CN115747229A - Heme biosensor-based growth coupling high-throughput screening method and application thereof in multi-gene metabolic pathway optimization - Google Patents

Abstract

The invention belongs to the technical field of synthetic biology and microbial metabolic engineering, and particularly relates to a heme biosensor-based growth coupling high-throughput screening method and application thereof in multi-gene metabolic pathway optimization. The invention establishes a heme pathway library and an efficient and feasible high-throughput screening method based on a heme sensor, thereby rapidly balancing heme metabolic pathways, simultaneously, constructs a key zymogen porphyrin ferrochelatase mutant library for heme synthesis, screens and obtains ideal variants with high enzyme activity, improves the growth and production performance of thalli, and provides theoretical reference for metabolic pathway balance and high-throughput screening of other metabolites, thereby having good value of practical application.

Description

High-throughput screening method for growth coupling based on heme biosensor and application of method in multi-gene metabolic pathway optimization

Technical Field

The invention belongs to the technical field of synthetic biology and microbial metabolic engineering, and particularly relates to a high-throughput screening method of growth coupling based on a heme biosensor and application of the method in multi-gene metabolic pathway optimization.

Background

The information disclosed in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

Heme is a kind of iron-containing porphyrin and belongs to the family of cyclic modified tetrapyrroles. Heme is the most widely used, most prevalent member of the tetrapyrrole family in terms of biological function. It plays an important role in gas sensing, signal transduction, transcriptional regulation, and oxygen transport. Meanwhile, heme is an important cofactor of cytochrome in the electron transport chain, and thus heme plays a crucial role in aerobic and anaerobic respiration as well as photosynthesis. In addition, heme also serves as an essential cofactor for a variety of enzymatic enzymes, such as cytochrome P450, catalase, peroxidase, and the like. The recent reports show that the heme can be an important preparation for seasoning meat, and can meet the appetite of people to the meat and keep the human body healthy. Meanwhile, the heme is used as an FDA (food and drug administration) approved porphyria treatment drug and has important application in the medical and health-care fields of acute intermittent porphyria.

The biosynthesis of heme uses 5-aminolevulinic acid (ALA) as a precursor. Two molecules of ALA in ALA dehydratase (encoded by hemB)) Producing porphyrin-Porphobilinogen (PBG). 4 molecules of PBG were polymerized by hydroxymethylcholane synthase (encoded by hemC) to Hydroxymethylcholane (HMB). Uroporphyrinogen III synthase (encoded by hemD) catalyzes the formation of uroporphyrinogen III (Uro III) from HMB. Uro III Produces Protoporphyrin IX (PPIX) under the catalysis of uroporphyrinogen decarboxylase (encoded by hemE), coproporphyrinogen III oxidase (encoded by hemF) and coproporphyrinogen III oxidase (encoded by hemY). Protoporphyrin ferrochelatase (FECH, encoded by hemH) and then Fe ²⁺ Insertion of PPIX produced hemoglobin. Microbial heme synthesis is limited by complex regulatory mechanisms and low enzymatic activity of key enzymes, which results in imbalanced metabolic flux and waste of cellular resources. These problems need to be overcome in metabolic engineering to improve the synthesis of heme.

Due to the complexity of biological systems, microbial metabolic engineering often relies on irrational design to increase chemical production. This strategy is based on designing and constructing a library of random mutations and screening the library for specific variants with the desired phenotype, and phenotypic determination of a large number of variants in the library is not accomplished using conventional methods.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a heme biosensor-based growth coupling high-throughput screening method and application thereof in multi-gene metabolic pathway optimization. Specifically, the invention constructs a growth-coupled high-throughput screening tool based on the heme biosensor HrtR. And constructing a hemB/C/D/E/F/Y gene expression intensity combination of the heme synthesis pathway by utilizing the RBS intensity combination, and screening to obtain an Escherichia coli strain SH-PPIX for producing PPIX at a high level. On the basis of the strain SH-PPIX, a mutant library of a key enzyme FECH is constructed, an ideal variant is screened out from the mutant library, and finally, the Escherichia coli SH-Heme for efficiently producing Heme is obtained. The present invention has been completed based on the above results.

Specifically, the invention relates to the following technical scheme:

in a first aspect of the invention, there is provided a heme biosensor comprising at least a heme-responsive transcription repressor gene, hrtR, and a tetracycline resistance gene, tetA (which may also be designated as tcR in the present invention); wherein, the HrtR is derived from Lactococcus lactis subsp. See, in particular, zhang, j., wang, z., su, t., sun, h., zhu, y., qi, q., wang, q.,2020.Tuning the Binding Affinity of heart-Responsive Biosensor for precision and Dynamic Pathway regulation. Iscience 23 (5), 101067.

When the heme biosensor is actually used, the heme biosensor can be in the form of a recombinant expression vector obtained by operatively connecting the gene to an expression vector, wherein the expression vector can be any one or more of a viral vector, a plasmid, a phage, a cosmid or an artificial chromosome; in one embodiment of the invention, the expression vector may be a plasmid, such as a pCDFDuet-1 plasmid vector. In one embodiment of the invention, hrtR and tetA are overexpressed using the pCDFDuet-1 vector. Wherein the regulatory sequence HrtO of HrtR is placed between the tac promoter upstream of tetA and RBS.

Since the heme producing strain produces a large amount of porphyrin during the culture process, the thallus presents reddish brown. The accumulation of porphyrins and heme themselves can affect the measurement of green and red fluorescence. Therefore, it is impossible to use a gene encoding a fluorescent protein such as gfp or rfp as a reporter gene for screening, and thus it is impossible to use a flow cytometric fluorescence sorting technique. Therefore, the invention uses tetA as a reporter gene, thereby coupling the heme concentration and the bacterial growth to achieve the purpose of screening. It should be noted that although HrtR-tetA is taken as an example in the present invention, it is obvious that the technical scheme that other antibiotic resistance genes or related genes mediating or influencing the growth of bacteria are utilized by those skilled in the art to achieve the above technical purpose based on the concept of coupling the hemoglobin concentration and the growth of bacteria to realize high-throughput screening also belongs to the protection scope of the present invention.

In a second aspect of the present invention, there is provided a method for high-throughput screening of growth coupling based on the above-mentioned hemoglobin biosensor, the method comprising: the heme biosensor is introduced into a strain to be screened, and tetracycline is applied to the culture environment of the strain to be screened.

Specifically, the concentration of tetracycline is not higher than 200. Mu.g/mL, including 10-200. Mu.g/mL, further including 20-140. Mu.g/mL, such as 20, 40, 80, 90, 100, 120, 140. Mu.g/mL.

Specifically, by adding tetracycline into the culture environment, when the accumulation level of heme is low, hrtR inhibits the expression of tcR, so that tetracycline cannot be discharged out of cells in time, and the growth of the cells is hindered and even the cells die. When the accumulation level of heme is high, heme is combined with HrtR to start the expression of tcR, so that tetracycline can be discharged out of cells, and the growth of the cells is normal. Based on the method, after a large number of variants are cultured for a period of time under tetracycline with a certain concentration, obvious differences are generated in growth states, strains with strong heme accumulation capacity are enriched after multiple passages, and strains with low heme accumulation capacity are eliminated during continuous passages.

The strain to be screened can be any strain capable of producing heme and intermediate products, derivatives or analogs thereof, the strain can be a naturally-occurring strain or a genetically engineered strain, and is not particularly limited herein.

In a third aspect of the present invention, there is provided the use of the above-described high throughput screening method for screening strains Producing Protoporphyrin IX (PPIX) at high levels.

Specifically, the application is to screen a strain which produces protoporphyrin IX at a high level by screening PPIX to produce a suitable gene expression intensity combination.

Wherein the suitable gene expression intensity combinations are obtained by expressing hemB, hemC, hemD, hemE, hemF and hemY based on RBSs of different intensities.

In particular, the method comprises the following steps of,

the RBS sequence of hemB is:

(a1) A nucleotide sequence as shown in any one of SEQ ID NO. 1-4;

(a2) The nucleotide sequence as shown in any one of SEQ ID No.1-4 is formed by substituting, adding or deleting one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemC is:

(b1) A nucleotide sequence as shown in any one of SEQ ID No. 5-8;

(b2) The nucleotide sequence as shown in any one of SEQ ID No.5-8 is formed by substituting, adding or deleting one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemD is:

(c1) A nucleotide sequence as shown in any one of SEQ ID NO. 9-12;

(c2) The nucleotide sequence shown in any one of SEQ ID NO.9-12 is formed by replacing, adding or deleting one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemE is:

(d1) A nucleotide sequence as shown in any one of SEQ ID NO. 13-16;

(d2) The nucleotide sequence as shown in any one of SEQ ID No.13-16 is formed by substituting, adding or deleting one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemF is:

(e1) A nucleotide sequence as shown in any one of SEQ ID NO. 17-20;

(e2) The nucleotide sequence as shown in any one of SEQ ID NO.17-20 is formed by substitution, addition or deletion of one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemY is:

(f1) A nucleotide sequence as shown in any one of SEQ ID NO. 21-24;

(f2) The nucleotide sequence shown in any one of SEQ ID NO.21-24 is formed by substitution, addition or deletion of one or more nucleotides, and still has the same or similar gene expression strength.

According to the invention, 7 Escherichia coli strains with high PPIX yield are obtained by screening, wherein the No.7 strain has the best PPIX yield, and the PPIX yield is higher than 150mg/L; specifically, the RBS sequences of hemB, hemC, hemD, hemE, hemF and hemY are shown as SEQ ID NO.2, SEQ ID NO.7, SEQ ID NO.12, SEQ ID NO.14, SEQ ID NO.19 and SEQ ID NO.23, respectively.

In a fourth aspect of the present invention, there is provided a highly heme-producing strain having a Protoporphyrin Ferrochelatase (FECH) variant, wherein the FECH variant is obtained by mutating a wild-type FECH at one or more sites of the following group: Y25H, Y26L, Y26V, Y26W, Y26R, I29S, I29K, I29T, R30Q, R30I, R30K, R30E, L43P, L43C, L43R, L43F, R46R, R46P, R46A, R46C, S222R, S222W, N225W, E264G, E264P, E264R, E264L, E264M, E264G; wherein the wild-type FECH is derived from Bacillus subtilis strain.168.

Obviously, the strain should also have hemB, hemC, hemD, hemE, hemF and hemY to achieve hemE generation, and in one embodiment of the present invention, hemB, hemC, hemD, hemE and hemF may be derived from Escherichia coli (Escherichia coli strain. K-12. Subst. MG1655) and hemY may be derived from Bacillus subtilis strain.168.

More specifically, the RBS sequence of hemB is:

(a1) A nucleotide sequence as shown in any one of SEQ ID NO. 1-4;

(a2) The nucleotide sequence as shown in any one of SEQ ID No.1-4 is formed by substituting, adding or deleting one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemC is:

(b1) A nucleotide sequence as shown in any one of SEQ ID No. 5-8;

(b2) The nucleotide sequence as shown in any one of SEQ ID No.5-8 is formed by substitution, addition or deletion of one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemD is:

(c1) A nucleotide sequence as shown in any one of SEQ ID NO. 9-12;

(c2) The nucleotide sequence as shown in any one of SEQ ID No.9-12 is formed by substituting, adding or deleting one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemE is:

(d1) A nucleotide sequence as shown in any one of SEQ ID NO. 13-16;

(d2) The nucleotide sequence as shown in any one of SEQ ID NO.13-16 is formed by substitution, addition or deletion of one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemF is:

(e1) A nucleotide sequence as shown in any one of SEQ ID NO. 17-20;

(e2) The nucleotide sequence as shown in any one of SEQ ID NO.17-20 is formed by substitution, addition or deletion of one or more nucleotides, and still has the same or similar gene expression strength.

The RBS sequence of hemY is:

(f1) A nucleotide sequence as shown in any one of SEQ ID NO. 21-24;

(f2) The nucleotide sequence shown in any one of SEQ ID NO.21-24 is formed by substitution, addition or deletion of one or more nucleotides, and still has the same or similar gene expression strength.

The strain can be Escherichia coli and derivative thereof. Of course, other microorganisms of different genera are selected to achieve the technical solutions or achieve the technical effects similar or similar to the technical solutions of the present application based on the inventive concept of the present invention, and the same shall also belong to the protective scope of the present invention.

In the fifth aspect of the invention, a method for industrially producing heme is provided, which comprises the steps of culturing and fermenting the strain and separating and obtaining heme.

Wherein, the culture fermentation method can be fed-batch fermentation, thereby further improving the yield of the heme.

The beneficial technical effects of one or more technical schemes are as follows:

the technical scheme provides a high-throughput screening strategy for regulating TcR expression in escherichia coli based on a heme biosensor HrtR, so that intracellular heme concentration is coupled with cell growth under screening pressure (namely in the presence of tetracycline) to achieve the purpose of enriching ideal variants.

The technical scheme provides a novel high-yield PPIX strain SH-PPIX, the strain comprises an optimized hemB/C/D/E/F/Y expression combination, sufficient precursor supply is provided for heme production, and after fed-batch fermentation culture, the PPIX yield reaches 160.8mg/L. Meanwhile, on the basis of SH-PPIX, a strain SH-Heme for producing Heme at a high level is disclosed, the strain contains FECH variants (Y26V, I29T, R30E, L43R, R46A, S222R and E264L) with high enzyme activity, and after fed-batch fermentation culture, the Heme yield reaches 127.6mg/L, so that the strain has considerable application value and prospect.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.

FIG. 1 is a PPIX standard curve for an example of the present invention.

Fig. 2 is a working schematic diagram of the high throughput screening tool based on the hemoglobin biosensor HrtR in the embodiment of the present invention.

FIG. 3 shows the difference between the growth conditions of the blank strain and the strain added with ALA in different concentrations of tetracycline in the examples of the present invention.

FIG. 4 shows a: growth differences due to heme addition at different tetracycline concentrations; b: growth differences caused by exogenous addition of different concentrations of heme at tetracycline concentration of 140. Mu.g/mL.

FIG. 5 is a schematic representation of RBS library of PPIX production genes in an example of the present invention.

FIG. 6 shows the accumulation of PPIX in the four passage enriched strains of the examples of the present invention.

FIG. 7 shows key binding sites of FECH substrate in examples of the present invention.

FIG. 8 shows the heme production of strains containing the FECH mutant in the examples of the present invention.

FIG. 9 shows the heme yields of SH20 strain from a batch feed fermentation in a 1L parallel fermenter according to example of the present invention. The yield of heme from SH20 strain fed-batch fermentation in a 5L fermenter. The temperature was 30 ℃ and the aeration was 2vvm, the pH was stabilized at 7.0.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments according to the present application. As used herein, the singular forms "a", "an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of the stated features, steps, operations, devices, components, and/or combinations thereof. Unless the experimental methods of specific conditions are specified in the following detailed description, the conventional methods and conditions of molecular biology within the skill of the art are generally followed, and such techniques and conditions are fully explained in the literature. See, e.g., sambrook et al, "molecular cloning: the techniques and conditions described in the Experimental handbook ", or according to the manufacturer's recommendations.

The invention is further illustrated by the following examples, which are not to be construed as limiting the invention thereto. It should be understood that these examples are only for illustrating the present invention and are not intended to limit the scope of the present invention.

Examples

The material method comprises the following steps:

1. culture medium

(1) LB liquid Medium (g/L)

Yeast powder 5g/L

Peptone 10g/L

Sodium chloride (NaCl) 10g/L

After adjusting the pH to 7.0, the mixture was autoclaved at 121 ℃ for 20 minutes.

(2) LB solid medium

100mL of the prepared LB liquid culture medium is added into a 300mL shaking bottle, 1.5-2.0g/L agar powder (1.5% -2%) is added, and the mixture is sterilized by high-pressure steam at 121 ℃ for 20min. Sterilizing, storing at normal temperature, melting at high temperature, cooling to about 50 deg.C, adding appropriate concentration of antibiotic, and mixing.

(3) MR medium

Mixing 6.67g KH ₂ PO ₄ ,4g(NH ₄ ) ₂ HPO ₄ ,0.8g of MgSO4·7H ₂ O,0.8g citric acid and 5g yeast powder were dissolved in 1L deionized water. The pH was adjusted to 7.0. Subpackaging in 50 mL-300 mL triangular bottles, autoclaving at 121 ℃, and cooling for later use. When in use, 250 mul of trace elements are added into each 50mL of culture medium.

The formula of the trace elements is as follows: each liter of deionized water contains 0.5mol of HCl,2g of CaCl ₂ ,2.2g ZnSO ₄ ·7H ₂ O,0.5g MnSO ₄ ·4H ₂ O,1g CuSO ₄ ·5H ₂ O,0.1g(NH ₄ ) ₆ Mo ₇ O ₂₄ ·4H ₂ O,0.02gNa ₂ B ₄ O ₇ ·10H ₂ O and 10g FeSO ₄ ·7H ₂ O。

(4)Fe ²⁺ MR medium

Adding 200mg/L FeSO based on MR culture medium ₄ ·7H ₂ O。

2. Gibson assembly

System of

(1) 5 Xbuffer (6 mL)

(2) 2X Assembly System (1.25 mL)

The principle is as follows:

the ends of adjacent DNA fragments for assembly contain homologous repetitive regions with the same sequence, when the reaction temperature is 50 ℃, T5 exonuclease in the system cuts the DNA fragments from the 5 'end to the 3' end to generate complementary single strands and anneal, phusion DNA polymerization enzyme in the system completes the gap region, and then Taq ligase is connected with a phosphodiester bond to form a complete circular plasmid in vitro.

The method comprises the following steps:

the fragments to be assembled (total 12. Mu.L) were added to the assembly system (described in 2.1.2) in a molar ratio of 1. After incubation in a metal bath at 50 ℃ for 1 hour at constant temperature, the assembly mixture is added to the competent cells to be transformed for transformation. And after the single colony grows out, performing colony PCR and sequencing to verify whether the assembly is successful.

3. PCR amplification

The PCR reaction system is used in this application:

(1) Phanta Max Super-Fidelity DNA Polymerase reaction system (50. Mu.L):

reaction procedures are as follows:

4 plasmid construction

(1) Construction of screening plasmid PHT

The cdfduet fragment was amplified using cdfduet-F/R as primers and the cdfduet1 plasmid as template. The tcR fragment was amplified using tcR-F/R as primers and cycduet1 plasmid as template. And (3) using hemH-F/R as a primer and a Bacillus subtilis 168 genome as a template to amplify to obtain a hemH fragment. The hrtR fragment was amplified using the hrtR-F/R as a primer and PBH1 plasmid (Zhang, J., wang, Z., su, T., sun, H., zhu, Y., qi, Q., wang, Q.,2020.Tuning the Binding Affinity of the blood-Responsive Biosensor for precision and Dynamic Pathway regulation. ISience 23 (5), 101067) as a template. The resulting cdfduet, tcR, hemH and hrtR four fragments were assembled by Gibson and transformed. Obtaining the screening plasmid.

cdfduet-F gaccgggtctccgcaagtggcacttttcggggctatttaacgaccctgccc

cdfduet-R acagtcgtattaaaaaaattaggacgttaaccttcaacccagtcagctcc

hrtr-F gtcaagcatcggtcgagatcccggtgcctaatgagataggcaccccaggc

hrtr-R tctagtactttcctgtgtgactctagatcttcatgacactgtgtcatca

tcr-F atgaagatctagagtcacacaggaaagtactagatgatgaatagttcgacaaagatcgc

tcr-R ccgaaaagtgccacttgcggagacccggtcttaagcacttgtctcctgtttactcc

hemh-F ctcattaggcaccgggatctcgaccgatgc

hemh-Rttaacgtcctaatttttttaatacgactgt

(2) Construction of RBS Strength library plasmid PBY

hemB, hemC, hemD, hemE, hemF fragments were amplified using hemB-F/R, hemC-F/R, hemD-F/R, hemE-F/R primers, hemF-F/R primers, respectively, and E.coli genome as template. Wherein hemB-F, hemC-F, hemE-F and hemY-F are degenerate primers. Four hemD-F primers were used, namely hemD-F1-4, and the four primers were mixed together to form the hemD-F primer. The hemY fragment was amplified using hemY-F/R using the Bacillus subtilis genome as template. Cycduet fragment was amplified using cycduet-F/R with cycduet1 plasmid as template. The obtained fragment gel was recovered, and overlap PCR was performed using T7-hemB-F and T7-hemD-R as primers and hemB, hemC, and hemD fragments as templates to obtain a BCD fragment. The EFY fragment was obtained by overlap PCR using T7-hemE-F and hemY-R as primers and hemE, hemF, hemY fragments as templates. Performing overlap PCR by using T7-hemB-F and hemY-R as primers and BCD and EFY as fragments to obtain BCDEFY fragments. The BCDEFY fragment and the cycduet fragment are assembled by Gibson and transformed. A PPIX library was obtained.

t7-cycduet-R

ataagaatgcggccgctaaactataacctaggctgctgccaccg

t7-cycduet-R

aattcccctatagtgagtcgtattagaaagatcttccatttcctaatgcaggagtcgc

hemb-F

aacaattccagcccctagatgcacttaaggaktacsatgacagacttaatccaacgccc

t7-hemb-F

gcattaggaaatggaagatctttctaatacgactcactataggggaattgtgagcggataacaattccagcccctagat

hemb-R

atcatcgtggttcaattaacgcagaatcttcttctcagcc

hemc-F

ggctgagaagaagattctgcgttaattgaaccacgatgatraagaggtkcataatgttagacaatgttttaagaattgc

hemc-R

ctagatcatgccggggcgtctccgt

hemd-F1

tgaagtctataacggagacgccccggcatgatctagagaaagaggagaaatactagatgatgagtatccttgtcacccg

hemd-F2

agtctataacggagacgccccggcatgatctagagattaaagaggagaaatactagatgatgagtatccttgtcacccg

hemd-F3

gaagtctataacggagacgccccggcatgatctagagtcacacaggaaagtactagatgatgagtatccttgtcacccg

hemd-F4

aagtctataacggagacgccccggcatgatctagagtcacacaggaaacctactagatgatgagtatccttgtcacccg

t7-hemd-R

tacgggagctcgccttattgtaatgcccgtaaaagcgcatcg

heme-F

gagcggataacaattccactgaccwctaagggggmaaaaatgaccgaacttaaaaacga

t7-heme-F

acgggcattacaataaggcgagctcccgtaatacgactcactataggggaattgtgagcggataacaattccactgacc

heme-R

ttagcggtgatactgttcagaca

hemf-F

gtggaggcagtgcatcgactgtctgaacagtatcaccgctaagaawaaggaggtaawttatgaaacccgacgcacacca

hemf-R

ttacacccaatccctgacct

hemy-F

aagtgagtttattaaggtcagggattgggtgtaatttgtttagcatmaggaggwataatgagtgacggcaaaaaacatg

hemy-R

cctaggttatagtttagcggccgcattcttatttagctgaataaataggtaagcgcgtc

(3) Construction of a library of protoporphyrin ferrochelatase FECH mutants

The pUC fragment was amplified using the pUC-F and pUC-R primers, the pUC19 plasmid as template. The hemA-hemL fragment was amplified using primers hemA-F and hemL-R, plasmid pDAL (Zhang, J., wang, Z., su, T., sun, H., zhu, Y., qi, Q., wang, Q.,2020.Tuning the Binding Affinity of the blood-Responsive Biosensor for precision and Dynamic Pathway regulation. ISience 23 (5), 101067) as templates. hemH was amplified from Bacillus subtilis genomic DNA using primers hemH-f and hemH-r. The resulting fragments were assembled by Gibson assembly to give plasmid pALH.

hemH was mutated on the basis of pALH, which was cloned into 3 fragments using 3 pairs of primers (mutant-F1/R1, mutant-F2/R2, and mutant-F3 (1-2)/R3) containing degenerate bases, and then regenerated into hemH fragments containing random mutations using overlap-PCR. The wild-type hemH on pALH was replaced with the obtained fragment to obtain a library plasmid.

mutant-F1

aagcatttcaggttcaggctttctgcctctthbtkwatgtgtcmvgtracgttcaatatcttcttccttataaggc

mutant-R1

gtgctttatgataatgattatgaatgcaaag

mutant-F2

agaggcagaaagcctgaacctgaaatgcttcaagatykcaaagacssctacgaagcgattggcggcatt

mutant-R2

ttgccagccgacagcatatt

mutant-F3-1

ggcgtttccgaatatgctgtcggctggcaatyggaagggtggacgcctgatccttggctcgg

mutant-F3-2

ggcgtttccgaatatgctgtcggctggcaatyggaagggaacacgcctgatccttggctcgg

mutant-R3

tttgcattcataatcattatcataaagcacsnntaagtgatccgcgacaaaccc

5 sample detection

(1) PPIX detection

PPIX was dissolved in DMSO, and diluted with DMSO to give solutions of PPIX at 10. Mu.g/L, 20. Mu.g/L, 30. Mu.g/L, 40. Mu.g/L, 50. Mu.g/L, 60. Mu.g/L, 70. Mu.g/L, 80. Mu.g/L, 90. Mu.g/L, and 100. Mu.g/L, and 200. Mu.l of PPIX solutions of different concentrations were pipetted into a 96-well plate. The fluorescence intensity of exciting light at 410nm and emitting light at 633nm is detected by a microplate reader. The values obtained construct a standard curve. The fermentation broth was centrifuged to collect the supernatant, diluted by an appropriate amount, and the fluorescence intensity at 410nm for excitation light and 633nm for emission light was detected in a 96-well plate and substituted into a standard curve to calculate the PPIX concentration (FIG. 1).

(2) Heme detection

Detection of hemoglobin the sample is first processed. Centrifuging a bacterial liquid sample obtained by fermenting 1mL, taking supernatant fermentation liquid 1:1, adding 1M NaOH solution, mixing uniformly, and then measuring extracellular heme. Then 1mL of acetone: HCL (95. Fully oscillating and mixing by using a vortex oscillator. Then, centrifuging to take a supernatant 1:1, adding 1M NaOH solution, mixing uniformly, and then measuring intracellular heme. The detection of hemoglobin was performed by HPLC.

HPLC method: a5 μm, 250X 4.6mm trans C18 column was used. The detector is a diode array detector, and the detection wavelength is 400 nm. The mobile phase A is 10:90 of methanol/acetonitrile. Mobile phase B was an aqueous solution containing 0.5% trifluoroacetic acid. The specific procedure is that the concentration of the solvent A is gradually increased from 20 percent to 95 percent within 40 min. The total flow rate was 1mL/min. The column oven was 40 ℃.

As a result:

construction of high-throughput screening system based on heme biosensor HrtR

The screening system consists of a heme biosensor HrtR and a tetracycline resistance gene tetA. HrtR is derived from Lactococcus lactis subsp.lactis Il1403 (Zhang, J., wang, Z., su, T., sun, H., zhu, Y., qi, Q., wang, Q.,2020.Tuning the Binding Affinity of blood-reactive Biosensor for precision and Dynamic Pathway regulation. ISience 23 (5), 101067). HrtR and tetA were overexpressed in E.coli (E.coli DH 5. Alpha.) using the pcdf-duet1 vector. Wherein the regulatory sequence HrtO of HrtR was placed between the tac upstream promoter and the RBS (RBS used BBa-B0032, http:// parts. Item. Org/Ribosome _ Binding _ Sites/Prokaryotic/Constitution-ive/Community _ Collection). As shown in figure 2, tetracycline is added into the culture medium at a certain concentration, and when the accumulation level of heme is low, hrtR inhibits the expression of tcR, so that tetracycline cannot be discharged out of cells in time, and the growth of the cells is hindered and even the cells die. When the accumulation level of heme is high, heme is combined with HrtR to start the expression of tcR, so that tetracycline can be discharged out of cells, and the growth of the cells is normal. Based on the method, after a large number of variants are cultured for a period of time under tetracycline with a certain concentration, obvious differences are generated in growth states, and after multiple passages, strains with strong heme accumulation capacity are enriched, and strains with low heme accumulation capacity are eliminated in continuous passages.

Before screening libraries using this tool, it is first necessary to determine the optimal tetracycline concentration for screening. Tetracycline concentration is required to be such that at this concentration, differences in intracellular heme concentration can cause the most significant growth differences. The constructed screening plasmid is transferred into DH5 alpha strain of genome integration T7 RNA polymerase, the obtained strain is cultured in a 24-well plate, tetracycline with the concentration of 10-250 mu g/mL is added in a gradient manner, and the OD of the strain is measured after culturing for 12h ₆₀₀ . The results are shown in FIG. 3 as a light blue curve, where strain growth is not affected when tetracycline concentration is below 20. Mu.g/mL, OD 12h later ₆₀₀ About 2.8. When the concentration of tetracycline isAbove 20. Mu.g/mL, the growth of the strain is limited, exhibiting OD ₆₀₀ The trend decreases with increasing tetracycline concentration. When the concentration of tetracycline is higher than 60 mu g/mL, the OD of the thalli for 12h ₆₀₀ When the concentration of tetracycline is less than 1, the thalli do not grow when the concentration of tetracycline reaches 140 mu g/mL. Then, 2g/L ALA was added to the medium to increase the intracellular heme concentration of the cells under the same culture conditions as described above. As a result, as shown by light yellow curves in FIGS. 3-4, the strain added with 2g/L ALA can normally grow in tetracycline with the concentration lower than 80 mu g/mL, when the tetracycline concentration is higher than 80 mu g/mL, the growth of thalli is influenced, when the tetracycline concentration reaches 150 mu g/mL, the growth of thalli is seriously influenced, and when the tetracycline concentration reaches 180 mu g/mL, the thalli does not grow. The result proves that the addition of ALA can increase the capability of thalli for synthesizing heme, hrtR is dissociated from HrtO by increasing the heme concentration, and the tolerance of thalli to tetracycline is enhanced by activating the expression of tcR, so that the thalli has a better growth state.

Then, in DH 5. Alpha. -T7 strain containing the selection plasmid, plasmid containing the heme endoglin ChuA was transferred to make the strain possess the ability to take up heme. The above experiment was repeated, and exogenously added ALA was replaced by heme. As shown in FIG. 4a, using the Cyc184 plasmid constitutively expressed tcR as a control strain, the growth of the control strain was not affected at tetracycline concentrations below 200. Mu.g/mL, and was weakly affected at tetracycline concentrations above 200. Mu.g/mL, indicating that the strain had a strong resistance to tetracycline resistance when tcR expression was not inhibited. The growth of the strain without added heme was the same as before. The ability of the strain exogenously added with 100 mu M heme to resist tetracycline resistance is obviously enhanced, and when the concentration of tetracycline is lower than 90 mu g/mL, the growth of the strain is not influenced. When the concentration of tetracycline is higher than 160. Mu.g/mL, the growth of the strain begins to deteriorate significantly, and when the concentration of tetracycline reaches 200. Mu.g/mL, the strain hardly grows. According to the experimental result, the concentration of 140 mu g/mL tetracycline is selected as the screening concentration, the strain added with 100 mu M heme has the most obvious growth difference with the blank strain at the concentration, and the obvious growth difference is beneficial to enriching the high-yield strainAnd (4) collecting. To further demonstrate that the increase of the hemoglobin concentration at a specific tetracycline concentration is directly correlated with the growth state of the bacteria, 10-100. Mu.M hemoglobin was added to each LB medium containing 140. Mu.g/mL tetracycline, and the OD was measured after culturing the strain containing the selected plasmid for 12 hours ₆₀₀ . As a result, as shown in FIG. 4b, the growth of the cells was gradually improved as the concentration of hemoglobin added from the source was increased. This result demonstrates that using httr to modulate tcR can couple intracellular heme concentrations to growth, demonstrating the feasibility of our constructed high-throughput screening tools based on response heme biosensors.

Screening PPIX production optimum gene expression intensity combination by utilizing high-throughput screening system

hemB (NCBI-GeneID: 945017), hemC (NCBI-GeneID: 947759), hemD (NCBI-GeneID: 948587), hemE (NCBI-GeneID: 948497), hemF (NCBI-GeneID: 946908), hemY (NCBI-GeneID: 936311) and hemH (NCBI-GeneID: 939772) were overexpressed in E.coli (E.coli DH5 α). Among them, hemH was constitutively expressed using trc promoter and RBS (Bba-B0034). hemB, hemC and hemD are initiated using the same T7 promoter, located on the same operon. hemE, hemF and hemY are driven using the same T7 promoter, on another operon. The same effect can be obtained with other promoters, the T7 promoter being used in order to enhance the transcription efficiency. hemB-hemY was expressed using 4 RBS of different intensities, respectively. The intensity of the RBS was calculated using an RBS calulator, and the specific sequence and intensity are shown in the following table. In the library, there are 4 differences in the expression level of a single gene, and 6 genes will give rise to 4 ⁶ =4096 combinations. Different combinations can result in differences in the flux of PPIX synthesis and thus in differences in PPIX production. PPIX is converted to heme under the action of FECH encoded by hemH, thus causing a difference in the synthesis of heme. The difference in the concentration of Heme results in a change in the growth capacity of the strain under tetracycline resistance, thereby achieving the goal of enriching high-level production of PPIX strains.

The constructed library plasmids were transferred into DH 5. Alpha. -T7 strain containing selection plasmid, and all strains were inoculated into 50mL LB, cultured at 37 ℃ at 220rpm for 12 hours. Then, after transferring the strain to 50mL of LB medium containing 140. Mu.g/mL of tetracycline in an inoculum size of 4%, while adding 2g/L of ALA as a precursor for PPIX production, the strain was cultured at 37 ℃ and 220rpm for 12 hours to obtain a first-passage strain. The first generation strain was further inoculated at an inoculum size of 4% into 50mL LB containing 140. Mu.g/mL tetracycline, 2g/L ALA, and cultured under the same conditions to obtain a second generation strain. The second generation strains were further passaged as described above to obtain third and fourth generation strains. Four rounds of communication enriched the strain 7 which yielded high PPIX production (FIG. 6). RBS composition of 7 strains was as follows:

directed evolution of FECH using high throughput screening tools

On the basis of the above strain No.7, FECH encoded by hemH (NCBI-GeneID: 939772) was mutated to construct a mutant library of FECH. The key sites for FECH substrate binding were first determined using computer-aided design: y25, Y26, I29, R30, L43, R46, S222, N225, and E264. Random mutagenesis was performed at these sites using mutation primers (materials method) to construct a library of mutants.

And (4) screening the ideal mutant with high yield of the Heme from the obtained mutant library, wherein the screening method is the same as the above. After 5 passages, a plurality of FECH mutants with higher yield than the wild type are obtained by enrichment. Mutant mutations were as follows. The resulting 20 mutants were subjected to shake flask fed-batch fermentation.

The yields are shown in FIG. 8.

Optimizing heme fermentation conditions

SH20 strain was fed-batch fermented in a 1L fermenter. The results show that 30 ℃ is the optimum temperature for heme production, which is higher than the yield at 37 ℃ with the same aeration (FIG. 9 a). Increased ventilation also favoured the production of haem, which reached 40.8mg/L when the ventilation was 2 vvm. SH20 was then cultured in a 5-L fermenter at 30 ℃ and 2 vvm. Addition of Fe ²⁺ After addition of sodium glutamate, the yield of heme reached 127.6mg/L (FIG. 9 b).

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications may be made to the embodiments described above, or equivalents may be substituted for elements thereof. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims (10)

1. A heme biosensor comprising at least a heme-responsive transcription repressor gene, httr, and a tetracycline resistance gene, tetA; wherein HrtR is derived from lactococcus lactis.

2. A method for high-throughput screening of coupled growth based on the heme biosensor of claim 1, the method comprising: introducing the heme biosensor of claim 1 into a strain to be screened, and applying tetracycline to the culture environment of the strain to be screened.

3. The high throughput screening method of claim 2, wherein the method comprises: the concentration of the tetracycline is not higher than 200 mug/mL, including 10-200 mug/mL, further including 20-140 mug/mL.

4. Use of the high throughput screening method of any one of claims 2-3 for screening strains producing protoporphyrin IX at high levels.

5. The use according to claim 4, wherein the use is specifically selected for strains producing protoporphyrin IX at high levels by selecting a combination of suitable gene expression intensities for protoporphyrin IX production.

6. Use according to claim 5, wherein the combination of suitable gene expression intensities is obtained based on different intensities of RBS expression hemB, hemC, hemD, hemE, hemF and hemY.

7. The use according to claim 6,

the RBS sequence of hemB is:

(a1) A nucleotide sequence as shown in any one of SEQ ID NO. 1-4;

(a2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.1-4 and still has the same or similar gene expression strength;

the RBS sequence of hemC is:

(b1) A nucleotide sequence as shown in any one of SEQ ID No. 5-8;

(b2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.5-8 and still has the same or similar gene expression strength;

the RBS sequence of hemD is:

(c1) A nucleotide sequence as shown in any one of SEQ ID NO. 9-12;

(c2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.9-12 and still has the same or similar gene expression strength;

the RBS sequence of hemE is:

(d1) A nucleotide sequence as set forth in any one of SEQ ID No. 13-16;

(d2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.13-16 and still has the same or similar gene expression strength;

the RBS sequence of hemF is:

(e1) A nucleotide sequence as shown in any one of SEQ ID NO. 17-20;

(e2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.17-20 and still has the same or similar gene expression strength;

the RBS sequence of hemY is:

(f1) A nucleotide sequence as shown in any one of SEQ ID NO. 21-24;

(f2) The nucleotide sequence as shown in any one of SEQ ID No.21-24 is formed by substituting, adding or deleting one or more nucleotides, and still has the same or similar gene expression strength.

8. A heme-producing strain having a protoporphyrin ferrochelatase variant mutated at one or more sites of the following group by wild-type FECH: Y25H, Y26L, Y26V, Y26W, Y26R, I29S, I29K, I29T, R30Q, R30I, R30K, R30E, L43P, L43C, L43R, L43F, R46R, R46P, R46A, R46C, S222R, S222W, N225W, E264G, E264P, E264R, E264L, E264M, E264G; wherein the wild type FECH is derived from Bacillus subtilis.

9. A hemE-producing strain having hemB, hemC, hemD, hemE, hemF and hemY; the hemB, hemC, hemD, hemE and hemF are derived from escherichia coli, and the hemY is derived from bacillus subtilis;

the RBS sequence of hemB is:

(a1) A nucleotide sequence as shown in any one of SEQ ID NO. 1-4;

(a2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.1-4 and still has the same or similar gene expression strength;

the RBS sequence of hemC is:

(b1) A nucleotide sequence as shown in any one of SEQ ID NO. 5-8;

(b2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.5-8 and still has the same or similar gene expression strength;

the RBS sequence of hemD is:

(c1) A nucleotide sequence as shown in any one of SEQ ID NO. 9-12;

(c2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.9-12 and still has the same or similar gene expression strength;

the RBS sequence of hemE is:

(d1) A nucleotide sequence as shown in any one of SEQ ID NO. 13-16;

(d2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.13-16 and still has the same or similar gene expression strength;

the RBS sequence of hemF is:

(e1) A nucleotide sequence as shown in any one of SEQ ID NO. 17-20;

(e2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.17-20 and still has the same or similar gene expression strength;

the RBS sequence of hemY is:

(f1) A nucleotide sequence as shown in any one of SEQ ID No. 21-24;

(f2) A nucleotide sequence which is formed by substituting, adding or deleting one or more nucleotides in the nucleotide sequence shown in any one of SEQ ID NO.21-24 and still has the same or similar gene expression strength;

further, the strain is escherichia coli and derivatives thereof.

10. A method for industrially producing heme, which comprises the steps of culturing and fermenting the strain of claim 8 or 9, and isolating heme;

further, the culture fermentation method is fed-batch fermentation.

Images