10
HEK-site7	GGAACACAAAGCATAGACTG	11
			ABE-site16	GGGAATAAATCATAGAATCC	12
ABE-site17	GACAAAGAGGAAGAGAGACG	13
			ABE-site13	GAAGATAGAGAATAGACTGC	14
ABE-site8	GTAAACAAAGCATAGACTGA					15

The target identifying primers used in the examples are shown in Table 3.

Table 3 identifying primers for target

Wherein: f is a forward primer, and R is a reverse primer.

The seamless Cloning Kit used in the examples was Vazyme Clon express MultiS One Step Cloning Kit, C113-01.

The HEK293T cells used in the examples were the ATCC CRL-3216 cell line.

The nucleotide sequence of the plasmid U6-sgRNA-EF1 alpha-GFP used in the examples is shown in SEQ ID NO 40, wherein the coding sequence of the sgRNA targeting the target sequence is indicated by the consecutive N.

The service provider for sequencing in the examples was Jinzhi Biotechnology, inc., suzhou.

Example 1

1.1 plasmid design and construction

1.1.1 As shown in FIG. 1, according to the crystal structure of ABE8e binding substrate DNA captured by a cryoelectron microscope, 21 single-point mutants of ABE8e (shown in Table 1) were designed, and 1 human endogenous test target FANCF site1 (shown in Table 2) was designed for screening evaluation.

1.1.2 Synthesis of 21 ABE8e single-point mutants according to the sequence in Table 1, ABE8e as vector, followed by seamless cloning and assembly, i.e., two oligos were synthesized according to Table 2, plus CACC on the plus strand and AAAC on the minus strand, and ligated to U6-sgRNA-EF 1. Alpha. -GFP that had been digested with BbsI.

1.1.3 the plasmids constructed in 1.1.1 and 1.1.2 were sequenced by sanger, ensuring the sequence is completely correct.

1.2 transfection of cells

Day 1: seeding 24-well plates with 293T cells

(1) HEK293T cells were digested at 2X 10 ⁵ cells/well were seeded in 96-well plates.

Note that: after the cells are recovered, the cells are generally required to be passaged by 2 times and can be used for transfection experiments.

Day 2: transfection

(2) The cell state of each well was observed.

Note that: the cell density before transfection is required to be 70% -90%, and the state is normal.

(3) Plasmid transfection amounts were as follows (ABE 8e as control):

ABE8e single point mutants: U6-sgRNA-EF1 α -GFP =750ng

Set n =3 wells/group.

1.3 genome extraction and preparation of amplicon libraries

At 72h post-transfection, cell genomic DNA was extracted using a Tiangen cell genome extraction kit (DP 304). Then, the corresponding identifying primer (shown in Table 3) is designed by using the operation flow of the Hi-Tom Gene edition Detection Kit (Nozawa genesis), i.e., the 5 'end of the forward primer is added with the bypass sequence 5' ggagtgactggtgc-3 '(SEQ ID NO: 41), the 5' end of the reverse primer is added with the bypass sequence 5 'gagtttggatgcttggatgg-3' (SEQ ID NO: 42), so as to obtain a primary PCR product, and then the primary PCR product is used as a template to perform secondary PCR to obtain a secondary PCR product, and then the secondary PCR product is mixed together to perform gel cutting, recovery and purification, and then sent to a company for sequencing.

1.4 deep sequencing results analysis and statistics

The deep sequencing results were analyzed using the BE-analyzer website (http:// www.rgenom. Net/BE-analyzer/#!), i.e., the ratios of statistics A > G, C > T, C > G, C > A, indel were plotted statistically using Graphpad Prism 9.1.0, as shown in Table 4 and FIGS. 2-4.

1.5 analysis of results

As shown in table 4 and figure 2, according to Sanger results, ABE8e-L145T, ABE8e-L145Q, ABE8e-N108Q and ABE8e-F84T all significantly reduced the editing of bystander A3 while maintaining the editing efficiency of the targeted base A4 among 21 single point mutants of ABE8 e.

TABLE 4 editing efficiency results for target FANCF site1 (unit,%)

As shown in fig. 3, depth sequencing evaluated the bystander C6 editing, the bystander cytosine editing produced by ABE8e was 45.2% (C > G + C > T + C > a), while the editing efficiencies produced by the four single point mutants were only 5.07%, 3.67%, 2.44%, and 2.93%, respectively, with ABE8e-N108Q reducing the most 94.6% of the harmful cytosine editing.

As shown in FIG. 4, ABE8e-N108Q was selected to be verified again at four other endogenous targets (EGFR-library-sg 4, HBG1-sg1, EMX1-sg2p, HBG-sg 8), and the results showed that: ABE8e as a control, ABE8e-N108Q reduced bystander cytosine editing from 13.7% to 3.13% for the EGFR-library-sg4 target, 5.17% from 16.4% for the HBG-sg1 target, 1.9% from 14.5% for the EMX1-sg2P target, and 1.2% from 9.33% for the HBG-sg8 target.

Taken together, ABE8e-L145T, ABE8e-L145Q, ABE8e-N108Q, and ABE8e-F84T all significantly reduced bystander adenine editing and bystander cytosine editing.

Example 2

This embodiment was designed to completely eliminate bystander cytosine editing and to achieve precise editing of a single a > G.

2.1 plasmid design and construction

2.1.1 based on the screening results of single point mutation in example 1, amino acid sites potentially affecting the substrate structure were synthesized by combinatorial mutagenesis again based on the crystal structure of ABE8e for seamless clonal assembly. Simultaneously designing 2 endogenous test targets ABE site10 and ABE site3 rich in poly A for testing (as shown in Table 2), and constructing the method to be the same as that of

1.1.2。

2.1.2 the plasmid constructed in 2.1.1 was sequenced by sanger, ensuring complete correctness.

2.2 transfection of cells

Day 1: seeding 24-well plates with 293T cells

Note that: after the cells are recovered, the cells are generally passaged 2 times and can be used for transfection experiments.

Day 2: transfection

(2) The cell state of each well was observed.

(3) The plasmid transfection amount was as follows (ABE 8e as control)

2.1 plasmid newly constructed: U6-sgRNA-EF1 α -GFP =750ng

Set n =3 wells/group.

2.3 genome extraction and preparation of amplicon libraries

At 72h after transfection, cell genomic DNA was extracted using a Tiangen cell genome extraction kit (DP 304). Then, the operation flow of the Hitom kit is used for designing corresponding identification primers (shown in table 3), namely, a bridging sequence shown as SEQ ID NO:38 is added to the 5 'end of the forward primer, a bridging sequence shown as SEQ ID NO:39 is added to the 5' end of the reverse primer, a round of PCR product is obtained, then, the round of PCR product is used as a template, two rounds of PCR products are obtained, and then, the round of PCR products are mixed together for gel cutting, recovery and purification and then sent to a company for sequencing.

2.4 deep sequencing results analysis and statistics

The deep sequencing results, i.e.the ratios of statistics A > G, C > T, C > G, C > A, indel, were analyzed using the BE-analyzer website (http:// www.rgenom. Net/BE-analyzer/#!) and statistically plotted using Graphpad Prism 9.1.0.

2.5 analysis of results

As shown in FIG. 5, according to the Sanger results, N108Q-L145T, N108Q-P29M, N108Q-P29W and N108Q-F84T showed extremely narrow editing windows in the 19 combination mutations, targeting a range of about 1 to 2 bases. For the ABE site3 target, the editing range of ABE8e is 5 bases, while the reported F148A mutation with the potential of narrowing the window has 4 bases, the editing range of ABE8e-N108Q editing window is 3 bases, and the four combined mutations only edit 1 base, and efficiently and accurately edit A5. Similarly, for the ABE site10 target point, ABE8e covers 7 bases, the ABE8e-F148A targeting region is 4 bases, for single-point mutation ABE8e-N108Q, the editing range is still 3 bases, the editing range of N108Q-L145T and N108Q-P29M is 2 bases, the fifth A is efficiently catalyzed, N108Q-P29W and N108Q-F84T accurately edit 1 base A5, and the editing activity is only partially reduced. For convenience of description, ABE8e-N108Q is named as ABE9s, and N108Q-L145T, N108Q-P29M, N108Q-P29W and N108Q-F84T are named as ABE9.1s, ABE9.2s, ABE9.3s and ABE9.4s in this order. The editing windows of ABE9.1s, ABE9.2s, ABE9.3s and ABE9.4s are about 1 to 2 bases, and the selectivity of adenine editing is strict in order.

As shown in fig. 6, the bystander cytosine editing features of the combinatorial mutations were again evaluated using ABE9.1s as an example, ABE site10 and a newly designed endogenous target HEK site7 as evaluation targets. The results show that ABE9.1s completely eliminated the detrimental cytosine editing compared to ABE9s, while narrowing the window to 1-2 bases and preferentially editing A5/A6 bases.

In conclusion, the combined mutations N108Q-L145T, N108Q-P29M, N108Q-P29W and N108Q-F84T of ABE8e can accurately edit 1-2 bases, and at the same time, harmful cytosine editing is completely eliminated.

Example 3

This example was designed to compare the operating characteristics of abe9.1s, abe9.2s, abe9.3s and abe9.4s.

3.1 plasmid design and construction

3.1.1 with ABE8e and ABE9s as controls, 4 additional targets ABE-site16, ABE-site17, ABE-site13 and ABE-site8 (as shown in Table 2) were designed for evaluation.

3.1.2 the plasmid constructed in 3.1.1 was sequenced by sanger, ensuring complete correctness.

3.2 transfection of cells

Day 1: seeding 24-well plates with 293T cells

Day 2: transfection

(2) The cell status of each well was observed.

(3) Plasmid transfection amounts were as follows (ABE 8e as control):

3.1 newly constructed plasmid: U6-sgRNA-EF1 α -GFP =750ng

Set n =3 wells/group.

3.3 genome extraction and preparation of amplicon libraries

At 72h after transfection, cell genomic DNA was extracted using a Tiangen cell genome extraction kit (DP 304). Then, the operation flow of the Hitom kit is used for designing corresponding identification primers (shown in table 3), namely, a bridging sequence shown as SEQ ID NO:38 is added to the 5 'end of the forward primer, a bridging sequence shown as SEQ ID NO:39 is added to the 5' end of the reverse primer, a round of PCR product is obtained, then, the round of PCR product is used as a template, two rounds of PCR products are obtained, and the two rounds of PCR products are mixed together for gel cutting, recovery and purification and then sent to a company for sequencing.

3.4 analysis and statistics of deep sequencing results

The deep sequencing results were analyzed using the BE-analyzer website (http:// www.rgenom. Net/BE-analyzer/#!), i.e., the ratios of A > G, C > T, C > G, C > A, indel were counted and plotted statistically using Graphpad Prism 9.1.0.

3.5 analysis of results

As shown in FIG. 7, at the ABE site16 site, the corresponding ABE8e editing window is-5 bases, ABE9s can cover-4 bases, and ABE9.1s, ABE9.2s, ABE9.3s and ABE9.4s only edit 1-2 bases; at the ABE site13 and ABE site13 sites, ABE8e edits ranged from-5 bases and ABE9s covered 3-4 bases, while the three variants, ABE9.1s, ABE9.2s, ABE9.3s and ABE9.4s, all edited for only one base except for ABE9.1s for minor A7 or A4 edits. For the ABE site17 site, ABE8e edits range to 6 bases, ABE9s edits range to 3 bases, ABE9.1s and ABE9.2s mainly edit 2 bases (A5/A6), ABE9.3s and ABE9.4s still edit a single base precisely.

In conclusion, ABE9s can slightly narrow the editing range, whereas ABE9.1s, ABE9.2s, ABE9.3s, ABE9.4s accurately edit 1-2 bases while keeping indel events low (as shown in fig. 8).

SEQUENCE LISTING

<110> university of east China

Shanghai Bangyao Biological Technology Co.,Ltd.

<120> adenine deaminase, adenine base editor comprising same, and use thereof

<130> P21016504C

<160> 42

<170> PatentIn version 3.5

<210> 1

<211> 167

<212> PRT

<213> Artificial Sequence

<220>

<223> TadA

<400> 1

Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu

1 5 10 15

Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg Glu Val Pro Val Gly Ala

20 25 30

Val Leu Val Leu Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Ala

35 40 45

Ile Gly Leu His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg

50 55 60

Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu

65 70 75 80

Tyr Val Thr Phe Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His

85 90 95

Ser Arg Ile Gly Arg Val Val Phe Gly Val Arg Asn Ser Lys Arg Gly

100 105 110

Ala Ala Gly Ser Leu Met Asn Val Leu Asn Tyr Pro Gly Met Asn His

115 120 125

Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu

130 135 140

Leu Cys Asp Phe Tyr Arg Met Pro Arg Gln Val Phe Asn Ala Gln Lys

145 150 155 160

Lys Ala Gln Ser Ser Ile Asn

165

<210> 2

<211> 501

<212> DNA

<213> Artificial Sequence

<220>

<223> TadA

<400> 2

atgtctgagg tggagttttc ccacgagtac tggatgagac atgccctgac cctggccaag 60

agggcacggg atgagaggga ggtgcctgtg ggagccgtgc tggtgctgaa caatagagtg 120

atcggcgagg gctggaacag agccatcggc ctgcacgacc caacagccca tgccgaaatt 180

atggccctga gacagggcgg cctggtcatg cagaactaca gactgattga cgccaccctg 240

tacgtgacat tcgagccttg cgtgatgtgc gccggcgcca tgatccactc taggatcggc 300

cgcgtggtgt ttggcgtgag gaactcaaaa agaggcgccg caggctccct gatgaacgtg 360

ctgaactacc ccggcatgaa tcaccgcgtc gaaattaccg agggaatcct ggcagatgaa 420

tgtgccgccc tgctgtgcga tttctatcgg atgcctagac aggtgttcaa tgctcagaag 480

aaggcccaga gctccatcaa c 501

<210> 3

<211> 18

<212> PRT

<213> Artificial Sequence

<220>

<223> Nuclear localization Signal sequence

<400> 3

Lys Arg Thr Ala Asp Gly Ser Glu Phe Glu Ser Pro Lys Lys Lys Arg

1 5 10 15

Lys Val

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> FANCF site1

<400> 4

ggaatccctt ctgcagcacc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> EGFR-library-sg4

<400> 5

aagatcaaag tgctgggctc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> HBG-sg1

<400> 6

cttgtcaagg ctattggtca 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> EMX1-sg2p

<400> 7

gacatcgatg tcctccccat 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> HBG-sg8

<400> 8

caggacaagg gagggaagga 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site3

<400> 9

gtcaagaaag cagagactgc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site10

<400> 10

gaacataaag aatagaatga 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> HEK-site7

<400> 11

ggaacacaaa gcatagactg 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site16

<400> 12

gggaataaat catagaatcc 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site17

<400> 13

gacaaagagg aagagagacg 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site13

<400> 14

gaagatagag aatagactgc 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site8

<400> 15

gtaaacaaag catagactga 20

<210> 16

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> FANCF site1-F

<400> 16

ggagtgagta cggtgtgcaa ggaacacgga taaagacgct ggg 43

<210> 17

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> FANCF site1-R

<400> 17

gagttggatg ctggatggta ggtagtgctt gagaccgcca gaa 43

<210> 18

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> EGFR-library-sg4-F

<400> 18

ggagtgagta cggtgtgcct tgtggagcct cttacaccca gtg 43

<210> 19

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<223> EGFR-library-sg4-R

<400> 19

gagttggatg ctggatggct ccccaccaga ccatgagagg c 41

<210> 20

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> HBG-sg1-F

<400> 20

ggagtgagta cggtgtgctg gaatgactga atcggaacaa ggc 43

<210> 21

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> HBG-sg1-R

<400> 21

gagttggatg ctggatggct ggcctcactg gatactctaa gact 44

<210> 22

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> EMX1-sg2p-F

<400> 22

ggagtgagta cggtgtgcgt ggttccagaa ccggaggaca aag 43

<210> 23

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> EMX1-sg2p-R

<400> 23

gagttggatg ctggatgggt ttgtggttgc ccaccctagt cat 43

<210> 24

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> HBG-sg8-F

<400> 24

ggagtgagta cggtgtgctg gggcaaggtg aatgtggaag atg 43

<210> 25

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> HBG-sg8-R

<400> 25

gagttggatg ctggatggaa cctctgggtc catgggtaga caa 43

<210> 26

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site3-F

<400> 26

ggagtgagta cggtgtgctg tcttcccttt cccttttcct cacc 44

<210> 27

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site3-R

<400> 27

gagttggatg ctggatggaa ttgaggctca gaggagatgt gcc 43

<210> 28

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site10-F

<400> 28

ggagtgagta cggtgtgcta cattaaccat ccccacatta tcc 43

<210> 29

<211> 45

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site10-R

<400> 29

gagttggatg ctggatggag ggaactagat gttatgttta ggtga 45

<210> 30

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> HEK-site7-F

<400> 30

ggagtgagta cggtgtgctg aatggattcc ttggaaacaa tgat 44

<210> 31

<211> 41

<212> DNA

<213> Artificial Sequence

<220>

<223> HEK-site7-R

<400> 31

gagttggatg ctggatggtg tcaaactgtg cgtatgacat c 41

<210> 32

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site16-F

<400> 32

ggagtgagta cggtgtgcta caattctgac cccatgcacc ctc 43

<210> 33

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site16-R

<400> 33

gagttggatg ctggatggat gccagatacc agcaatccag caa 43

<210> 34

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site17-F

<400> 34

ggagtgagta cggtgtgcct caagcctgat tccaaggaga ttg 43

<210> 35

<211> 39

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site17-R

<400> 35

gagttggatg ctggatggtc cctcctctgc gtgaatttg 39

<210> 36

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site13-F

<400> 36

ggagtgagta cggtgtgcca tcaatcaact tctctttctc tccc 44

<210> 37

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site13-R

<400> 37

gagttggatg ctggatggat atcacttcag cccaggagta taac 44

<210> 38

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site8-F

<400> 38

ggagtgagta cggtgtgcct gctgccgtgg gagacaattc ata 43

<210> 39

<211> 43

<212> DNA

<213> Artificial Sequence

<220>

<223> ABE-site8-R

<400> 39

gagttggatg ctggatggag ctgttgcatg aggaaaggga cta 43

<210> 40

<211> 2340

<212> DNA

<213> Artificial Sequence

<220>

<223> U6-sgRNA-EF1α-GFP

<220>

<221> misc_feature

<222> (250)..(269)

<223> n is a, c, g, or t

<400> 40

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattagaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccn nnnnnnnnnn nnnnnnnnng ttttagagct agaaatagca agttaaaata 300

aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt ttaggcctga 360

attctgcaga tatccatcac actggcggct ccggtgcccg tcagtgggca gagcgcacat 420

cgcccacagt ccccgagaag ttggggggag gggtcggcaa ttgaaccggt gcctagagaa 480

ggtggcgcgg ggtaaactgg gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg 540

gtgggggaga accgtatata agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt 600

ttgccgccag aacacaggta agtgccgtgt gtggttcccg cgggcctggc ctctttacgg 660

gttatggccc ttgcgtgcct tgaattactt ccactggctg cagtacgtga ttcttgatcc 720

cgagcttcgg gttggaagtg ggtgggagag ttcgaggcct tgcgcttaag gagccccttc 780

gcctcgtgct tgagttgagg cctggcctgg gcgctggggc cgccgcgtgc gaatctggtg 840

gcaccttcgc gcctgtctcg ctgctttcga taagtctcta gccatttaaa atttttgatg 900

acctgctgcg acgctttttt tctggcaaga tagtcttgta aatgcgggcc aagatctgca 960

cactggtatt tcggtttttg gggccgcggg cggcgacggg gcccgtgcgt cccagcgcac 1020

atgttcggcg aggcggggcc tgcgagcgcg gccaccgaga atcggacggg ggtagtctca 1080

agctggccgg cctgctctgg tgcctggcct cgcgccgccg tgtatcgccc cgccctgggc 1140

ggcaaggctg gcccggtcgg caccagttgc gtgagcggaa agatggccgc ttcccggccc 1200

tgctgcaggg agctcaaaat ggaggacgcg gcgctcggga gagcgggcgg gtgagtcacc 1260

cacacaaagg aaaagggcct ttccgtcctc agccgtcgct tcatgtgact ccacggagta 1320

ccgggcgccg tccaggcacc tcgattagtt ctcgagcttt tggagtacgt cgtctttagg 1380

ttggggggag gggttttatg cgatggagtt tccccacact gagtgggtgg agactgaagt 1440

taggccagct tggcacttga tgtaattctc cttggaattt gccctttttg agtttggatc 1500

ttggttcatt ctcaagcctc agacagtggt tcaaagtttt tttcttccat ttcaggtgtc 1560

gtgaaatacg actcactata gggagaccca agctggctag ttaagcttgg taccgccacc 1620

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 1680

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 1740

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 1800

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 1860

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 1920

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 1980

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 2040

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 2100

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 2160

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 2220

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 2280

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 2340

<210> 41

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> Positive primer end bridging sequence

<400> 41

ggagtgagta cggtgtgc 18

<210> 42

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> reverse primer end bridging sequence

<400> 42

gagttggatg ctggatgg 18

Claims

1. An adenine deaminase comprising one or more amino acid mutations at position 29, 84, 108 and 145 of the amino acid sequence as set forth in SEQ ID NO 1.

2. The adenine deaminase of claim 1, wherein said one or more amino acid mutations comprise:

the 145 th amino acid residue L is mutated into Q; or the like, or a combination thereof,

the 84 th amino acid residue F is mutated into T; or the like, or a combination thereof,

the 84 th amino acid residue F is mutated into T, and the 108 th amino acid residue N is mutated into Q; or the like, or, alternatively,

the 108 th amino acid residue N is mutated into Q, and the 145 th amino acid residue L is mutated into T; or the like, or a combination thereof,

the 108 th amino acid residue N is mutated into Q, and the 29 th amino acid residue P is mutated into W;

preferably, the adenine deaminase further comprises a nuclear localization signal sequence; the nuclear localization signal sequence is preferably shown as SEQ ID NO. 3.

3. An adenine base editor comprising a nuclease and an adenine deaminase of claim 1 or 2;

preferably, the nuclease is a Cas protein and variants thereof;

more preferably, the Cas protein is saccharomyces cerevisiae-derived spCas9, staphylococcus aureus-derived SaCas9, laccas 12a derived from lachnospiraceae bacteria, or enacas 12a derived from acidaminococcus bacteria; the Cas protein variant is VQR-spCas9, VRER-spCas9, sprY, spNG, saCas9-KKH or SaCas9-NG.

4. A fusion protein comprising the adenine deaminase of claim 1 or 2;

preferably, the fusion protein further comprises a nuclease, the nuclease is the nuclease in the adenine base editor of claim 3.

5. An adenine base editing system comprising: sgRNA and the adenine base editor of claim 3;

preferably, the target sequence of the sgRNA is shown as the nucleotide sequence of SEQ ID NO. 4-15.

6. A pharmaceutical composition comprising the adenine deaminase of claim 1 or 2, the adenine base editor of claim 3, the fusion protein of claim 4 or the adenine base editing system of claim 5.

7. A method of base editing for non-therapeutic purposes, the method comprising:

expressing the adenine deaminase of claim 1 or 2, the adenine base editor of claim 3, the fusion protein of claim 4, or the adenine base editing system of claim 5 in a target cell such that base editing occurs in said target cell;

preferably, the source of the target cells is an isolated cell line;

more preferably, the isolated cell line is a 293T cell, a HELA cell, a U2OS cell, an NIH3T3 cell or an N2A cell.

8. Use of the adenine deaminase of claim 1 or 2, the adenine base editor of claim 3, the fusion protein of claim 4 or the adenine base editing system of claim 5 in the manufacture of a medicament for base editing or in the manufacture of a medicament for gene therapy.

9. Use of the adenine deaminase of claim 1 or 2, the adenine base editor of claim 3, the fusion protein of claim 4 or the adenine base editing system of claim 5 in the construction of animal models and crop breeding.

10. Use of an adenine deaminase according to claim 1 or 2, an adenine base editor according to claim 3, a fusion protein according to claim 4 or an adenine base editing system according to claim 5 for the preparation of a base editing tool.