CN115747272A - Synthetic method of vitreous chromogen - Google Patents
Synthetic method of vitreous chromogen Download PDFInfo
- Publication number
- CN115747272A CN115747272A CN202211526457.7A CN202211526457A CN115747272A CN 115747272 A CN115747272 A CN 115747272A CN 202211526457 A CN202211526457 A CN 202211526457A CN 115747272 A CN115747272 A CN 115747272A
- Authority
- CN
- China
- Prior art keywords
- reaction
- solvent
- synthesizing
- intermediate product
- vitreous
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/55—Design of synthesis routes, e.g. reducing the use of auxiliary or protecting groups
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to a synthesis method of vitronectin, which comprises the following process steps: a synthetic method of a vitreous chromogen comprises the following process steps: step (1): mixing xylose, acetylacetone and an alkaline substance in a solvent, and heating to react to obtain a first intermediate product crude product; step (2): mixing potassium phosphate buffer solution, the first intermediate product crude product obtained in the step (1), reductase KRED2935 crude enzyme solution, glucose dehydrogenase, glucose and beta-nicotinamide adenine dinucleotide phosphate monosodium salt, converting for 1-2 hours at 25-35 ℃, adding ethyl acetate to terminate the reaction after the conversion is finished, extracting, combining organic phases, adding anhydrous sodium sulfate to dry, and then carrying out reduced pressure rotary evaporation to remove the solvent, thus obtaining the vitreous color factor. The method can obtain the vitreous color factor with high stereoselectivity, has high conversion rate, easily separates the obtained product, and overcomes the problems of low stereoselectivity and difficult process scale-up production of the existing route.
Description
Technical Field
The invention relates to a synthesis method of vitronectin.
Background
Vitronectin (Pro-XylaneeTM), chemically known as hydroxypropyl tetrahydropyrane triol, is a xylose derivative with anti-aging activity and is commonly used in cosmetics. Boseine is a xylose derivative with the functions of beautifying and resisting wrinkles, which is discovered by Erlaiya for years, is converted from xylose and has wide biological activity. The vitreous chromogen can directly influence extracellular matrix in three-layer structure of skin, activate or promote synthesis of mucopolysaccharide (GAGs) in skin, improve adhesion degree between dermis and epidermis, promote regeneration of damaged tissue, help maintain elasticity of dermis, effectively keep skin compact and delicate, and delay skin aging.
According to the papers and patents reported by Eriya company, the preparation of the boscalid is completed by two steps, in the step 1, D-xylose is used as a raw material, sodium bicarbonate is used as alkali, water is used as a solvent, stirring and reacting are carried out for 6 hours at the temperature of 90 ℃, acetylacetone and xylose are condensed, cyclized and cracked, and the beta-acetone xyloside is obtained with high yield. And step 2, reducing the beta-acetone xyloside by using sodium borohydride to obtain the vitreous chromogen. Among them, selective reduction of β -acetone xyloside is a difficult point. The stereoselectivity of the reduced ketocarbonyl group by the traditional chemical method is poor, a pair of diastereoisomers is obtained, and the separation is very difficult. In addition, sodium borohydride or lithium borohydride and the like are used as reducing agents to reduce ketone carbonyl in beta-acetone xyloside, a large amount of boric acid is generated as a byproduct, the boric acid is easy to be purified by column chromatography due to hinge with glass color of polyhydroxy, mass production is not easy, and reducing reagents are dangerous and can introduce a large amount of pollutants. If other homogeneous metal catalysts are adopted, metal residues of products are inevitably increased, and the products are also difficult to purify.
Disclosure of Invention
The invention aims to provide a synthesis method of a vitreous chromogen, which can be used for reducing beta-acetone xyloside by utilizing reductase in a stereospecific manner to obtain the vitreous chromogen, has high conversion rate and mild reaction and is suitable for industrial amplification production.
The purpose of the invention is realized by the following technical scheme:
a synthetic method of a vitreous chromogen comprises the following process steps:
step (1): mixing xylose, acetylacetone and an alkaline substance in a solvent, and heating for reaction to obtain a first intermediate product crude product;
step (2): mixing potassium phosphate buffer solution, the first intermediate product crude product obtained in the step (1), reductase KRED2935 crude enzyme solution, glucose dehydrogenase, glucose and reduced beta-nicotinamide adenine dinucleotide disodium phosphate tetrasodium (NADPH), converting at 25-35 ℃ for 1-2h, adding 10% NaOH aqueous solution every 30min in the reaction process to adjust the pH of the system to 8.0, after the conversion is finished, adding ethyl acetate to terminate the reaction, extracting, combining organic phases, adding anhydrous sodium sulfate to dry, and then decompressing and rotary steaming to remove the solvent, thus obtaining the vitreous chromogen.
Wherein the reaction temperature in the step (1) is 60-70 ℃, the reaction time is 18-20h, after the heating reaction is finished, the pH value of the reaction solution is adjusted to be neutral by using 4N HCl, and the solvent is removed to obtain a first intermediate product crude product.
The solvent in the step (1) is methanol.
The alkaline substance is one or a mixture of more of sodium bicarbonate, potassium bicarbonate, sodium carbonate and potassium carbonate.
The alkaline substance is sodium carbonate, and the molar ratio of xylose to sodium carbonate is 1:1.2 to 2.
The molar ratio of xylose to acetylacetone is 1:1.2 to 1.5.
The specific method of the step (2) is as follows: the specific method of the step (2) is as follows: adding 20g of the crude first intermediate product obtained in the step (1), 10g of reductase KRED2935 crude enzyme liquid, 5000U of glucose dehydrogenase, 30g of glucose and 2.0g of reduced beta-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) into 1L of 0.1M potassium phosphate buffer solution with the pH of 8.0, converting at 28 ℃ for 1.5h, adding 10% NaOH aqueous solution every 30min during the reaction to regulate the pH of the system to 8.0, adding ethyl acetate to terminate the reaction after the conversion is finished, extracting, combining organic phases, adding anhydrous sodium sulfate to dry, and then carrying out reduced pressure rotary evaporation to remove the solvent, thus obtaining the vitrochromic.
The synthetic route of the method is as follows:
compared with the prior art, the invention has the advantages that:
1. according to the invention, the reductase KRED2935 is used for reducing the first intermediate product, namely the beta-xyloside acetonide, so that the vitreous color factor can be obtained with high stereoselectivity, the conversion rate is high, the conversion efficiency is high, 20g of the beta-xyloside acetonide crude product can be completely converted within 1.5h in reaction, the obtained product is easy to separate, and the problems of low stereoselectivity and difficulty in amplified production of the process in the conventional route are solved.
2. In addition, by using the reductase KRED2935 and under the action of glucose dehydrogenase, glucose and reduced beta-nicotinamide adenine dinucleotide disodium phosphate tetrasodium (NADPH), the vitronectin can be efficiently prepared without adding a reducing agent in the whole reaction, and the production cost is reduced. And the whole reaction is mild, and almost no high-pollution and dangerous reagent is used, so that the method is suitable for industrial large-scale production of the vitreous color factor.
Detailed Description
The present invention will be described in detail with reference to the following examples:
example 1: preparation of beta-acetonyloside (i.e. first intermediate):
adding 180mL of methanol, 38.16g (0.36 mol) of sodium carbonate, 30g (0.2 mol) of xylose and 26g (0.24 mol) of acetylacetone into a reaction flask in sequence, reacting at 65 ℃ for 20 hours, adjusting the pH to 7 by using 4N HCl, and spin-drying to obtain a first intermediate crude product, namely a crude product of beta-xylopyranoside, wherein MS (ESI) is as follows: 191.11[ M ] C + H] + 。
Example 2: preparation of vitriol:
the specific method of the step (2) comprises the following steps: 20g of the crude first intermediate product obtained in the step (1), 10g of reductase KRED2935 crude enzyme solution, 5000U of glucose dehydrogenase, 30g of glucose and 2.0g of reduced beta-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) are sequentially added into 1L of 0.1M potassium phosphate buffer solution with the pH value of 8.0, the crude enzyme solution is converted for 1.5h at the temperature of 28 ℃,10g of NaOH aqueous solution is added every 30min in the reaction process to adjust the pH value of the system to 8.0, after the conversion is finished, ethyl acetate is added to terminate the reaction, extraction is carried out, organic phases are combined, anhydrous sodium sulfate is added to dry, and then the solvent is removed by reduced pressure rotary evaporation, so that 18.5g of the vitreous chromogen is obtained. MS (ESI): m/z:193.03[ 2 ] M + H] + . By referring to a traditional conversion rate detection method and a product ee value determination method, detection shows that 20g of the crude beta-xylopyranoside can be completely converted within 1.5h, and the ee value of the product is more than 99.9%.
Wherein, the reductase KRED2935 has the following gene sequence and amino acid sequence:
reductase KRED2935 gene sequence:
ATGAACAGAAAAAATGAATATGCGCTGGTTACGGGAGCAACCAGCGGGATCGGCTATGAACTTGCAAAACAGTTTGCAAGCAACGGATATGATCTTGTGATGGTTGCCCGCAATCATGATGAGCTGAAAACAAGAGCCGATGAATTTAAA AGTTTCGGCA TTAATGTAAT TACCATCGCTAAAAATCTTT TTATTGAAGA AGACGCCTATTCTTTATATTCTGAATTAAAATTAAACGGTATCAGTCCTTCAATCCTTGTGAACGATGCAGGGCAGGGCGTTTATGGAAAATTTCAGGATACGGATCTGCACCGTGAAGTAGATATTGTTAATCTGAATATCGTTTCTGTCCTTATTTTGACCAAAATGTTTTTGAAAGACCGCTTACCGAAAGGTTCCGGAAAGATCCTGAATCTGGCTTCTATTGCAAGTAAGGCTCCGGGTCCGTGGCATTCGGTGTATCATGGGACCAAAGCATTTGTTTTATCTTGGTCGGAAGCCATTAGAGAAGAATTGAAAGATACCGGAATTACAGTAACAGCCTTATTAC CCGGGCCTACGGATACGGATTTCTTCAATAAAGCAGATATGAATGAAAGTAAGATCCTGGAAGATAAGGACAATCTTGCATCACCGGAAGAAGTAGCTATTGATGGTTTTAATGCCTTAATGAATGGTGATGACAAAGTAGTTTCGGGATTAAAAAATAAACTCACCGTAGCCATGTCGAATATTGCAACAGACAGCATGGCCGCACACAGAATGGGAGA AATGCAAAAACCGGTCAATG AAAAATAG
amino acid sequence of reductase KRED 2935:
Met Asn Arg Lys Asn Glu Tyr Ala Leu Val Thr Gly Ala Thr Ser Gly Ile Gly TyrGlu Leu Ala Lys Gln Phe Ala Ser Asn Gly Tyr Asp Leu Val Met Val Ala Arg Asn HisAsp Glu Leu Lys Thr Arg Ala Asp Glu Phe Lys Ser Phe Gly Ile Asn Val Ile Thr IleAla Lys Asn Leu Phe Ile Glu Glu Asp Ala Tyr Ser Leu Tyr Ser Glu Leu Lys Leu AsnGly Ile Ser Pro Ser Ile Leu Val Asn Asp Ala Gly Gln Gly Val Tyr Gly Lys Phe GlnAsp Thr Asp Leu His Arg Glu Val Asp Ile Val Asn Leu Asn Ile Val Ser Val Leu IleLeu Thr Lys Met Phe Leu Lys Asp Arg Leu Pro Lys Gly Ser Gly Lys Ile Leu Asn LeuAla Ser Ile Ala Ser Lys Ala Pro Gly Pro Trp His Ser Val Tyr His Gly Thr Lys Ala PheVal Leu Ser Trp Ser Glu Ala Ile Arg Glu Glu Leu Lys Asp Thr Gly Ile Thr Val ThrAla Leu Leu Pro Gly Pro Thr Asp Thr Asp Phe Phe Asn Lys Ala Asp Met Asn GluSer Lys Ile Leu Glu Asp Lys Asp Asn Leu Ala Ser Pro Glu Glu Val Ala Ile Asp GlyPhe Asn Ala Leu Met Asn Gly Asp Asp Lys Val Val Ser Gly Leu Lys Asn Lys LeuThr Val Ala Met Ser Asn Ile Ala Thr Asp Ser Met Ala Ala His Arg Met Gly Glu MetGln Lys Pro Val Asn Glu Lys
corresponding sequences of reductase KRED2935 are synthesized by a gene synthesis company, an escherichia coli expression system is constructed by a conventional technical means, and the reductase KRED2935 overexpression wet cells are obtained through expression. Taking fresh reductase KRED2935 bacterial cells to be resuspended in potassium phosphate buffer solution (0.1M, pH8.0), breaking the cells by a homogenizer, centrifuging at 15000rpm and 4 ℃ for 30min, and obtaining supernatant which is reductase KRED2935 crude enzyme liquid.
Example 3: comparative experiment:
the inventor of the invention also tries to prepare the vitronectin by reducing the crude product of the first intermediate product by other reductase. Such as reductases ChKRED20 (NCBI accession No.: KC 342020), chKRED07 (NCBI accession No.: KC 342007), chKRED03 (NCBI accession No.: KC 342003), etc.
The inventor entrusts a gene synthesis company to synthesize sequences corresponding to the enzymes respectively, constructs an escherichia coli expression system by a conventional technical means, obtains corresponding enzyme overexpression wet cells through expression, then prepares corresponding somatic cells into corresponding crude reductase enzyme liquid, and reduces a first intermediate product by using the crude reductase enzyme liquid, wherein the specific method refers to the method in example 2:
20g of the crude first intermediate product obtained as described in example 1, 10g of crude reductase enzyme, 4000U of glucose dehydrogenase, 50g of glucose, 2.0g of reduced beta-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) were added to 1L of 0.1M potassium phosphate buffer solution with pH8.0 in this order, and the mixture was converted at 28 ℃ for 1.5 hours, 10 parts of aqueous NaOH solution was added every 30min during the reaction to adjust the pH of the system to 8.0, after the conversion was completed, ethyl acetate was added to terminate the reaction, extraction was performed, the organic phases were combined, anhydrous sodium sulfate was added to dry, then the solvent was removed by reduced pressure rotary evaporation, isopropanol (HPLC grade) was added to dissolve the corresponding product, the conversion of the product and the ee value of the product were determined by HPLC after high speed centrifugation, and the conversion and the ee value are shown in Table 1:
TABLE 1
| Reductase | Conversion rate% | ee value% |
| KRED2935 | >99 | >99.9 |
| ChKRED20 | 48 | 92 |
| ChKRED07 | 85 | 96 |
| ChKRED03 | 89 | 99 |
From the above data, it is clear that vitronectin can be obtained by reducing the first intermediate product by the above-mentioned reductases, but the conversion effect and stereoselectivity of each reductase are significantly different. The reductase KRED2935 can be effectively used for preparing the vitronectin, and the problems of low stereoselectivity and difficulty in amplified production of the prior route are solved. The inventors also performed similar tests for some enzymes other than the reductases ChKRED20 (NCBI accession No. KC 342020), chKRED07 (NCBI accession No. KC 342007), chKRED03 (NCBI accession No. KC 342003), but all did not perform as well as the reductases KRED2935. Therefore, the reductase KRED2935 is expected to be a high-efficiency reductase in the preparation process of the vitronectin, so that the synthesis of the vitronectin can be amplified and produced.
In addition, by using the reductase KRED2935 and under the action of glucose dehydrogenase, glucose and reduced beta-nicotinamide adenine dinucleotide disodium phosphate tetrasodium (NADPH), the vitronectin can be efficiently prepared without adding a reducing agent in the whole reaction, and the production cost is reduced. And the whole reaction is mild, and almost no high-pollution and dangerous reagent is used, so that the method is suitable for industrial production of the vitronectin.
The above description is only for the preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art should be considered to be within the technical scope of the present invention, and the technical solutions and the inventive concepts thereof according to the present invention should be equivalent or changed within the scope of the present invention.
Claims (7)
1. A synthesis method of a vitreous chromogen is characterized by comprising the following steps: the method comprises the following process steps:
step (1): mixing xylose, acetylacetone and an alkaline substance in a solvent, and heating to react to obtain a first intermediate product crude product;
step (2): mixing potassium phosphate buffer solution, the first intermediate product crude product obtained in the step (1), reductase KRED2935 crude enzyme solution, glucose dehydrogenase, glucose and reduced beta-nicotinamide adenine dinucleotide disodium phosphate tetrasodium (NADPH), converting at 25-35 ℃ for 1-2h, adding 10% NaOH aqueous solution every 30min in the reaction process to adjust the pH of the system to 8.0, after the conversion is finished, adding ethyl acetate to terminate the reaction, extracting, combining organic phases, adding anhydrous sodium sulfate to dry, and then decompressing and rotary steaming to remove the solvent, thus obtaining the vitreous chromogen.
2. The method for synthesizing boscalid according to claim 1, characterized in that: and (2) the reaction temperature in the step (1) is 60-70 ℃, the reaction time is 18-20h, after the heating reaction is finished, the pH value of the reaction solution is adjusted to be neutral by using 4N HCl, and the solvent is removed to obtain a first intermediate product crude product.
3. The method for synthesizing boscalid according to claim 1, characterized in that: the solvent in the step (1) is methanol.
4. The method for synthesizing boscalid according to claim 1, characterized in that: the alkaline substance is one or a mixture of more of sodium bicarbonate, potassium bicarbonate, sodium carbonate and potassium carbonate.
5. The method for synthesizing boscalid according to claim 4, characterized in that: the alkaline substance is sodium carbonate, and the molar ratio of xylose to sodium carbonate is 1:1.2 to 2.
6. The method for synthesizing a vitreous chromogen according to claim 1, wherein: the molar ratio of xylose to acetylacetone is 1:1.2 to 1.5.
7. The method for synthesizing boscalid according to claim 1, characterized in that: the specific method of the step (2) is as follows: adding 20g of the crude first intermediate product obtained in the step (1), 10g of reductase KRED2935 crude enzyme liquid, 5000U of glucose dehydrogenase, 30g of glucose and 2.0g of reduced beta-nicotinamide adenine dinucleotide disodium tetrasodium phosphate (NADPH) into 1L of 0.1M potassium phosphate buffer solution with the pH of 8.0, converting at 28 ℃ for 1.5h, adding 10% NaOH aqueous solution every 30min during the reaction to regulate the pH of the system to 8.0, adding ethyl acetate to terminate the reaction after the conversion is finished, extracting, combining organic phases, adding anhydrous sodium sulfate to dry, and then carrying out reduced pressure rotary evaporation to remove the solvent, thus obtaining the vitrochromic.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211526457.7A CN115747272A (en) | 2022-11-30 | 2022-11-30 | Synthetic method of vitreous chromogen |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211526457.7A CN115747272A (en) | 2022-11-30 | 2022-11-30 | Synthetic method of vitreous chromogen |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115747272A true CN115747272A (en) | 2023-03-07 |
Family
ID=85341794
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211526457.7A Pending CN115747272A (en) | 2022-11-30 | 2022-11-30 | Synthetic method of vitreous chromogen |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115747272A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116904543A (en) * | 2023-09-07 | 2023-10-20 | 云合(天津)生物技术有限公司 | Application of dehydrogenase in synthesis of R-configuration vitronectin and synthesis method |
| CN116926028A (en) * | 2023-09-07 | 2023-10-24 | 云合(天津)生物技术有限公司 | Dehydrogenase mutant and application thereof in synthesis of S-vitronectin |
| CN118147250A (en) * | 2024-05-11 | 2024-06-07 | 成都格纯生物医药有限公司 | Method for preparing vitronectin from recombinant fusion protein |
-
2022
- 2022-11-30 CN CN202211526457.7A patent/CN115747272A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116904543A (en) * | 2023-09-07 | 2023-10-20 | 云合(天津)生物技术有限公司 | Application of dehydrogenase in synthesis of R-configuration vitronectin and synthesis method |
| CN116926028A (en) * | 2023-09-07 | 2023-10-24 | 云合(天津)生物技术有限公司 | Dehydrogenase mutant and application thereof in synthesis of S-vitronectin |
| CN116904543B (en) * | 2023-09-07 | 2023-11-21 | 云合(天津)生物技术有限公司 | Application of dehydrogenase in synthesis of R-configuration vitronectin and synthesis method |
| CN116926028B (en) * | 2023-09-07 | 2023-12-01 | 云合(天津)生物技术有限公司 | Dehydrogenase mutant and application thereof in synthesis of S-vitronectin |
| CN118147250A (en) * | 2024-05-11 | 2024-06-07 | 成都格纯生物医药有限公司 | Method for preparing vitronectin from recombinant fusion protein |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN115747272A (en) | Synthetic method of vitreous chromogen | |
| Pan et al. | Production of high‐purity isomalto‐oligosaccharides syrup by the enzymatic conversion of transglucosidase and fermentation of yeast cells | |
| CN107557412B (en) | Method for catalytically synthesizing NADPH by immobilized enzyme | |
| CN102827891A (en) | Method for preparing steviol by carrying out catalytic hydrolysis on stevioside by beta-glucosidase | |
| CN114507681B (en) | Sorbose reductase OpCR gene, mutant and encoded protein and application thereof in preparation of vitronectin | |
| CN109182410A (en) | A kind of enzymatic preparation method of (S)-N-Boc-3- hydroxy piperidine | |
| CN107400653B (en) | Recombinant escherichia coli containing alpha-glycosidase gene and application thereof | |
| CN114540380A (en) | Sorbitol dehydrogenase sorDHGo gene, encoding protein and application in preparation of vitreous chromogen | |
| CN112094835B (en) | Application of beta-glucosidase mutant | |
| CN116790523A (en) | Method for producing isomaltulose alcohol by whole cell transformation | |
| EP1756292B1 (en) | Process for fermenting sugars containing oligomeric saccharides | |
| CN111705096A (en) | Method for producing beta-nicotinamide mononucleotide by enzyme conversion method | |
| JPS6246159B2 (en) | ||
| EP0788551A1 (en) | A method for improved raw material utilization in fermentation processes | |
| JP3513197B2 (en) | Method for producing high purity maltitol | |
| CN111808893B (en) | Novel biological preparation method of amino alcohol drug intermediate | |
| CN108251461B (en) | Method for preparing d-borneol | |
| KR101801908B1 (en) | Method for Preparing of Arbutin | |
| EP1496113B1 (en) | Gluconate dehydratase | |
| JPH10150997A (en) | Production of optically active n-benzyl-3-pyrrolidinol | |
| CN118064515A (en) | Preparation method of R-type vitreous color factor | |
| CN111187799A (en) | Method for producing red algae glucoside and special engineering bacteria thereof | |
| JPH02177891A (en) | Method for synthesizing cytidine-5'-monophosphosialate by conjugated enzymic reaction | |
| CN112779235B (en) | Method for synthesizing various flavonoid glycosides by biological catalysis | |
| JPS61268191A (en) | Production of sugar containing fructooligosaccharide |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |