CN115725740A - Primer probe composition, kit and method for detecting insertion mutation of 20 th exon of human EGFR gene - Google Patents

Abstract

The invention belongs to the technical field of gene detection, and provides a primer probe composition, a kit and a method for detecting insertion mutation of a 20 th exon of a human EGFR gene, wherein the primer probe composition comprises: probes E20ins-Ref-P, E20ins-MT-P1, E20ins-MT-P2, E20ins-MT-P3, E20ins-MT-P4 and E20ins-MT-P5; respectively detecting an internal reference gene, a p.V769_ D770insASV mutation, a p.D770_ N771insSVD mutation, a p.H773_ V774insH mutation, a p.H773_ V774insNPH mutation and a p.D770_ N771insG mutation. The invention is based on the digital PCR technology, is used for detecting the insertion mutation of the exon20 of the EGFR gene, comprises 5 common insertion mutation types of the exon20 of the EGFR gene, designs respective specific probes aiming at each insertion mutation, can effectively improve the detection specificity, and can realize the detection of five insertion mutation types in one reaction tube. The kit has high detection efficiency, good specificity and high sensitivity, can visually present mutation frequency results, and has important significance for precise medication guidance of NSCLC patients.

Description

Primer probe composition, kit and method for detecting insertion mutation of 20 th exon of human EGFR gene

Technical Field

The invention belongs to the technical field of gene detection, and particularly relates to a primer probe composition, a kit and a method for detecting insertion mutation of a 20 th exon of a human EGFR gene.

Background

An Epidermal Growth Factor Receptor (EGFR) is a multifunctional glycoprotein widely distributed on cell membranes of various tissues of the human body, has tyrosine kinase activity, is one of four members of an ErbB family, and is also known as HER1 or ErbB1.EGFR is activated by ligand to start intracellular signal conduction, and through the cascade reaction of adaptor protein and enzyme in cytoplasm, transcription of transcription factor activating gene is regulated to guide cell migration, adhesion, proliferation, differentiation and apoptosis. Research shows that high expression or abnormal expression of EGFR exists in a plurality of solid tumors, and provides theoretical basis and experimental basis for EGFR-targeted tumor treatment and signal transduction intervention treatment aiming at EGFR signal transduction pathways. Therefore, molecular targeted therapy with Epidermal Growth Factor Receptor (EGFR) as a therapeutic target has become a focus of attention in the tumor world at home and abroad.

EGFR kinase domain 18-21 exon mutation is a non-small cell lung cancer (NSCLC) determined driving mutation gene, EGFR most common typical mutation is 19 exon deletion mutation (exon 19deletion, ex19del) and 21 exon amino acid substitution L858R missense mutation (exon 21 point mutation, L858R), NSCLC patients carrying such mutation are highly sensitive to Tyrosine Kinase Inhibitors (TKIs); other identified atypical mutations EGFR S768I, L861Q and G719X were moderately sensitive to TKIs, but showed heterogeneity and reduced response; the 20 exon T790M mutation and a part of exon20 insertion mutations (exon 20insertions, ex20 ins) were insensitive to TKIs and were drug-resistant mutations. The insertion or deletion mutation of the EGFR gene exon20 accounts for 4 to 12 percent of lung cancer patients, belongs to the third high-frequency gene mutation type, and has important research significance.

EGFR 20 exon insertion mutation (E20 ins) accounts for 10% of lung cancer EGFR mutations; among these, 94.7% of E20ins insertions occur in the EGFR loop region, starting from the p.a767 residue located at the c-terminus of the aC helix, and are highly diverse in three different forms: insertions, deletions-insertions (delins) and repeats, with the highest frequency of insertional mutagenesis being p.a767_ V769dup (25.1%) and p.s768_ D770dup (17.6%).

Currently, the commonly used methods for detecting the insertion mutation of exon20 of EGFR gene are NGS and fluorescence PCR. NGS is a high-throughput massively parallel sequencing method that can detect multiple gene targets simultaneously, however, it is expensive, complex, time consuming and laborious. Although the fluorescent PCR technique is simple and rapid, it cannot be absolutely quantified, gives a mutation frequency, and has insufficient sensitivity in some cases.

Moreover, in the prior art, the exon20 mutation of the EGFR gene is usually detected together with the exon 18 and the exon 19, for example, patent application CN108220442B, CN112322733A, CN114277142a and the like, which are not deeply studied, and the detection effect is not ideal because the detection is not performed on different mutation sites of the exon 20. For example, the detection of the mutation of the exon20 p.T790M of the human EGFR gene disclosed in CN109652505A has a single detection effect.

Therefore, a detection method is needed to detect the exon20 mutation of the EGFR gene comprehensively and accurately.

Disclosure of Invention

In order to solve the problems, the invention provides a primer probe combination, a detection kit and a method for detecting multiple insertion mutations of EGFR Exon20 based on a digital PCR technology. The method solves the problems of high cost, low sensitivity and incapability of accurate quantification in the prior art, improves the sensitivity and accuracy of detection, and provides an effective new method for quantitative detection of insertion of EGFR gene exon 20.

In a first aspect of the invention, a primer probe composition for detecting EGFR Exon20 multiple insertion mutations based on digital PCR technology is provided, comprising:

probes E20ins-Ref-P, E20ins-MT-P1, E20ins-MT-P2, E20ins-MT-P3, E20ins-MT-P4 and E20ins-MT-P5; wherein the content of the first and second substances,

detecting an internal reference gene by using a probe E20ins-Ref-P, wherein the sequence is shown as SEQ ID NO. 3;

the probe E20ins-MT-P1 is used for detecting p.V769_ D770insASV mutation, and the sequence is shown as SEQ ID NO. 4;

the probe E20ins-MT-P2 is used for detecting p.D770_ N771insSVD mutation, and the sequence is shown as SEQ ID NO. 5;

the probe E20ins-MT-P3 is used for detecting p.H773_ V774insH mutation, and the sequence is shown as SEQ ID NO. 6;

the probe E20ins-MT-P4 is used for detecting p.H773_ V774insNPH mutation, and the sequence is shown as SEQ ID NO. 7;

the probe E20ins-MT-P5 is used for detecting p.D770_ N771insG mutation, and the sequence is shown as SEQ ID NO. 8.

The technical scheme is based on a digital PCR technology, is used for detecting the insertion mutation of the exon20 of the EGFR gene, comprises 5 common insertion mutation types of the exon20 of the EGFR gene, designs respective specific probes aiming at each insertion mutation, can effectively improve the detection specificity, and can realize that five insertion mutation types are detected in one reaction tube. The kit has high detection efficiency, good specificity and high sensitivity, can visually present mutation frequency results, and has important significance for precise medication guidance of NSCLC patients.

In one embodiment of the present invention, the method further comprises a pair of primers: an upstream primer with a sequence shown as SEQ ID NO. 1 and a downstream primer with a sequence shown as SEQ ID NO. 2. The primer is suitable for detecting the five mutation sites, the insertion mutation of the No. 20 exon of the five EGFR genes and the internal reference share 1 pair of primers, and the detection is carried out in the same reaction tube, so that the mutual interference of a plurality of pairs of primers is avoided, the detection specificity is good, and the sensitivity is high.

In one embodiment of the present invention, the 5' -end of the probes E20ins-MT-P1, E20ins-MT-P2, E20ins-MT-P3, E20ins-MT-P4, and E20ins-MT-P5 is labeled with a fluorophore FAM.

In one embodiment of the present invention, the 5' -end of the probe E20ins-Ref-P is labeled with a fluorophore VIC.

In a second aspect of the invention, a kit for detecting multiple insertion mutations of EGFR Exon20 based on a digital PCR technology is provided, and comprises the primer probe composition.

In one embodiment of the present invention, the kit further comprises a positive control sample and/or a negative control sample.

In a third aspect of the present invention, there is provided a method for detecting insertion mutation of exon20 of EGFR gene based on digital PCR technology, comprising the steps of:

s-1, extracting sample DNA;

s-2, taking the sample DNA as a template, and carrying out digital PCR amplification on the probe by using the primer;

and S-3, analyzing the amplification result, judging whether the exon20 of the EGFR gene has insertion mutation, and if so, calculating mutation frequency.

The mutation frequency calculation formula is as follows:

mutation frequency = FAM copy number/VIC copy number x 100%.

The detection method disclosed by the invention is simple and convenient to operate, sensitive in detection, good in accuracy, good in specificity, considerable in quantitative result and only needs 3 hours in the experimental process.

The invention is based on the digital PCR technology, is used for detecting the insertion mutation of the exon20 of the EGFR gene, comprises 5 common insertion mutation types of the exon20 of the EGFR gene, designs respective specific probes aiming at each insertion mutation, can effectively improve the detection specificity, and can realize that five insertion mutation types are detected in one reaction tube. The kit has high detection efficiency, good specificity and high sensitivity, can visually present mutation frequency results, and has important significance for precise medication guidance of NSCLC patients.

Drawings

FIG. 1 is a fluorescence profile of a pure wild-type sample;

FIG. 2 is a fluorescence distribution diagram of a homozygous mutant sample;

FIG. 3 is a graph showing fluorescence profiles of heterozygous mutant samples;

FIG. 4 is a graph of fluorescence distribution of the sample MT 1;

FIG. 5 is a graph of fluorescence distribution of the sample MT 2;

FIG. 6 is a graph of fluorescence distribution of a sample MT 3;

FIG. 7 is a graph of fluorescence distribution of a sample MT 4;

FIG. 8 is a graph showing the fluorescence distribution of the sample MT 5.

Detailed Description

The present invention will be described in further detail with reference to the following embodiments, and the present invention is not limited to the following examples. Variations and advantages that may occur to those skilled in the art may be incorporated into the invention without departing from the spirit and scope of the inventive concept, which is defined by the appended claims. The procedures, conditions, reagents, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art, except for those specifically mentioned below, and the present invention is not particularly limited.

Example 1

Establishment of digital PCR (polymerase chain reaction) detection method for insertion mutation of EGFR (epidermal growth factor receptor) gene exon20

1. Wax block standard substance DNA extraction

Five mutant wax standard DNA samples were extracted using a silica gel membrane adsorption kit (Qiagen) and the concentration and purity of the DNA was checked using a Nanodrop spectrophotometer (Thermo Fisher) to ensure that the DNA concentration was greater than 2ng/ul and A260/A280 was between 1.8-2.0 and A260/A230 was greater than 1.7.

2. Design test of primer Probe

1. Primer Probe design

Specific primer probes were designed for each mutation type, with the mutation probe modified with FAM signal and the wild type probe (internal control) modified with VIC signal. Wherein the primers share a pair, and the probe sequence of each primer is shown in the following table 1.

TABLE 1 primer Probe sequence Listing

Primers or probes	Serial number	Sequence (5 '→ 3')	Type of mutation
				Upstream primer	SEQ ID NO:1	ACCATGCGAAGCCACACT
Downstream primer	SEQ ID NO:2	CGTGATGAGCTGCACGGTG
				E20ins-Ref-P	SEQ ID NO:3	CCTCTCCCTCCCTCCA	Wild type
E20ins-MT-P1	SEQ ID NO:4	CAGCGTGGCCAGCGTGG	p.V769_D770insASV(A767_V769dup)
				E20ins-MT-P2	SEQ ID NO:5	AGCGTGGACAGCGTGGACA	p.D770_N771insSVD(S768_D770dup)
E20ins-MT-P3	SEQ ID NO:6	CCCCCACCACGTGTGCCGC	p.H773_V774insNPH(N771_H773dup)
				E20ins-MT-P4	SEQ ID NO:7	AACCCCCACAACCCCCACGTG	p.H773_V774insH(H773dup)
E20ins-MT-P5	SEQ ID NO:8	TGGCCAGCGTGGACGGTAACC	p.D770_N771insG

2. Digital PCR test

DNA of a pure wild type sample, a homozygous mutant sample and a heterozygous mutant sample is used as a template, an amplification reagent is a Hoyi probe dPCR kit (product number 233003), and other related consumables of digital PCR comprise a Hoyi sample preparation universal kit (a microfluidic biochip method) (product number 10001) and a micro-droplet detection universal kit (product number 10002), and amplification is carried out according to a system in a table 2.

The results show that: when a pure wild-type sample was tested, only the VIC signal, fig. 1; when homozygous mutant samples were tested, only FAM + VIC double positive signals were present, as in fig. 2; when a heterozygous mutant sample was detected, there was a single VIC signal and a FAM + VIC double positive signal, as shown in fig. 3.

The primer probe combinations in table 1 were tested on digital PCR. The template adopts five mutant wax block standard substance DNAs, and the mutation rate of each standard substance is as follows: 1-50% of MT, 2-49% of MT, 3-36% of MT, 4-40% of MT and 5-28% of MT. The amplification reagent is a probe dPCR kit (a cargo number 233003) of Hoyi, and other digital PCR related consumables comprise a universal kit (a microfluidic biochip method) (a cargo number 10001) for preparing a Hoyi sample and a universal kit (a cargo number 10002) for detecting micro droplets.

(1) Architecture configuration

System configuration was performed as per table 2:

TABLE 2 digital PCR amplification System

(2) Droplet preparation and amplification

The micro-droplet preparation was performed using a sample preparation apparatus (Hoyi manufacturing technology, beijing, ltd.) according to the instruction manual. Then the 8-linked discharge tube containing the micro-droplets is placed on a PCR instrument for amplification, and the amplification conditions are set as the following table 3:

TABLE 3 digital PCR amplification System

(3) The result of the detection

After PCR amplification is finished, reading and collecting fluorescent signals by a Hoyi chip reader, directly reading FAM and VIC detected copy numbers, and calculating mutation frequency according to the copy numbers, wherein the calculation formula is as follows: e20ins mutation frequency = FAM copy number/VIC copy number x 100%. The specific detection results are shown in Table 4, and the fluorescence profiles are shown in FIGS. 4 to 8.

TABLE 4 test results of standards

The result shows that the detection result is consistent with the theoretical value, which shows that the system has higher accuracy.

Example two

Clinical sample testing

1. Clinical sample DNA extraction

FFPE samples of NSCLC patients are extracted by a silica gel membrane adsorption kit (Qiagen), 2 samples of each of five mutation types are detected, one negative sample is detected, and a Nanodrop spectrophotometer (Thermo Fisher) is used for detecting the concentration and purity of DNA, so that the concentration of the DNA is more than 2ng/ul, the A260/A280 is between 1.8 and 2.0, and the A260/A230 is more than 1.7.

2. Digital PCR detection

PCR amplification was performed according to the reaction system and procedure of example I. After PCR is finished, reading and collecting fluorescent signals by a Hoyi chip reader, directly reading FAM and VIC detected copy numbers, and calculating mutation frequency according to the copy numbers, wherein the calculation formula is as follows: e20ins mutation frequency = FAM copy number/VIC copy number x 100%. The specific test results are shown in Table 5.

TABLE 5 clinical specimen test results

The result shows that the detection result of the patent sample is consistent with the NGS result, which shows that the detection method of the patent has the advantages of low cost, fast time, high accuracy and good specificity.

Claims (10)

1. The primer probe composition for detecting the insertion mutation of the 20 th exon of the human EGFR gene is characterized by comprising probes E20ins-MT-P1, E20ins-MT-P2, E20ins-MT-P3, E20ins-MT-P4 and E20ins-MT-P5; wherein the content of the first and second substances,

the probe E20ins-MT-P1 is used for detecting p.V769_ D770insASV mutation, and the sequence is shown as SEQ ID NO. 4;

the probe E20ins-MT-P2 is used for detecting p.D770_ N771insSVD mutation, and the sequence is shown as SEQ ID NO. 5;

the probe E20ins-MT-P3 is used for detecting p.H773_ V774insH mutation, and the sequence is shown as SEQ ID NO. 6;

the probe E20ins-MT-P4 is used for detecting p.H773_ V774insNPH mutation, and the sequence is shown as SEQ ID NO. 7;

the probe E20ins-MT-P5 is used for detecting p.D770_ N771insG mutation and has a sequence shown in SEQ ID NO. 8.

2. The primer probe composition of claim 1, further comprising a probe E20ins-Ref-P for detecting an internal reference gene, wherein the sequence is shown as SEQ ID NO. 3.

3. The primer probe composition of claim 1 or 2, further comprising a pair of primers, wherein the sequence of the upstream primer is shown as SEQ ID NO. 1, and the sequence of the downstream primer is shown as SEQ ID NO. 2.

4. The primer probe composition according to claim 1 or 2, wherein 5' ends of the probes E20ins-MT-P1, E20ins-MT-P2, E20ins-MT-P3, E20ins-MT-P4, and E20ins-MT-P5 are labeled with a fluorophore FAM.

5. The primer probe composition according to claim 4, wherein the 5' -end of the probe E20ins-Ref-P is labeled with a fluorophore VIC.

6. A kit for detecting insertion mutation at exon20 of human EGFR gene comprising the primer probe composition according to any one of claims 1 to 5.

7. The kit of claim 6, further comprising a positive control sample and/or a negative control sample.

8. A method for detecting a 20 th exon insertion mutation in the human EGFR gene for non-therapeutic and diagnostic purposes, comprising the steps of:

s-1, extracting sample DNA;

s-2, performing digital PCR amplification on the probe composition by using the primer of any one of claims 1 to 5 and taking the sample DNA as a template;

and S-3, analyzing the amplification result, judging whether the exon20 of the EGFR gene has insertion mutation, and if so, calculating mutation frequency.

9. The method of claim 6, wherein the digital PCR amplification system used in step S-2 is:

。

10. the method according to claim 9, wherein the digital PCR amplification conditions used in step S-2 are:

。

Images