CN115725686A

CN115725686A - Biological angstrom pore system based on small-conductance mechanical force sensitivity channel

Info

Publication number: CN115725686A
Application number: CN202210758241.7A
Authority: CN
Inventors: 耿佳; 包锐; 魏于全; 赵长健; 李开菊; 牟星禹
Original assignee: Sichuan University
Current assignee: Sichuan University
Priority date: 2021-08-30
Filing date: 2022-06-29
Publication date: 2023-03-03
Anticipated expiration: 2042-06-29
Also published as: CN117568437A; CN115725685A; CN115927738B; CN115725686B; WO2023030180A1; CN115725708B; CN115927738A; CN115725708A; CN115725685B

Abstract

The invention belongs to the field of nanopore detection, and particularly relates to a biological emmer pore system based on a small conductance mechanical force sensitivity channel (MscS). The invention provides application of an angstrom pore system in detecting charged molecules, which is characterized in that the angstrom pore system comprises an MscS angstrom pore, an insulating film, a first medium and a second medium. The MscS angstrom pore provided by the invention can realize reversible in-situ adjustment only by changing external conditions, and is suitable for direct detection of molecules with various types and sizes, such as nucleotide, amino acid, peptide, drug molecule and the like.

Description

Biological angstrom pore system based on small-conductance mechanical force sensitivity channel

Chinese patent application No. CN2021110062606, entitled "biomicropore system for dNTPs and detection of new corona virus based on PaMscS" filed on 30.08.2021, and chinese patent application No. CN2021110042496, entitled "biomicropore system for small molecule drug detection and whole blood detection based on PaMscS", filed on 30.2021, both priority patent applications are incorporated by reference in their entirety.

Technical Field

The invention belongs to the field of nanopore detection, and particularly relates to a biological angstrom pore system based on a small-conductance mechanical force sensitive channel.

Background

The nanopore monomolecular detection technology is a sensing detection technology which integrates the advantages of simple operation, high sensitivity, high detection speed, no need of marking and the like, and is widely applied to the fields of protein detection, gene sequencing, marker detection and the like. At present, the cost, sensitivity and precision of gene detection are main problems to be solved urgently in the development of the detection technology, so that the development of a novel nanopore material is a key means for solving the problems.

A biological nanopore is a naturally occurring nanoscale pore whose pore size is similar to the size of many important biological molecules. Specific blocking currents and translocation events occur when molecules pass through the channels inside the nanopore. According to the blocking current and translocation frequency of the molecule, qualitative and quantitative analysis of the target molecule can be realized. Therefore, the size of the channel pore is the dominant factor affecting the detection capability and the range of applications of the nanopore. Some protein nanopores with appropriate channel pore size have been used for nanotechnology applications, such as α -hemolysin (α -hemlysin, α -HL), mspA, csgG, aerolysin (Aerolysin), phi29 connectors, and the like. These biological nanopores are primarily from the bacterial porins or virus phyla and have pore sizes (1.0 nm-3.6 nm) that are approximately the size of single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA). Thus, they are suitable for detecting nucleic acids and have been used for DNA/RNA sequencing, nucleic acid biomarker detection, and biomolecular interaction studies. However, local modifications of biological nanopores, such as site-directed mutagenesis or modification of specific aptamers, are currently required to adapt to a wider sequencing range according to specific application requirements. Taking α -HL as an example, its limited pore size is about 1.4nm, so the application range is limited only in the analysis of ssDNA, RNA or other molecules, and by using cyclodextrin (cyclodextrin) modification, it can be used to directly detect deoxyribonucleoside monophosphates dNMPs without the need of fluorescent labeling. However, modification of the pore size of biological nanopores by modification means requires a great deal of bioengineering technical assistance, and in addition, protein pores are much less flexible in terms of size adjustment than solid-state nanopores. In this sense, there is an urgent need to find a nanopore with a flexible structure to efficiently detect molecules of various sizes.

In conclusion, in order to overcome the defects of the prior art, the invention provides a novel biological angstrom pore system based on a small-conductance mechanical force sensitivity channel, an angstrom pore is a pore-size protein with a size smaller than that of a nanopore, and the novel protein angstrom pore system does not need an aptamer or modification, thereby providing a novel low-cost and high-universality way for real-time molecular sensing, gene detection and DNA calculation.

Disclosure of Invention

In view of the above, the present invention provides a use of a hermite system for detecting charged molecules, wherein the hermite system comprises a hermite, an insulating film, a first dielectric and a second dielectric; said hermite being embedded in said insulating film, said insulating film separating said first medium from said second medium, said hermite providing a passageway through said first medium to said second medium, said charged molecule in said first medium interacting with said hermite upon application of a driving force between said first medium and said second medium; the angstrom pore is an MscS angstrom pore having a radially symmetric and cylindrically shaped heptameric structure comprising 7 side openings and 1 bottom opening.

Further, the charge properties and/or pore size of the openings are adjustable.

Further, the adjusting of the opening includes subjecting the insulating film to a mechanical force stimulus and/or changing a physical state of the insulating film.

Further, the mechanical force stimulus comprises one or more of a change in osmotic pressure difference of a medium on both sides of the insulating film, a direct physical stimulus of a microneedle to the insulating film, and a stimulus of a negative pressure of air to the insulating film. The change in the physical state of the insulating film includes a change in the thickness of the insulating film, a change in the composition of the insulating film, a change in the curvature of the surface of the insulating film, and the like.

Further, the aperture of the opening may be adjusted according to the following:

(1) Selecting the kind of the first medium and the second medium; and/or

(2) A difference in osmotic pressure between the first medium and the second medium.

Further, the E.oryzae is derived from a bacillus.

Further, the Eimeria species is derived from one or more of Pseudomonas aeruginosa, escherichia coli, thermoanaerobacter tengchongensis, and helicobacter pylori.

Further, the emmer pore is an MscS variant.

Further, the MscS variants comprise a side-hole volume variant and/or a side-hole charge variant.

Further, the insulating film includes a phospholipid film and/or a polymer film.

Further, the charged molecule comprises one or more of a nucleotide, an amino acid, a peptide, a drug molecule.

Further, the emmer pore is a PaMscS variant.

Further, the hermite comprises one or more of the following variants: 130A, 130H, 180R, 271I, 130S and 130P.

Further, the molar mass of the drug molecules is less than 1000g/mol. Specifically, the drug molecule may be pyrophosphoric acid, gentamicin sulfate, neomycin sulfate, sisomicin, glutamic acid, or the like.

Further, the first medium and/or the second medium comprises one or more of a sodium chloride solution, a lithium chloride solution, a cesium chloride solution, a potassium chloride solution, and a sodium bromide solution.

In another aspect, the present invention also provides a biological angstrom pore system, which includes an angstrom pore, an insulating film, a first medium and a second medium, the angstrom pore being embedded in the insulating film, the insulating film separating the first medium from the second medium, the angstrom pore providing a passage communicating the first medium with the second medium; the angstrom pore is an MscS variant angstrom pore having a radially symmetric and cylindrically shaped heptameric structure comprising 7 side openings and 1 bottom opening.

Further, the emmer pore is a side-pore volume variant and/or a side-pore charge variant of MscS.

Further, the insulating film includes a phospholipid film and/or a polymer film. The phospholipid membrane comprises DPHPC, DOPC and E.coli lipid; the polymeric membrane comprises a triblock copolymer polymeric membrane.

Further, the E.oryzae is derived from a Bacillus.

Further, the hermite pore is a pamsccs variant.

Further, the hermite pores include one or more of the following variants: 130A, 130H, 180R, 271I, 130S and 130P. The mutation sites of the several variants described above are located at the lateral opening of the cytoplasmic end, specifically with regard to the change in volume and charge properties of the amino acids. Through mutation, the pore diameter (also understood as 'pore size') of the mutated side hole can be changed, and the detection capability of molecules with specific molecular volume is improved; the local charge characteristics of the mutated side hole channel can be changed, so that the detection capability of a specific charged molecule is improved; the stability of the protein channel currents of the mutant PaMscS hermite pores may also be enhanced.

Further, the charge properties and/or pore size of the openings are adjustable.

Further, the mechanical force stimulus includes one or more of a change in osmotic pressure difference of a medium on both sides of the insulating film, a direct physical stimulus of a micro needle to the insulating film, and a stimulus of a negative pressure of air to the insulating film.

(1) Selecting a type of the first medium and the second medium; and/or

In another aspect, the present invention also provides the use of the above biological nanopore system in the detection of charged molecules, wherein the charged molecules comprise one or more of nucleotides, amino acids, peptides, and drug molecules.

Compared with the prior art, the invention has the beneficial effects that:

the invention provides the use of a hermite system for the detection of charged molecules, wherein the hermite system comprises an MscS hermite. The invention creatively forms a small conductance mechanical force sensitivity channel of small conductance product, mscS, and utilizes the characteristics of mechanical force sensitivity channel protein to detect charged molecules, which is embodied as:

1) The MscS Hermitian pore is narrow in diameter. It is estimated that MscS angstrom pores have a pore size in the range of-6-16 angstrom, which is much smaller than that commonly used in the prior art (e.g., alpha-hemolysin nanopores have a pore size of about 1.4-2.4nm, i.e., 14-24 angstrom).

2) The MscS angstrom pore diameter is adjustable (also can be understood as flexible structure). The MscS emmetropore can convert a mechanical stimulus to an electrical or biochemical signal within milliseconds, thereby initiating modulation of the tunnel configuration. By utilizing the sensitivity of the MscS angstrom pores to the mechanical force stimulation on the insulating film and/or the change of the physical state of the insulating film, the adjustment of the MscS angstrom pores can be realized by influencing the insulating film without complicated chemical modification. For example, the concentrations of the first medium and the second medium (i.e., 30mM NaCl/300mM NaCl, 100mM NaCl/300mM NaCl, and 300mM NaCl/300mM NaCl) can be adjusted to adjust the osmotic pressure difference across the insulating film and thereby adjust the pore size, achieving optimization of the selectivity for dNTPs and improved discrimination of dNTPs. Protein nanopores in the prior art usually have a fixed channel structure, and additional protein engineering modification or chemical modification is required to realize channel structure adjustment. The MscS angstrom pore diameter provided by the invention can realize reversible in-situ adjustment only by changing external conditions, and is suitable for direct detection of molecules with various types and sizes.

3) The hermite system provided by the invention can be applied to sensing detection of single molecules. The hermite system provided by the invention is suitable for various charged molecules (theoretically, as long as the molecules with the size smaller than the MscS hermite hole can realize sensing and detection), such as nucleotides, amino acids, peptides, drug molecules and the like; while larger sized nucleic acids (e.g., ssDNA) and proteins (e.g., proteins in a whole blood sample) cannot enter the tunnel of the MscS emmetropore and do not interfere with the detection molecules.

4) Based on the characteristics, the application scene of the angstrom pore system provided by the invention is wide. For example, mutations can be introduced into the side hole of an MscS emmer pore, adjusting the volume (e.g., W for a, S, P) and charge (e.g., W for H, K for R) of the amino acid at the side hole, to achieve better detection of a particular charged molecule and a molecule of a particular size. For example, the present invention provides an E.coli system that can directly detect a single nucleotide, or can be used in conjunction with a depletion strategy (e.g., detecting the remaining nucleotides of a nucleic acid amplification system) to identify the presence or absence of a target nucleic acid in a sample, e.g., to demonstrate good specificity and sensitivity in the diagnosis of SARS-CoV-2 samples. For example, the hermite system provided by the invention can detect the existence of drug molecules in a complex sample (such as whole blood), can directly measure the drug concentration in the whole blood with molar sensitivity and can continuously monitor the blood concentration of a living animal in real time, and has robustness and sensitivity. For example, the hermite systems provided herein can also detect amino acids and short peptides (e.g., dipeptides).

As used herein, the term "derived from" refers not only to proteins produced by the strain of the organism in question, but also to proteins encoded by DNA sequences isolated from such strains and produced in a host organism containing such DNA sequences.

As used herein, the term "charged molecule" refers to a substance having a net charge and a size less than or equal to the angstrom pore size of the invention. Exemplary charged molecules include nucleotides, amino acids, peptides, drug molecules, and/or other charged small molecules (e.g., short peptides).

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It is obvious that the drawings in the following description are some embodiments of the invention, and that for a person skilled in the art, other drawings can be derived from them without inventive exercise.

FIG. 1 shows electrophysiological testing and dNTP detection based on a PaMscS Ammi well;

FIG. 2 shows the transport frequency of dNTPs through a PaMscS1 pore under different osmotic pressure conditions;

FIG. 3 shows SARS-CoV-2 nucleic acid detection based on real-time monitoring of dNTPs consumption by PaMscS 2;

FIG. 4 shows detection of AFP aptamers and miR21 by PaMscS1 through dNTPs depletion;

FIG. 5 shows the SDS-PAGE results for PaMscS protein (1: wild-type PaMscS;2: W130A mutant; 3: K180R mutant; 4: marker);

fig. 6 shows the current signal or current profile for wild-type or mutant PaMscS;

FIG. 7 shows the current trajectory through a single PaMscS1 angstrom pore at a ramp voltage of 0mV to +100 mV;

fig. 8 shows the transport capacity of different ions through the PaMscS s1 pore;

fig. 9 shows the translocation frequency statistics of dNTPs through a PaMscS1 emm pore at different voltages (n = 3);

figure 10 shows the current trajectory and residence time distribution for PaMscS1 detection of single nucleotides;

figure 11 shows that single-stranded DNA cannot be translocated through the PaMscS1 pore;

FIG. 12 shows the results of the Aminopore detection of SARS-CoV-2orf1ab gene by loop-mediated isothermal amplification (LAMP);

FIG. 13 shows the results of native PAGE electrophoresis of PCR reagents mixed with miR21 and AFP aptamers;

FIG. 14 shows drug single molecule biosensing experiments based on PaMscS3 (V271I) angstrom pores;

FIG. 15 shows drug concentration measurements of whole blood samples;

FIG. 16 shows a proof-of-concept experiment for continuous monitoring of drug concentration in living rats via Aminopore;

FIG. 17 shows a continuous current trace for gentamicin sulfate PaMscS3 (V271I) Amyloid pores;

FIG. 18 shows a continuous current trace for a PaMscS3 (V271I) Amyloric pore of neomycin sulfate;

fig. 19 shows that high concentrations of gentamicin sulfate and neomycin sulfate can block the PaMscS3 (V271I) epothilone pores for extended periods of time;

FIG. 20 shows that MspA-2NNN E-rice pores can be frequently blocked by whole blood samples (10 μ L of whole blood sample to add 1mL end);

fig. 21 shows a continuous current trace for a PaMscS3 (V271I) emmetron pore in a blood sample;

FIG. 22 shows the current trace for direct measurement of rat whole blood samples through a PaMscS3 (V271I) Ammi well;

FIG. 23 shows the current signal for gentamicin sulfate through a PaMscS3 (V271I) epothilone pore from-50 mV to-80 mV;

FIG. 24 shows the current signal for sisomicin through a PaMscS3 (V271I) angstrom pore from-50 mV to-80 mV;

FIG. 25 shows a single channel embedded current trace for wild-type EcMscS (voltage +100mV, conductivity 30mM;

FIG. 26 shows the channel scan voltage (-100 mV to 100 mV) for wild-type EcMscS;

figure 27 shows conductance profiles of wild-type EcMscS;

figure 28 shows a sequence alignment of PaMscS with MscS of other bacteria;

FIG. 29 shows dNTP detection based on a wild-type PaMscS emittor pore;

fig. 30 shows the current trace for PaMscS1 detection of glutamate;

figure 31 shows the amino acid detection scheme based on PaMscS emmer pores and different amino acid blocking current profiles.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention. It is to be understood that the embodiments described are only a few embodiments of the present invention, and not all embodiments. All other embodiments, which can be obtained by a person skilled in the art without inventive step based on the embodiments of the present invention, are within the scope of protection of the present invention.

It should be noted that, in this document, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrases "comprising a component of' 8230; \8230;" does not exclude the presence of another like element in a process, method, article, or apparatus that comprises the element.

As used in this specification, the term "about" typically means +/-5% of the stated value, more typically +/-4% of the stated value, more typically +/-3% of the stated value, more typically +/-2% of the stated value, even more typically +/-1% of the stated value, and even more typically +/-0.5% of the stated value.

In this specification, certain embodiments may be disclosed in a range of formats. It should be understood that this description of "within a certain range" is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, the range

The description should be read as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within this range, e.g., 1,2,3,4,5, and 6. The above rules apply regardless of the breadth of the range.

Detailed description of the drawings

FIG. 1: A. electrophysiological measurement chamber schematic. B. Single-well insertions of PaMscS1 and PaMscS2 angstrom wells at +50mv voltage. I-V relationships for PaMscS1 and PaMscS2 Am pores over a voltage range of-50 mv to +50mv. Conductance profiles for PaMscS s1 and PaMscS2 angstrom wells (N =18, respectively) (buffer conditions-cis: 300mM NaCl, -trans: 30mM NaCl). E. dNTPs were detected by a PaMscS mutant Ammi well (buffer conditions-cis: 300mM NaCl, -trans: 30mM NaCl, and voltage +50 mv).

FIG. 2: at different permeabilitiesdCTP (expressed in orange) and dGTP (expressed in blue) were tested for translocation frequency under differential pressure conditions, symmetric (a, 300mM NaCl. Four sets of dNTPs concentrations, 0.5mM, 1.0mM, 1.5mM and 2.0mM, were tested for translocation of dCTP and dGTP. D. Relationship between translocation frequency and dCTP/dGTP concentration under symmetric, low and high differential osmotic pressure conditions (each data point n = 3). E. Under 3 different osmotic pressure conditions, f _dCTP And f _dGTP The rate of increase of (c).

FIG. 3: A. schematic representation of the detection of SARS-CoV-2 by Aminoculum pore. B. SARS-CoV-2Orf1ab gene assay results under gradient copy number (buffer conditions-cis end: 300mM NaCl, -trans end: 100mM NaCl, voltage +50mV, negative Control (NC) group: n =4, 10^11 copies/mL group: n =4, 10^8 copies/mL group: n =4, 10^5 copies/mL group: n =4, 10^3 copies/mL group: n = 3). C.22 clinical sample detection results, including 15 positive samples (patient number: 1-15) and 7 negative samples (patient number: 16-22), the Aminolecular detection results of 21 samples are consistent with hospital qPCR detection results (patient number: 1-15, 17-22), and 1 negative sample (patient number: 16) is diagnosed as positive by the Aminolecular (buffer conditions are-cis end: 300mM NaCl, trans end: 100mM NaCl, voltage is +50 mV). D. Monitoring the depletion of dNTPs by the MscS emittor pore can be combined with Nucleic Acid Amplification Techniques (NAAT), such as Polymerase Chain Reaction (PCR) and chain displacement amplification (SDA).

FIG. 4: A. schematic diagram of detection strategy. B. Current traces for the no target control group, miR21 group, AFP aptamer group, and both miR21 and AFP aptamer groups. Current distribution for c.4 detection groups. Relative increase in dATP and dGTP signals in group D.4. Samples without miR21 and AFP aptamer did not result in dNTPs depletion; samples with miR21 resulted in more dATP depletion and a relatively lower frequency of dATP translocation; samples with AFP aptamers will result in more dGTP consumption and a relatively lower dGTP translocation frequency; samples with both miR21 and AFP aptamers will result in more dATP and dGTP consumption and relatively lower dATP and dGTP translocation frequencies (buffer conditions-cis end: 300mM NaCl, -trans end: 100mM NaCl, voltage +50mV, n =3 per experiment).

FIG. 6: A. background signal frequencies of wild-type PaMscS and mutant PaMscS1, paMscS2, background noise frequencies of PaMscS1 and PaMscS2 are lower than wild-type PaMscS (voltage +50mv, n.gtoreq.3). Time of insertion of PaMscS1 and PaMscS2 angstrom-rice pores, paMscS2 angstrom-rice pores have higher membrane fusion efficiency (n.gtoreq.3) than PaMscS 1. dNTPs of PaMscS s1 and PaMscS2 angstrom wells blocked the current distribution.

FIG. 7: current traces through a single PaMscS1 angstrom pore at a ramp voltage of 0mV to +100 mV: when the voltage was raised above +90mV, voltage gating was observed (buffer conditions-cis: 300mM NaCl, -trans: 30mM NaCl, sampling frequency: 4999 hz).

FIG. 8: the buffering conditions were: 300mM NaCl on the cis side and 30mM NaCl on the trans side, with n.gtoreq.3 for each data point, mean. + -. SD.

FIG. 10: residence time distribution: dGTP (A), dATP (B), dTTP (C) and dCTP (D); the concentration of each nucleotide was 2mM and the buffer conditions were-cis terminal: 300mM NaCl, -trans end: 30mM NaCl, voltage +50mV.

FIG. 11: voltage: +50mV; buffer conditions are as follows: cis-30 mM NaCl, trans-30 mM NaCl. The final concentration of ssDNA was 5. Mu.M, and the sequence was 5'TAGCTTATCAGACTGATGTTGA3' (SEQ ID NO: 5).

FIG. 12: samples containing from 10^3 copies/mL to 10^11 copies/mL of the Orf1ab gene can be detected.

FIG. 13: DNA template 1 (containing polyT); DNA template 2 (containing polyC); 3. PCR reagents with miR21 and AFP aptamers; 4. control group (without miR21 and AFP aptamer).

FIG. 14: A. results from gentamicin sulfate detection through the PaMscS s3 (V271I) emmetron pore, including representative current traces and occlusion signals. B. Results for neomycin sulfate detection by PaMscS3 Aminopore. C. Quantitative standard curve for gentamicin sulfate (N = 3) and heat map of occlusion signal (right, 878 occlusion events). D. Quantitative standard curve for neomycin sulfate (middle, N = 4) and heat map of occlusion signal (right, 883 occlusion events). The electrolyte conditions were-cis terminal: 300mM NaCl, -trans end: 30mM NaCl,10mM HEPES, pH7.0, and the voltage for drug detection was-50 mV. E. The results of the detection of 1.5. Mu.M gentamicin sulfate between LC-MS and PaMscS3 Ammi wells were compared. The electrolyte conditions were-cis terminal: 130mM NaCl, -trans end: 130mM NaCl,10mM HEPES, pH7.0, the detection voltage of the drug was-50 mV.

FIG. 15 is a schematic view of: A. the whole blood sample was assayed directly through a PaMscS3 (V271I) Amylor pore, which remained open after the addition of the whole blood sample. The electrolyte conditions were-cis terminal: 130mM NaCl, -trans end: 130mM NaCl,10mM HEPES, pH7.0, voltage-50 mV. B. After addition of 20. Mu.L rat blood, the-cis terminal conductance buffer turned red. C. Percentage of the channel of the whole blood sample open. D. The quantitative standard curve range of gentamicin sulfate is 0 to 3 μ M. E. Drug concentrations were measured by PaMscS3 emmetropium in rats at various time intervals after gentamicin injection. The electrolyte conditions for whole blood ehmitic pore detection are-cis: 130mM NaCl, -trans end: 130mM NaCl,10mM HEPES, pH7.0, voltage-50mV, N3.

FIG. 16: A. rat drug concentration monitoring system. B. The quantitative standard curve for gentamicin sulfate ranged from 0 to 30 μ M. C. Typical current traces for PaMscS3 (V271I) Ames pores during drug concentration monitoring with 4mg/kg and 20mg/kg gentamicin sulfate injections. D. Results of continuous drug blood concentration monitoring of rats through PaMscS3 angstrom wells at different doses of gentamicin sulfate (N = 1). Grey data points indicate that the drug blocking signal frequency is higher than the highest signal frequency within the standard curve range, and that the double step signal occurs frequently and makes the quantification inaccurate. The electrolyte conditions were-cis terminal: 130mM NaCl, -trans end: 130mM NaCl,10mM HEPES, pH7.0, voltage-50 mV.

FIG. 17: current trace against the background of the ehmitic well and the trace after addition of gentamicin sulfate. The electrolyte conditions were-cis terminal: 300mM NaCl, -trans end: 30mM NaCl,10mM HEPES, pH7.0, voltage-50mV, N =3.

FIG. 18: background current traces from the ehmitic wells and traces after addition of neomycin sulfate. The electrolyte conditions were-cis terminal: 300mM NaCl, -trans end: 30mM NaCl,10mM HEPES, pH7.0, voltage-50mV, N =3.

FIG. 19 is a schematic view of: at high concentrations of drug, the blocking signals of the drug are difficult to count and the pamsccs 3 (V271I) emmetro can become blocked for long periods of time, making quantitative calculations impossible. The electrolyte conditions were-cis terminal: 300mM NaCl, -trans end: 30mM NaCl,10mM HEPES, pH7.0, the voltage for drug detection was-50 mV.

FIG. 20: the electrolyte conditions were-cis terminal: 300mM NaCl, -trans end: 300mM NaCl,10mM HEPES, pH7.0, voltage +100mV, N =3.

FIG. 21: current trace against the ehmi well background and the trace after addition of the whole blood sample.

FIG. 22: mu.L rat whole blood was added to the-cis end (1 mL), and a PaMscS3 (V271I) Aminopore worked well in the presence of the whole blood sample.

FIG. 23: the electrolyte conditions were-cis terminal: 130mM NaCl, -trans end: 130mM NaCl,10mM HEPES, pH7.0. It is noted that two peaks appear in the gradient voltage.

FIG. 24: the electrolyte conditions were-cis terminal: 130mM NaCl, -trans end: 130mM NaCl,10mM HEPES, pH7.0. The structure of sisomicin is close to the C1a component of gentamicin sulfate. At the gradient voltage, only one blocking current peak is observed.

FIG. 28: alignment of sequences of the MscS family. Residues highlighted in red in figure 28d are identical in the 4 sequences; the columns above the sequence are designated alpha helix and beta strand.

Aminodorum pratense (L.) pers

The emittor pore used in the invention is a small conductance mechanical force sensitive channel (MscS), preferably a PaMscS (pseudomonas aeruginosa small conductance mechanical force sensitive channel) or a variant thereof. The variant (which may also be understood as a "mutant") may be a naturally occurring variant expressed by an organism, such as Pseudomonas aeruginosa. Variants also include non-naturally occurring variants produced by recombinant techniques. In the present invention, "PaMscS variant", "mutant PaMscS mutant" means the same meaning unless otherwise specified.

In one embodiment of the invention, the emmetropic pore may be an MscS variant. Amino acid substitutions, for example single or multiple amino acid substitutions, may be made to the amino acid sequence of SEQ ID NO 1 or

2or

3 or 4. Substitutions may be conservative or non-conservative. Preferably, one or more positions of the amino acid sequence of SEQ ID NO 1 or

2or

3 or 4 are non-conservatively substituted, wherein the amino acid residue to be substituted is replaced by an amino acid of significantly different chemical and/or physical size. Further, the MscS variants can be divided into side hole volume variants and side hole charge variants. A side hole volume variant refers to a variant in which the mutation site is located at the lateral opening (also understood as "side hole") of the cytoplasmic end and the side hole volume is changed by changing the amino acid at that site. The side-hole charge variant refers to a variant in which the mutation site is located at the side opening of the cytoplasmic end and the side-hole charge thereof is changed by changing the amino acid at the site. For example, the side-hole volume variant can be a substitution of a larger volume of an amino acid (e.g., tryptophan (W)) for a smaller volume of an amino acid (e.g., alanine (a), serine (S), or proline (P)), or vice versa. The side hole charge variant can be obtained by replacing an amino acid with a certain charge with an amino acid with an opposite charge or with a neutral charge, or by replacing an amino acid with a neutral charge. In general, non-limiting examples of positively charged amino acids include histidine, arginine, and lysine; non-limiting examples of negatively charged include aspartic acid and glutamic acid; non-limiting examples of neutrality include glycine, alanine, phenylalanine, valine, leucine, isoleucine, cysteine, asparagine, glutamine, serine, threonine, tyrosine, methionine, proline, and tryptophan. Conservative or non-conservative substitutions of amino acids, as well as many different types of modifications (deletions, substitutions, additions) of amino acids, etc., are well known in the art, and one skilled in the art can modify MscS as appropriate to obtain the corresponding MscS variant. Modifications include modification of the corresponding DNA sequence (e.g., direct synthesis of the corresponding protein after modification of DNA sequence information or site-directed mutagenesis of the DNA sequence by PCR) to obtain the corresponding variant (and its corresponding DNA sequence).

In a particular embodiment, the MscS variant can be a PaMscS variant. The PaMscS variants include, for example, one or more of 130A, 130H, 180R, 271I, 130S, and 130P. The side-hole volume mutants of PaMscS include, for example, 130A, 130S, 130P, and the side-hole charge variants of PaMscS include, for example, 130H, 180R, 271I. Such modifications can alter the pore size (also understood as "pore size") of the modified side pore, thereby improving the detection capability for analytes of a particular molecular volume; the local charge characteristics of the modified side-hole channel can also be changed, so that the detection capability of a specific charged analyte is improved; the stability of the protein channel current of the PaMscS variants can also be enhanced.

In one embodiment of the invention, the hermite pore may be a wild-type pamsccs that has a high background noise but still has the ability to detect an analyte.

In one embodiment of the invention, the hermite pore may be a wild-type EcMscS (e.coli small conductance mechanical force sensitive tunnel) or a variant thereof. The EcMscS has a highly similar structure to pammscs and also forms a stable tunnel current, enabling the detection of analytes. Sequence similarity of PaMscS to EcMscS was 60%. Conservative substitutions or non-conservative substitutions for amino acids, as well as many different types of modifications (deletions, substitutions, additions) to amino acids, are well known in the art, and one skilled in the art can modify EcMscS to obtain corresponding EcMscS variants, as appropriate.

In another embodiment of the invention, the herminium pores may be derived from other bacilli, such as anaerobe tengcnatus (Thermoanaerobacter tengconsis) and helicobacter pylori (helicobacter pylori), in addition to Escherichia coli (Escherichia coli) and Pseudomonas aeruginosa. PaMscS has the same high similarity with TtMscS and HpMscS, and the sequence similarity is 55% and 44% respectively. In combination with the results of actual electrophysiological measurements of PaMscS and EcMscS, it can be seen that MscS is able to detect analytes as hermite pores because of its highly similar structure and similar function. While conservative or non-conservative substitutions for amino acids, as well as many different types of modifications (deletions, substitutions, additions) to amino acids, are well known in the art, one skilled in the art can modify MscS, as appropriate, to obtain corresponding MscS variants.

Analyte

The analyte is a charged species. An analyte is charged if it has a net charge. The analyte may be negatively or positively charged. An analyte is negatively charged if it has a net negative charge. An analyte is positively charged if it has a net positive charge. Suitable analytes should be substances with a size smaller than or equal to the pore size of the hermite pores, preferably nucleotides, amino acids, peptides, drug molecules.

In one embodiment of the invention, the analyte may be a nucleotide. "nucleotide" refers to a monomeric unit consisting of a heterocyclic base, a sugar, and a phosphate group. It is understood that heterocyclic bases include naturally occurring bases (guanine (G), adenine (A), cytosine (C), thymine (T), and uracil (U)) as well as non-naturally occurring base analogs. Sugars include naturally occurring sugars (deoxyribose and ribose) as well as non-naturally occurring sugar analogs. The nucleotides include deoxyribonucleotides and ribonucleotides such as ATP, dATP, CTP, dCTP, GTP, dGTP, UTP, TTP, dUTP, GMP, UMP, TMP, CMP, dGMP, dAMP, dTMP, dCMP, dUMP, ADP, GDP, TDP, UDP, CDP, dADP, dGDP, dTDDP, dCDP. The nucleotides include naturally occurring nucleotides and non-naturally occurring nucleotide analogs that hybridize to nucleic acids in a manner similar to naturally occurring nucleotides. The nucleotides are free (or, alternatively, can be understood as "single"). Preferably, the nucleotide is ATP, dATP, CTP, dCTP, GTP, dGTP, UTP, TTP, dUTP.

In one embodiment of the invention, the analyte may be an amino acid. "amino acid" refers to any of the 20 naturally occurring amino acids found in proteins, the D-stereoisomers of naturally occurring amino acids (e.g., D-threonine), unnatural amino acids, and chemically modified amino acids. Each of these amino acid types is not mutually exclusive. The following abbreviations are used for the 20 naturally occurring amino acids: alanine (Ala; A), asparagine (Asn; N), aspartic acid (Asp; D), arginine (Arg; R), cysteine (Cys; C), glutamic acid (Glu; E), glutamine (Gln; Q), glycine (Gly; G), histidine (His; H), isoleucine (Ile; I), leucine (Leu; L), lysine (Lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y) and valine (Val; V). The specific properties (e.g., polarity, charge, hydrophilicity, average volume) of an amino acid are known to those of skill in the art. In another embodiment of the invention, the analyte may be a short peptide, such as a dipeptide.

In one embodiment of the invention, the analyte may be a drug molecule. The drug molecule may be a compound. More specifically, a "drug molecule" can be a drug having a molecular weight of 1000g/mol or less (e.g., less than 800, 700, 600, 500, 400, 300, or 200 g/mol). Preferably, the drug molecule may be an aminoglycoside antibiotic. In another embodiment of the invention, the drug molecules include amino acids and salts thereof (including non-druggable amino acids) and peptides.

Hermite system

The "angstrom pore system" includes pores having angstrom-scale dimensions (simply referred to as "angstrom pores"), an insulating film, a first dielectric, and a second dielectric. In one embodiment of the invention, the pores having angstrom-scale dimensions are small conductance mechanical force sensitive channel (MscS) angstrom pores. The pores having angstrom-scale dimensions are preferably heptameric structures having radial symmetry and a cylinder-like shape, comprising 7 side openings and 1 bottom opening. In one embodiment of the invention, the pores with angstrom-scale dimensions have a typical heptameric structure radially symmetric and shaped like a cylinder, comprising 8 openings, with 7 equal openings distributed on the sides, the 8 th opening distributed on the bottom and formed by 7 subunits; the aperture sizes of the 8 openings can be adjusted. The pores having angstrom-scale dimensions allow the analyte to translocate from one side of the insulating film to the other.

In one embodiment of the present invention, the pores with angstrom scale size are embedded in the insulating film, the insulating film (it can also be understood that the composite of the angstrom scale size pores and the insulating film) separates the first medium from the second medium, the pore channel of the angstrom scale size pores provides a channel for communicating the first medium and the second medium; upon application of a driving force between the first medium and the second medium, an analyte located in the first medium interacts with the MscS Eimeria pores to form an electrical current (i.e., an electrical signal). In the present invention, "first medium" refers to the medium in which the analyte is located when added to the hermite system; the "second dielectric" refers to the other side of the "first dielectric" in the two parts of the dielectric separated by the insulating film. In the present invention, the driving force refers to the force that drives the analyte to interact with the pores by means of electrical potential, electroosmotic flow, concentration gradient, and the like.

The first medium and the second medium may be the same or different, and the first medium and the second medium may include an electrically conductive liquid. The electric conduction liquid is an alkali metal halide aqueous solution, and specifically is sodium chloride (NaCl), lithium chloride (LiCl), cesium chloride (CsCl), potassium chloride (KCl) and sodium bromide (NaCl). In one embodiment of the present invention, the first medium and the second medium contain electrically conductive liquids having different concentrations, in other words, there is a difference in the concentrations of the electrically conductive liquids in the first medium and the second medium, so that there is a difference in osmotic pressure across the insulating film. The first medium and/or the second medium may also include a buffer, such as HEPES. The concentration of the first medium and/or the second medium may range from 30mM to 3M.

The insulating film refers to a film having the ability to carry angstrom pores (or nanopores) and block an ion current passing through non-angstrom pores (or nanopores). The insulating film may include a phospholipid film and/or a polymer film. Exemplary phospholipid membranes include DPHPC, DOPC, e.coli lipid, and exemplary polymeric membranes include triblock copolymer polymeric membranes.

The present angstrom pore system may comprise any of the small conductance mechanical force sensitive channels described herein, such as wild-type PaMscS (SEQ ID NO: 1), wild-type EcMscS (SEQ ID NO: 2), wild-type TtMscS (SEQ ID NO: 3), and wild-type HpMscS (SEQ ID NO: 4), and their corresponding variants, with specific sequence information for the four MscS listed in Table 4. For example, the small conductance mechanical force-sensitive channel can be a mutant PaMscS1 (W130A), a mutant PaMscS2 (K180R), a mutant PaMscS3 (V271I).

Table 4: amino acid sequence information of four MscS

In one embodiment of the invention, the angstrom pore system includes two electrolyte chambers separated by an insulating film to form a trans (-trans) compartment and a cis (-cis) compartment, the pores of the angstrom pores being embedded in the insulating film, and only small conductance mechanical force sensitive channels on the insulating film to communicate the two electrolyte chambers. When an electric potential is applied to the above two electrolyte chambers, electrolyte ions in the solution in the electrolyte chamber move through the angstrom pore by electrophoresis.

In one embodiment of the invention, the small conductance mechanical force sensitive channel (MscS) hermite pores may be embedded in the insulator film, but retain the ability to alter the protein structure in response to mechanical stimuli to which the insulator film is subjected and changes in the physical state of the insulator film. Specifically, the mechanical force stimulation includes osmotic pressure variation on both sides of the insulating film, direct physical stimulation of the insulating film by micro-needles, stimulation of the insulating film by negative pressure of air pressure, and the like. The physical changes of the insulating film include changes in thickness of the insulating film, changes in composition of the insulating film, and changes in curvature of the surface of the insulating film. The altering the protein structure comprises altering a charge property and/or pore size of the opening of the MscS. Further, the charge properties and/or pore size of the openings altered by the MscS-angstrom pores can be used to detect different analytes. The adjustable range of the aperture of the hermite hole related by the invention can be 5-15 hermite.

Interaction between the ehmitic pore and an analyte

The analyte may be in contact with the hermite hole on either side of the insulating film. The analyte may be in contact with either side of the insulating membrane such that the analyte passes through the passage of the hermite to the other side of the insulating membrane. In this case, the analyte interacts with the pores as it passes through the insulating film via the channels of the pores. Alternatively, the analyte may be in contact with a side of the insulating film, which may allow the analyte to interact with the angstrom pore, causing it to separate from the angstrom pore and stay on the same side of the insulating film. The analyte may interact with the pores in any manner and at any site. The analyte may also impinge on the angstrom pore, interacting with the angstrom pore, causing it to separate from the angstrom pore and reside on the same side of the insulating film.

During the interaction of the analyte with the angstrom pore, the analyte affects the current flowing through the angstrom pore in a manner specific to the analyte, i.e., the current flowing through the angstrom pore is characteristic of a particular analyte. Control experiments can be performed to determine the effect of a particular analyte on the current flowing through the hermite pores, and then to identify the particular analyte in the sample or to determine whether the particular analyte is present in the sample. More specifically, the presence, absence, concentration, or the like of an analyte can be identified based on a comparison of a current pattern obtained by detecting the analyte with a known current pattern obtained using a known analyte under the same conditions.

The hermite system of the present invention may further comprise one or more measuring devices, such as a patch clamp amplifier or a data acquisition device, that measure the current flowing through the hermite.

Sample(s)

The analyte may be present in any suitable sample. The invention is typically performed on samples known to contain or suspected of containing the analyte. The invention may be performed on samples containing one or more species of unknown analyte. Alternatively, the invention may identify the one or more species of analyte known to be present or expected to be present in the sample.

The sample may be a biological sample. The invention may be carried out in vitro on a sample obtained or extracted from any organism or microorganism. The invention may also be carried out in vitro on samples obtained or extracted from any virus. Preferably, the sample is a fluid sample. The sample typically comprises a bodily fluid. The sample may be a bodily fluid sample, such as urine, blood, serum, plasma, lymph, cyst fluid, pleural fluid, ascites fluid, peritoneal fluid, amniotic fluid, epididymal fluid, cerebrospinal fluid, bronchoalveolar lavage fluid, breast milk, tears, saliva, sputum, or a combination thereof. The sample may be derived from a human or from another mammal. The sample may be a non-biological sample. The non-biological sample is preferably a fluid sample, such as drinking water, sea water, river water, and reagents for laboratory testing.

The sample may be untreated prior to analysis, for example by detecting the analyte directly in whole blood. The sample may also be processed prior to analysis, for example by centrifugation, filtration, dilution, precipitation or other physical or chemical means known in the art.

In one embodiment of the invention, the sample is a whole blood sample.

In one embodiment of the invention, the sample is a nucleic acid amplification product.

Method for detecting the presence of nucleic acids in a sample

The invention also provides a method of detecting the presence of a nucleic acid in a sample. The method comprises the following steps: s1, placing a sample in a nucleic acid amplification system, carrying out nucleic acid amplification, determining the number of substrate nucleotides in the nucleic acid amplification system, and obtaining a nucleic acid amplification product of the sample; s2, adding a nucleic acid amplification product of the sample to an E.coli well system comprising: an angstrom pore, an insulating membrane, a first medium, a second medium, wherein said protein angstrom pore is embedded in said insulating membrane, said insulating membrane separates said first medium from said second medium, said angstrom pore provides a passageway that communicates said first medium with said second medium, said angstrom pore is an MscS angstrom pore, said angstrom pore has a radially symmetric and cylindrically shaped heptamer structure, said heptamer structure comprises 7 side openings and 1 bottom opening, and nucleic acid amplification products of said sample are added to said first medium; s3 applying a driving force between said first medium and said second medium, remaining nucleotides in nucleic acid amplification products of said sample interacting with said pores and generating an electrical signal (current); s4, quantifying the electric signal to obtain the number of the residual nucleotides; s5, comparing the number of the residual nucleotides with the number of the substrate nucleotides to determine whether the target nucleic acid exists in the sample. In some embodiments, S1 may be performed simultaneously with S2 or in the same system. Before detection, a threshold value may also be set, e.g., the presence of target nucleic acid in the sample is considered to be present only if the amount of at least one of the remaining nucleotides is below the threshold value; alternatively, only if the number of remaining nucleotides of all species is above the threshold is the target nucleic acid considered to be absent from the sample.

The "depletion strategy" of the present invention is actually applicable to a variety of transmembrane pores and is not limited to the angstrom pores of the present invention. One skilled in the art will appreciate that other transmembrane pores capable of detecting (and distinguishing) different nucleotides may be selected to detect the presence or absence of a target nucleic acid based on an understanding of the present invention.

"nucleic acid" refers to a deoxyribonucleotide or ribonucleotide polymer in either single-or double-stranded form. "nucleic acid amplification" of a target nucleic acid refers to a process of constructing in vitro a nucleic acid strand identical or complementary to at least a portion of the target nucleic acid sequence, which is only possible when the target nucleic acid is present in a sample. In nucleic acid amplification processes, enzymes (e.g., nucleic acid polymerases, transcriptases) are typically utilized to generate multiple copies of a target nucleic acid or fragment thereof, or multiple copies of a sequence complementary to the target nucleic acid or fragment thereof. After the nucleic acid amplification process occurs, the substrate nucleotides of the nucleic acid amplification system are reduced correspondingly with the increase of the copy number. FIGS. 3 and 4 are examples of nucleic acid amplification.

The principle of the method is based on the in vitro nucleic acid amplification technology to consume the substrate nucleotides in the nucleic acid amplification system, so that common in vitro nucleic acid amplification technologies, such as Polymerase Chain Reaction (PCR), ligase Chain Reaction (LCR), strand displacement amplification technology (SDA), transcription-mediated amplification Technology (TMA) and loop-mediated isothermal amplification technology (LAMP), can be used with the method provided by the invention.

In one embodiment, the methods provided herein allow for the detection of the presence of a novel coronavirus nucleic acid in a sample.

In one embodiment, the methods provided herein can detect the presence or absence of single-stranded nucleic acid in a sample.

In one embodiment of the invention, the invention is performed by constructing suitable primers (e.g., specific primers for SARS-CoV-2 nucleic acid) and introducing the primers into a nucleic acid amplification system (including the substrates dNTPs, polymerase, reverse transcriptase). If present in the sample, the new coronavirus nucleic acid is nucleic acid amplified under suitable conditions, consuming the substrates dNTPs and generating multiple copies of the nucleic acid. After the nucleic acid amplification product of the sample is added into the hermite system provided by the invention, macromolecular substances (such as enzymes, polynucleotides and the like) in the nucleic acid amplification system cannot pass through the hermite, that is, only free mononucleotides in the nucleic acid amplification system can pass through the hermite and generate specific current, and then the number of the remaining nucleotides is determined so as to judge whether the target new coronavirus nucleic acid exists in the sample (namely, if no target new coronavirus nucleic acid exists in the sample, the number of the remaining nucleotides is closer to the number of substrate nucleotides before nucleic acid amplification, and if the new coronavirus nucleic acid exists in the sample, the number of the remaining nucleotides is obviously lower than the number of substrate nucleotides before nucleic acid amplification, and more specifically, at least one nucleotide in the substrate nucleotides is completely consumed).

In one embodiment of the invention, the invention is performed by constructing a suitable probe (e.g., the probe comprises a sequence that is complementary paired to a target nucleic acid sequence and a polynucleotide sequence) and introducing the probe into a nucleic acid amplification system (including substrates dNTPs, polymerase). If the target nucleic acid sequence is present in the sample, nucleic acid amplifying the target nucleic acid sequence under suitable conditions to consume the substrate dNTPs and generate multiple copies of the target nucleic acid sequence; more specifically, since the probe also has a polynucleotide sequence (e.g., polyT, polyA, polyC, polyG), the presence or absence of the target nucleic acid sequence in the sample can be determined from the specific consumption of a certain substrate nucleotide because the substrate nucleotide corresponding to the polynucleotide sequence is consumed in a large amount after the target nucleic acid sequence is bound to the probe. After the nucleic acid amplification product of the sample is added into the hermite system provided by the invention, macromolecular substances (such as enzyme, polynucleotide and the like) in the nucleic acid amplification system cannot pass through the hermite, that is, only free mononucleotide in the nucleic acid amplification system can pass through the hermite and generate specific current, and then the number of the remaining nucleotides is determined so as to judge whether a target nucleic acid sequence exists in the sample (namely, if no target nucleic acid sequence exists in the sample, the number of the remaining nucleotides is closer to the number of substrate nucleotides before nucleic acid amplification, and if the target nucleic acid sequence exists in the sample, the number of the remaining nucleotides is obviously lower than the number of the substrate nucleotides before nucleic acid amplification and the corresponding polynucleotide in the probe is greatly consumed).

Method for detecting drug molecules in a sample

The present invention also provides a method of detecting a drug molecule in a sample, the method comprising: s1 adding said sample to a hermite system, said hermite system comprising: an angstrom pore, an insulating film, a first dielectric, a second dielectric, wherein said angstrom pore is embedded in said insulating film, said insulating film separates said first dielectric from said second dielectric, said angstrom pore provides a channel that connects said first dielectric with said second dielectric, said angstrom pore is an MscS angstrom pore, said angstrom pore has a radially symmetric and cylindrically shaped heptamer structure, said heptamer structure comprises 7 side openings and 1 bottom opening; the sample is added to the first medium; s2, applying a driving force to the first medium and the second medium, wherein the drug molecules in the sample interact with the pores and generate an electric signal; and S3, analyzing the electric signal so as to identify the drug molecules in the sample.

In one embodiment of the invention, the sample is a body fluid sample. The body fluid sample may be urine, blood, serum, plasma, lymph, cyst fluid, pleural fluid, ascites fluid, peritoneal fluid, amniotic fluid, epididymal fluid, cerebrospinal fluid, bronchoalveolar lavage fluid, breast milk, tears, saliva, sputum, or a combination thereof. The sample may be untreated prior to analysis, for example by detecting the analyte directly in whole blood. Of course, the sample may also be processed prior to analysis, for example by centrifugation, filtration, dilution, precipitation or other physical or chemical means known in the art. The samples referred to in the present invention include unprocessed samples and processed samples.

In one embodiment of the invention, the detectable range of the drug molecule may be greater than 10nM (also understood as the lower limit of detection is 10 nM). Preferably, the detectable range of the drug molecule may be 10nM to 1mM. If the concentration of the drug molecule is much greater than 10nM (e.g., 10 mM), it can be diluted to a concentration of 10nM to 1mM.

In one embodiment of the invention, the drug molecule is a compound. More specifically, a "drug molecule" can be a drug having a molecular weight of 1000g/mol or less (e.g., less than 800, 700, 600, 500, 400, 300, or 200 g/mol). Preferably, the drug molecule may be an aminoglycoside antibiotic such as gentamicin sulfate, neomycin sulfate, sisomicin, and the like. In another embodiment of the invention, the drug molecules include amino acids and salts thereof (including non-druggable amino acids) and peptides.

In one embodiment of the present invention, the present invention detects a drug molecule in a sample of body fluid, wherein the detection limit of the drug molecule is 10nM. In other words, the detectable range of the drug molecule in the body fluid sample may be greater than 10nM.

In one embodiment of the present invention, the present invention detects drug molecules in a whole blood sample (also understood as "blood sample"). After the whole blood sample is added to the hermite system provided by the invention, cells (such as red blood cells, white blood cells and blood platelets) and macromolecular substances (such as proteins) in the whole blood sample cannot pass through the hermite, that is, the cells and the macromolecular substances in the whole blood sample cannot block the hermite system provided by the invention. The drug molecules existing in the whole blood sample can pass through the hermite hole and generate specific current, and the hermite hole provided by the invention can sensitively identify the drug molecules with lower concentration, so that the existence and the concentration of the drug molecules in the whole blood sample can be judged.

In one embodiment of the invention, the methods provided herein can be used for continuous monitoring of blood drug levels of drug molecules in a subject.

In one embodiment of the invention, paMscS2 (K180R) and PaMscS3 (V271I) Amylor pores are used to detect drug molecules in whole blood samples, but other MscS and their corresponding variants are also within the scope of the invention, based on the ability of the variants to perform a sensory detection of drug molecules.

Specific examples are as follows:

example one

The material and the method are as follows:

sodium chloride (NaCl, >99.0%, CAS # 7647-14-5), dNTP mix (> 99.0%), dATP (> 97%, CAS # 1927-31-7), dCTP (> 98%, CAS # 102783-51-7), dGTP (> 98%, CAS # 93919-41-6), dTTP (> 98%, CAS # 18423-43-3) were purchased from Sangon Biotech. Yeast extract (CAS # 8013-01-2), trypsin (CAS # 73049-73-7), ampicillin sodium salt (not less than 98.5%, CAS # 69-52-3), tris (not less than 99.9%, CAS # 77-86-1), imidazole (Imidazole) (not less than 99%, CAS # 288-32-4), dodecyl-beta-D-maltoside (n-Dodecyl-beta-D-Maltopyranoside, DDM) (not less than 99%, CAS # 69227-93-6), isopropyl- β -D-thiogalactoside (IPTG) (≧ 99%, CAS # 367-93-1), phenylmethylsulfonylfluoride (PMSF) (≧ 99%, CAS # 329-98-6), 4- (2-Hydroxyethyl) piperazine-1-ethanesulfonic acid (4- (2-hydroxyethyi) piperazine-1-ethanesulfonylamino acid, HEPES) (> 99.5%, CAS # 7365-45-9) purchased from Sigma-Aldrich. Coli extracted phospholipids were purchased from Avanti. PrimeSTARHSDNA polymerase was purchased from TaKaRa. pUC57 vector plasmids, DNA templates, miRNA-21, AFP aptamers were synthesized by Sangon Biotech, and the sequence information is listed in Table 1.

TABLE 1 sequences of miR21 and AFP aptamers

Expression and purification of wild-type and mutant PaMscS:

the gene for PaMscS from Pseudomonas aeruginosa genomic DNA was amplified by Polymerase Chain Reaction (PCR) using gene-specific primers. The gene was inserted into a plasmid using the Clonexpress II One Step Cloning Kit (Vazyme). Coli BL21 (DE 3) cells containing a plasmid of PaMscS gene were cultured at 37 ℃ in Luria-Bertani (LB) medium in the presence of 50. Mu.g/mL ampicillin and purified by expression. The peak was determined by SDS-PAGE analysis. In particular, the expression and purification steps of the wild-type protein and the mutant protein are the same in the invention, but the wild-type protein and the mutant protein have sequence difference, so that the wild-type protein and the mutant protein have difference in plasmid synthesis stage.

The experimental team of the invention reveals the structure of the protein icopore through modeling, and the protein icopore is a typical heptamer which is radially symmetrical and similar to a cylinder. It contains 8 openings, 7 on the side and 1 on the bottom. The N-terminal residues 1-13 are too flexible to be resolved in the model. Topologically, paMscS can be divided into 2 parts, a transmembrane region and a large cytoplasmic part. Each monomer produces three N-terminal transmembrane helices, including TM1 (residues 17-52), TM2 (residues 58-83) and TM3 (residues 90-122). The C-terminal cytoplasmic domain can be divided into an intermediate beta domain and a COOH terminal domain. TM1 and TM2 in each subunit are arranged together in an anti-parallel direction, and TM1 passes through the through holeThe double layer of membrane outside the tunnel and TM2 forms the central layer, forming a permeation path around the channel axis. The TM3 helix can be described as two helix segments, TM3a and TM3b, separated by a distinct kink (kink) at Gly108 to 53 °, which are conserved residues in homology. TM3a passes through the membrane with different deflections like TM1, while TM3b returns to the cytoplasm and interacts with the cytoplasmic region. In addition, 7 subunits form a E-radius

And (ii) a central aperture that senses tension and is associated with a conformational change. Comparing the MscS structures of Pseudomonas aeruginosa and Escherichia coli, the former has a smaller tilt angle of TM1 and TM2 than the latter, which results in a large deflection of the TM region, especially the loop between TM1 and TM 2. In the cytoplasmic region, the intermediate beta domain (residues 123-172) contains 5 beta strands, which are tightly linked to the beta strands of other different subunits. And the C-terminal domain (residues 177-273) consists of 5 beta strands and 2 alpha helices, which are mixed structures. Between these two domains of adjacent monomers, there were 7 equal openings on the sides, clearly visible, with a radius of about

It is proposed to be the cause of ion permeation in EcMscS. In addition to these inlets, the 8 th opening is present in the bottom of the protein, which is represented by 7 beta strands with a narrowest radius of E.E.E.E.

In all sizes, extend to &

PaMscS2 is parallel to the seven-fold axis and has a width in the vertical direction of &

The structure of PaMscS is similar to EcMscS in the off state (PDB: 2 OAU), with over 101 rmsd of the TM domain

C of (A) _α Atomic, but in the open state (PDB: 2VV 5), there is a large difference in the TM region, rmsd is

These results indicate that the conformation of PaMscS in structure reflects the off state. Overall, the unique and fine structure of the PaMscS emmer pore shows great potential for detection.

Site mutation:

modifying the DNA sequence corresponding to the corresponding amino acid site (including direct synthesis or PCR mutation after DNA sequence modification), and modifying the DNA sequence of the target mutation site into the DNA sequence corresponding to the mutant protein. Mutant proteins of mutant PaMscS proteins emmer pores may include 130A, 130H, 180R, 271I, 130S, or 130P.

Merging of membranes and single-channel recording:

the experiments were performed in a vertical cuvette supplied by the Warner instrument, all current traces being recorded by the HEKA EPC 10 USB patch clamp amplifier with a sampling frequency of 9900Hz, if not mentioned specifically. mu.L of a 25mg/mL E.coli membrane was precoated on the 150 μm orifice of the cup, and then 1mL of an electrolyte solution (-trans end: 100mM NaCl,10mM HEPES, pH7.0; cis end: 300mM NaCl,10mM HEPES, pH 7.0) was added to each side of the sample cell. A1 mL pipette was then used to aspirate approximately 2/3 of the electrolyte solution from the cell from the-cis end. When the average current approaches 0pA, the electrolyte solution is driven to the-cis side of the cell to form a planar phospholipid bilayer membrane. After phospholipid membrane formation, a solution of PaMscS1 protein was added to the-cis terminus. When PaMscS1 was embedded in planar phospholipid bilayer membranes, there was a significant change in current. After the protein was embedded, 1mL of the solution was replaced and the subsequent experiment was performed.

Single nucleotide detection:

different sets of amplification products were detected by MscS Ammi well. Different samples were added to the-cis end, recorded at +50mV and observed for 20 min. When a stable PaMscS1 angstrom pore is formed on a planar phospholipid membrane, the mononucleotide to be detected is added to the-cis end of the sample pore, then a voltage is applied and a current signal is recorded.

Collection and handling of coronavirus clinical specimens:

clinical specimens of SARS-CoV-2 patients were collected from throat swabs (patient Nos. 1 to 15) and blood (patient Nos. 16 to 22), and subjected to reverse transcription to obtain cDNA.

Reverse transcription of RNA and PCR amplification:

the SARS-CoV-2 RNA reverse transcription amplification system of the invention is as follows: random hexamers (60. Mu.M) and anchor polyT (23): 1. Mu.L, dNTP mix (10 mM each): 1. Mu.L, RNA sample: 11. Mu.L. The reaction was incubated in a thermal cycler at 65 ℃ for 5 minutes. The samples were immediately placed on ice to cool rapidly for >1 minute. Then, in a clean pre-PCR chamber, the following reagents were mixed with the sample: 5 XSuperScriptIV buffer: 4 μ L, DTT (100 mM): 1 μ L, RNaseOUT RNase inhibitor: 1 μ L, superscript IV reverse transcriptase: 1 μ L. The cDNA was obtained after incubating the samples in a thermal cycler using a program of 42 ℃ for 50 minutes and 70 ℃ for 10 minutes. The cDNA PCR amplification system in the experiment of the invention is as follows: ddH2O: 26.5. Mu.L, 5 XPrimeSTAR buffer (Mg 2+ Plus): 10 μ L of dNTP mix (2.5 mM): 4 μ L, primer 1 (forward primer ORF P1, 10 μ M): 2 μ L, primer 2 (reverse primer ORF P2, 10 μ M): 2 μ L, primeSTAR HS DNA polymerase (2.5U/. Mu.L): 0.5 μ L, cDNA sample: 5 μ L. The amplification procedure was as follows: preheating at 95 ℃ for 5 minutes, and heat-denaturing at 98 ℃ for 10 seconds. Refractive annealing at 55 ℃ for 15 seconds, followed by extension at 72 ℃ for 12 seconds. The cycle was repeated 35 times. The primers are independently synthesized by the research team and have the following sequences:

ORF P1：TTGTTTGAATAGTAGTTGTCTGA(SEQ ID NO:7)

ORF P2：TCAACTCAATATGAGTATGGTACTG(SEQ ID NO:8)

reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) and detection:

performing an RT-LAMP reaction comprising the following system: ddH ₂ O：4.1μL，

Colorimetric LAMP 2X Master Mix(DNA&RNA)：12.5μL，F3(20μM)：0.2μLB3 (20 μ M): 0.2 μ L, FIP (20 μ M): 1 μ L, BIP (20 μ M): 1 μ L, loopF (20 μ M): 0.5 μ L, loopB (20 μ M): 0.5 μ L, template: 5 μ L. The LAMP reaction was run at 60 ℃ for 30 minutes.

Nucleic acid amplification and detection:

the nucleic acid amplification system of the present invention is as follows: ddH2O:64.6 μ L,5 XPrimeSTAR buffer (Mg 2+ Plus): 20 μ L, dNTP mix (10 mM each): 6 μ L, primer 1 (

miRNA

21, 100 μ M): 0.4 μ L, primer 2 (AFP aptamer, 10 μ M): 4 μ L, template 1 (extract, polyT): 2 μ L, template 2 (polyC, 1 μ M): 2 μ L, primeSTAR HS DNA polymerase (2.5U/. Mu.L): 1 μ L. The amplification procedure was as follows: preheating at 95 ℃ for 5min and heat-denaturing at 98 ℃ for 10s.60 ℃ refractive annealing for 15 seconds, followed by 68 ℃ extension for 23 seconds. The cycle was repeated 30 times in total, and the results of nucleic acid amplification are shown in FIG. 13.

Analysis of electrobiological data:

in the present invention, electrobiological data were processed by the clautfit software and plotted with Origin software.

Example two

Electrophysiological detection and dNTP detection based on PaMscS ehmitic wells:

the basic function of MscS is a fast on/off switch in response to mechanical stimuli, such as changes in membrane tension during osmotic pressure. The cytoplasmic domain of MscS functions as a molecular sieve that balances osmotic agent loss during osmoadaptation (osmoadaptation). In the protein icorn pore of the present invention, 7 side pores from the cytoplasmic region play a key role in the translocation (translocation) of ions and solutes. Therefore, the side-hole mutants PaMscS1 (W130A) and PaMscS2 (K180R) were selected for subsequent studies due to low background noise (fig. 5, fig. 6A-C). In electrophysiological experiments, purified proteins were added to the-cis end of the electrophysiological device (FIG. 1A). When the PaMscS mutant channel is embedded in a bilayer lipid membrane (BLM, a kind of insulating membrane), stable channel current hopping can be observed at a voltage of +50mV (fig. 1B). At voltages ranging from-50 mV to +50mV, the channel conductance of PaMscS1 remained stable (FIG. 1C), and when the voltage was higher than +90mV, the gating probability of PaMscS1 increased (FIG. 7). The conductance of the PaMscS1 angstrom wells was 0.64 ± 0.02nS (n =91, gaussian-fit peak ± SD, -cis end: 300mM NaCl, -trans end: 30mM NaCl), and the conductance profile of the PaMscS2 angstrom wells was 34.9 ± 7.0pA (mean ± SD from 18 independent insertion events) (fig. 1D). Ion transport results for PaMscS1 indicated that PaMscS1 had better selectivity for Br "(fig. 8).

In the case of insertion of a PaMscS1 Am pore in BLM and the presence of dNTPs in the-cis terminus, translocation signals of the dNTPs can be observed at positive voltages. The translocation frequency of dNTPs increased with increasing voltage (figure 9). Both PaMscS1 and PaMscS2 were analyzed for dNTP mixture detection (dNTPs concentration: 0.2mM, voltage: +50mV, -cis terminal: 300mM NaCl, -trans terminal: 30mM NaCl). A clear difference in the blocking current distribution can be observed between the two mutants, indicating that the translocation of dNTPs is associated with the side aperture of the PaMscS amesdial pore (fig. 1E), i.e. the PaMscS1 and PaMscS2 amesdial pores appear differently to the distribution of dNTPs blocking currents under the same assay conditions. In particular, the PaMscS1 angstrom pore exhibited 3 peaks for the four dNTPs cocktail blocking rates, while the PaMscS2 angstrom pore exhibited 2 peaks for the four dNTPs cocktail blocking rates. Since the difference between the pamsccs 1 and pamsccs 2 mutations is in the side hole amino acid difference, it is presumed that the detection signal of dNTPs correlates with the side hole. Since PaMscS1 has a better discriminating effect on dNTP mixtures, it is more suitable for discriminating dNTPs mixtures. Whereas for pamsccs 2 it shows more stable channel conductance and relatively higher membrane fusion efficiency, and thus it is more suitable for subsequent rapid diagnosis (fig. 6A-C). The wild-type PaMscS emmer pore exhibited 2 peaks for the four dNTPs cocktail blocking rates (fig. 29). The current traces and residence time distributions for detection of single nucleotides by PaMscS1 are shown in FIGS. 10A-D.

Compared with the currently reported composition containing am7 beta CD and MoS ₂ Compared to the nanoporous α -hemolysin of α -Hederin, although the detection accuracy of the PaMscS s1 angstrom pore was lower than the reported optimal biological nanopore containing am7 β CD conjugate (i.e., constructed using an α -hemolysin mutein and a 6-amino-6 deoxy- β -cyclodextrin aptamer), the translocation speed was comparable to the solid state nanopore. In a single-stranded DNA (ssDNA) detection experiment, 50. Mu.M of ssDNA was detected under a buffer condition of 30mM NaCl/300mM NaCl and at a bias voltage of +50mVThe channel size was narrower, so no translocation event was observed (fig. 11). Therefore, the PaMscS mutant hermite pore has the potential to be a useful small molecule sensor.

EXAMPLE III

Selective adjustment of PaMscS1 angstrom wells was used for optimized dNTPs detection:

given the mechanical force sensitivity of the PaMscS s1 angstrom pore, the experimenter adjusted the selectivity of the PaMscS s1 angstrom pore by applying different osmotic pressure differences. To maintain constant charge characteristics of dCTP and dGTP at different osmotic pressure differences, the experimenter maintained the conductivity buffer concentration at the-cis end at 300mM and varied the conductivity buffer concentration at the-trans end to vary the osmotic pressure difference. The detection capacity of PaMscS1 angstrom pores for large and small molecule dGTP and dCTP was tested under 3 conditions of differential osmotic pressure, including symmetric (symmetric) conditions (FIG. 2A,300mM NaCl/300mM NaCl, +50mV bias), low differential osmotic pressure conditions (FIG. 2B,100mM NaCl/300mM NaCl, +50mV bias) and high differential osmotic pressure conditions (FIG. 2C,30mM NaCl/300mM NaCl, +50mV bias). Under the condition of symmetric osmotic pressure, the translocation frequency of dCTP is from 0.16 +/-0.03 s ^-1 Increase to 0.22 + -0.07 s ^-1 And dGTP is from 0.09 + -0.02 s ^-1 Change to 0.07. + -. 0.003s ^-1 . The translocation frequency of dCTP was from 0.34. + -. 0.1s under conditions of low differential permeability (LOD) ^-1 Increased to 0.67 + -0.14 s ^-1 And dGTP is from 0.06 + -0.01 s ^-1 Increased to 0.3 + -0.04 s ^-1 . Under high osmotic pressure (HOD) conditions, the translocation frequency of dCTP is from 0.12 + -0.04 s ^-1 Increase to 0.22 + -0.07 s ^-1 And dGTP is from 0.37 +/-0.08 s ^-1 Increased to 1.12 + -0.12 s ^-1 (fig. 2D, n =3, mean ± s.e.m for each experiment). Figure 2E summarizes the detection of dGTP and dCTP, and it is summarized that low differential osmotic pressure conditions showed the highest increase in translocation events for dCTP, while high differential osmotic pressure conditions showed the highest increase in translocation events for dGTP (figure 2E). The low osmotic pressure conditions show a balanced capture capacity for both dCTP and dGTP compared to the reduced capture efficiency of dCTP under high osmotic pressure conditions. Given that the size and charge characteristics of dGTP and dCTP remain constant under given experimental conditions, and the MscS family (e.g., ecMscS, hpMscS, atMsL1 eggs)White, etc.) may vary in channel size under different pressure, osmotic conditions or membrane potentials, and the experimenter can draw conclusions: the differences in selectivity of the PaMscS 1-angstrom pore for dNTPs are caused by changes in the size of the tunnel under different osmotic pressure conditions.

Example four:

detection of SARS-CoV-2 clinical samples by PaMscS 2:

the rapid and simple detection of SARS-CoV-2 nucleic acid is an important prevention method for the prevalence of SARS-CoV-2. Here, the experimenter performed the detection of SARS-CoV-2 using primers specific to SARS-CoV-2Orf1ab (cDNA) (FIG. 3A). The PaMscS2 angstrom pore has higher membrane fusion efficiency and is applied to detection. The target sequence was 172bp, and fragment analysis of the amplified product indicated that the primers were useful for amplification of the target gene (Table 2). The SARS-CoV-2Orf1ab gene was synthesized and the gradient concentration of the SARS-CoV-2Orf1ab gene was examined. Synthetic SARS-CoV-2Orf1ab gene can be detected at concentrations ranging from 10^3 copies/mL to 10^11 copies/mL (FIG. 3B). Then, 22 clinical samples were tested, including 15 samples from patients diagnosed and 7 samples from healthy controls. Both 15 positive samples and 6 negative samples (patient nos.: 1 to 15, 17 to 22) tested through the E.coli showed results consistent with the clinical test (Table 3), and 1 negative sample was diagnosed as a false positive result (patient No.: 16). The specificity of the method was 86% and the sensitivity was 100% (FIG. 3C). As a nano device for Nucleic Acid Amplification monitoring, the pamscc mutant hermite system can be combined with various NAATs (Nucleic Acid Amplification Tests) (fig. 12) such as polymerase chain reaction and chain displacement Amplification to detect a target gene (fig. 3D), and the hole also has the potential of monitoring a reverse transcription process, and can realize rapid and Amplification-free detection of a target RNA.

Table 2: fragment length and amplification product concentration

Table 3: ct value and the detection result of the Hermite in clinical samples

Example five:

detection of various biomarkers through PaMscS1 angstrom pores:

experimenters designed a discrimination strategy for dNTP barcode probes and validated their application in the detection of various biomarkers through a PaMscS1 angstrom well. Two probes were designed to bind to the target DNA sequence and cause specific dNTPs consumption in a chain polymerization reaction, where the miR21 probe (probe a): a barcode sequence comprising a sequence complementary paired to miR21 and a polyT; AFP aptamer probe (probe B): a barcode sequence comprising a sequence complementary to the AFP aptamer pair and a polyC. When either probe A or probe B is present in the sample, the polymerase chain reaction can be activated, consuming either dATP or dGTP in the reaction system (FIG. 4A). Control samples without target sequence, samples with miR21, samples with AFP aptamer, and samples with both miR21 and AFP aptamer were tested. The corresponding current traces and blocking current profiles are shown in fig. 4B and 4C. It can be observed that in the control group (sample without miR21 and AFP aptamer), dATP (. Delta.f) _dATP ＝f _dATP /f _Background ) Relative increase in frequency of translocation events of (d) 1.7. + -. 0.2 (mean. + -. S.E.M), dGTP (δ f) _dGTP ＝f _dGTP /f _Background ) The relative increase in frequency of translocation events of (a) is 1.8 ± 0.03. In the sample with miR21,. Delta.f _dATP Significantly lower than control (1.4 + -0.1, mean + -S.E.M) in samples with AFP aptamer,. Delta.f _dGTP Down to 1.0 ± 0.3 (mean ± s.e.m). For samples with both miR21 and AFP aptamer, δ f compared to control group _dATP (1.1. + -. 0.2, mean. + -. S.E.M) and. Delta.f _dGTP (1.3. + -. 0.2, mean. + -. S.E.M) were all reduced (FIG. 4D). TheseThe results show that PaMscS1 can detect single or multiple biomarkers simultaneously (n.gtoreq.3 per experiment).

Example six:

a strategy to enhance a signal:

A. the detection limit of the substances to be detected is enhanced through ion regulation, particularly for dNTPs, the detection limit of the dNTPs can be improved by adding divalent cations such as nickel ions and cobalt ions into the cytoplasmic end of the hermite related to the invention; B. the signal to noise ratio is enhanced through adjustment of the electric conduction liquid permeation difference, the distinguishing capacity of the medicine molecules with similar structures can be improved through improving the concentration of the electric conduction liquid, and the detection effect on dGTP can be improved through improving the permeation difference of the electric conduction liquid on the two sides of the phospholipid membrane.

Example seven:

drug detection

1. Drug measurements by LC-MS:

LC-MS and LC-MS/MS analyses were performed on Shimadzu ultra fast liquid chromatography (UFLC, shimadzu) and AB SCIEX Qtrap 5500 mass spectrometers, equipped with a Turbo Spray ion source (Turbo Spray ion source). Collection and analysis of chromatographic and mass spectral data was done by analyst1.6.2 software (AB SCIEX, USA).

The chromatographic separation was carried out on a Waters acquisition UPLC BEH C18 column (2.1 mm × 100mmi.d.,1.7 μm). The mobile phase consisted of water (a) and acetonitrile (B), eluting with a gradient as follows: 0-1.0 min, 10-90% by weight B;1-2.0 minutes, 90% B. The flow rate was 0.5mL/min. The column temperature and the autosampler temperature were maintained at 35 ℃ and 15 ℃ respectively. The injection volume was 1. Mu.L.

In MS/MS analysis, positive ionization mode was used for sample detection with the following optimized mass spectrometry parameters: ion spray voltage, 5500V; declustering voltage, 100V; temperature, 500 ℃. The MRM (multiple reaction monitoring) mode was chosen for quantification of gentamicin sulfate and IS (internal standard), the ion pairs were 450.2-160.1, 464.2-160.1, 478.2-157.1 and 265.2-232.2, respectively.

2. Gentamicin sulfate was continuously monitored from a dialysis device connected to the blood vessels of living rats:

male Sprague-Dawley rats (250-300 g) were provided by Woodward Dawley animals, inc., and all animal experiments in the present invention were approved by the ethical Committee of the Waxi hospital, sichuan university (approval No. 2021885A).

Rats (n = 1) were anesthetized with 2% pentobarbital and the left femoral vein was isolated and catheterized to provide one intravenous injection port. Next, an initial 0.4mL heparin solution (250U/mL) was injected through the catheter, followed by 0.1mL per 40 minute cycle to prevent clot formation during monitoring. The left femoral artery was then isolated, catheterized, and immediately connected to the device through a pre-designed tube with dialysis membrane. After the air in the device is expelled by the blood stream, the tube is connected to an intravenous catheter to form a stable circulation. For continuous monitoring, a baseline signal was first recorded in the absence of the target drug, followed by a slow infusion of a specific concentration of gentamicin sulfate through an intravenous catheter. For the interval measurement of the blood concentration, a similar cycle is established, with neither equipment nor dialysis membrane. Blood samples were collected from the arterial catheters at 0, 15, 30, 45 and 60 minutes and drug concentrations were measured using PaMscS3 (V271I) emmer pores. After each experiment, the rats were sacrificed by cervical dislocation.

3. And (3) whole blood detection:

collecting 10 microliter of rat blood, adding the rat blood into a sample groove fused with an Hermite hole (-cis end), applying bias voltage, recording the signal frequency in a certain time of sample addition, then subtracting the blank blood control frequency from the signal frequency, and calculating to obtain the corresponding concentration of the molecule according to the standard curve of the detected molecule.

As a result:

1. drug monomolecular biosensing based on PaMscS emmer pores:

according to the channel structure of PaMscS angstrom pores, small molecule drugs (molar mass less than 1000 g/mol) are selected for detection. Gentamicin sulfate (gentamicin sulfate; molecular weight: MW 561.65) and neomycin sulfate (neomycin sulfate; molecular weight: 712.72) were tested for quantitative determination because of their large-scale clinical use, suggesting an urgent need for convenient TDM (therapeutic drug monitoring). The test for gentamicin sulfate and neomycin sulfate was carried out in the presence of 300mM NaCl (-cis terminal) and 30mM NaCl (-trans terminal), 10mM HEPES, pH7.0, and a drug test voltage of-50 mV. Significant blocking current signals appeared after drug addition to the detection system (fig. 14A, 14B, fig. 17, fig. 18). Standard curves for gentamicin sulfate showed linear detection ranging from 10nM to 10 μ M (N = 3), and 2D density plots of typical gentamicin sulfate signals showed peak occlusion currents of 11.57 ± 0.02pA and peak residence times of 1.33 ± 0.02ms (fig. 14C, peak of gaussian fit, 878 occlusion events). The standard curve for neomycin sulfate showed a linear detection range of 100nM to 100 μ M (N = 3), and the 2D density plot of a typical neomycin sulfate signal showed a peak occlusion current of 9.44 ± 0.02pA and a peak residence time of 1.06 ± 0.01ms (fig. 14D, gaussian-fitted peak, 883 occlusion events). Higher drug concentrations may lead to severe obstruction of the channels and make drug concentration calculation difficult (fig. 19). Besides gentamicin sulfate and neomycin sulfate, the PaMscS E.oryzae pores can also sense other drugs, such as sisomicin (MW: 447.53), pyrophosphate (MW: 177.975), in a single molecule.

To assess the accuracy of detection of drugs by PaMscS3 (V271I) E.coli, LC-MS was used to measure the concentration of gentamicin sulfate. Similar detection results were exhibited by the PaMscS3 (V271I) Aminopore and LC-MS for the 1.5 μ M gentamicin sulfate sample, indicating that detection of the PaMscS3 (V271I) Aminopore was of good accuracy (FIG. 14E).

2. Drug concentration measurement of whole blood samples:

blood is the main medium for Therapeutic Drug Monitoring (TDM), but the whole blood has complex components, which can cause serious interference to nanopore detection. A commonly used nanopore MspA-2NN was blocked after addition of 10. Mu.L of whole blood sample to the-cis end (1 mL volume at the-cis and trans ends), with a probability of only 5% + -4.7% of open channels at +100mV within 300s (FIG. 20, electrolyte conditions-cis end: 300mM NaCl, -trans end: 300mM NaCl,10mM HEPES, pH7.0, N = 3). In contrast, the PaMscS2 Omegano well can maintain the opening of the channel with a 99% + -1% probability of opening the channel at +100mV within 300s even when 20. Mu.L of whole blood is added to the-cis end (FIGS. 15A, 15B, 15C, electrolyte conditions of-cis end: 130mM NaCl, -trans end: 130mM NaCl,10mM HEPES, pH7.0, N = 3). Given the robust detection capability of the PaMscS3 (V271I) ehmitic pore, gentamicin sulfate plasma concentrations in rats were measured directly at various time intervals (0 min, 15 min, 30 min, 45 min, and 60 min, fig. 21, fig. 22) after 4mg/mL gentamicin sulfate injection. The standard curve for gentamicin sulfate ranged from 0 to 3. Mu.M and was used to calculate drug concentrations (FIG. 15D, N.gtoreq.3). Of the 5 monitoring points, 15 minutes had the highest drug concentration and 60 minutes had the concentration decreased to the pre-injection level (0 minutes) (FIG. 15E, N.gtoreq.3). The drug concentration trend measured by the PaMscS3 (V271I) angstrom hole accords with the pharmacokinetic rule, and the PaMscS angstrom hole can accurately measure the change of the drug concentration in the living rat body. Interestingly, the occlusion current profile of gentamicin sulfate showed two peaks in 130mM NaCl buffer at higher negative voltage (fig. 23), while single component sisomicin (sisomicin) showed one occlusion current peak under the same conditions (fig. 24), indicating that the two occlusion current peaks of gentamicin sulfate may be related to its multiple components.

3. Continuous monitoring of the drug by dialysis devices connected to the blood vessels of living rats:

due to the wide variation in drug metabolism rates among different patients, particularly critically ill patients, it is difficult to meet the needs of precision medicine with the spaced TDM technique. Therefore, continuous monitoring of drug concentration is highly desirable. To achieve long-term monitoring of drug concentrations in living animals, experimenters have introduced dialysis membranes to avoid blood consumption. In TDM processes, a small amount of blood flows through a conduit to a dialysis device and then back into the body. Small molecule drugs in the blood can permeate into the conducting fluid at the-cis end through the dialysis device without substantial depletion of blood (fig. 16A). Standard curves for gentamicin sulfate ranged from 0 to 30 μ M for continuous monitoring drug concentration calculations (fig. 16B). In the feasibility verification experiments in live rats, a clear signal of gentamicin sulfate was continuously observed up to 3 hours after injection, based on a simple dialysis device (fig. 16C). Different doses of gentamicin sulfate, including 4mg/kg and 20mg/kg, in rats can be distinguished by an epothilone well monitoring device (FIG. 16D). These results indicate that the system can continuously monitor the drug concentration in live animals with minimal loss.

Example eight:

electrophysiological detection based on ecMscS hermite

When the wild-type EcMscS channel is embedded in a Bilayer Lipid Membrane (BLM), stable channel current hopping can be observed at a voltage of +100mV (fig. 25). The wild-type EcMscS channel current remained stable at voltages ranging from-100 mV to +100mV (fig. 26). The conductance of the wild-type EcMscS E-rice wells was 0.334. + -. 0.028nS (-cis end: 300mM NaCl, -trans end: 30mM NaCl) (FIG. 27). Fig. 28a-c show the structures of EcMscS, ttMscS and HpMscS, respectively, which are highly similar to the structures of pammscs, i.e. heptameric structures that are both radially symmetric and shaped like cylinders. In addition, fig. 28a-c and 28d further compare sequences of PaMscS with EcMscS, ttMscS, hpMscS, which indicates that EcMscS, ttMscS, hpMscS have some homology to pammscs, but this homology is not highly homologous. EcMscS and pammscs are only 60% similar, but both have the ability to detect analytes. Thus, it will be appreciated by those skilled in the art that the key to determining the ability of a bacterial MscS to serve as an emittor-pore analyte is its radially symmetric, cylindrically shaped heptamer structure and tunnel pore size, not just homology.

Example nine:

amino acid detection based on PaMscS emmer pores

In this example, amino acid detection was performed using PaMscS1 as an example. Glutamic acid (10 mM) was assayed under the conditions of 300mM NaCl (-cis terminal) and 30mM NaCl (-trans terminal), 10mM HEPES, pH7.0, and at-50 mV for drug detection. The current trace of glutamic acid is shown in fig. 30.

Short peptides (e.g., dipeptides) can be detected by the hermite pores of the present invention in addition to single amino acids. As shown in the left panel of FIG. 31, the amino acid to be tested and the aspartic acid carrier are subjected to dehydration condensation to form a dipeptide, the formed dipeptide is detected under the conditions of 300mM NaCl (-cis terminal), 30mM NaCl (-trans terminal), 10mM HEPES and pH7.0 electrolyte, and a current signal generated by the dipeptide is compared with a specific current signal of the tested amino acid to judge the type of the amino acid to be tested.

To summarize:

in the present invention, experimenters have studied a new class of sub-nanochannels, pammscs, as single molecule sensing. Structural information and electrophysiological examination of wild-type and mutant PaMscS E-wells confirmed the ability to directly detect dNTPs. Depending on the size of the analyte, the selectivity of the hermite may be adjusted in situ to obtain the best detection efficiency. In contrast to monitoring of increased synthesized nucleic acid products in NAAT, pamsccs hermite can be used to directly determine the consumption of DNA components during DNA amplification, with significantly greater amounts of change than DNA products. According to this strategy, SARS-CoV-2 clinical specimens were detected with specificity and sensitivity of 86% and 100%, respectively. With this strategy, two target biomarkers including miR21 and AFP aptamers were also detected simultaneously by dNTP barcode probes, indicating that a PaMscS emmer pore can be used for coded detection of multiple biomarkers. The angstrom-scale hole can also realize the direct detection of low molecular weight molecules (such as amino acid and medicine).

While the present invention has been described with reference to the embodiments shown in the drawings, the present invention is not limited to the embodiments, which are illustrative and not restrictive, and it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope of the invention as defined in the appended claims.

Reference documents

1.Liu,H.&Johnston,A.P.R.AProgrammable Sensor to Probe the Internalization of Proteins and Nanoparticles in Live Cells.Angewandte Chemie International Edition52,5744–5748(2013).

2.Li,X.etal.Plant DNA barcoding:from gene to genome.Biological Reviews90,157–166(2015).

3.Wilson,P.M.et al.A novel fluorescence-based assay for the rapid detection and quantification of cellular deoxyribonucleoside triphosphates.Nucleic Acids Research39,e112–e112(2011).

4.Fuller,C.W.etal.Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.Proceedings of the National Academy of Sciences of the United States of America113,5233–5238(2016).

5.Butler,T.Z.,Pavlenok,M.,Derrington,I.M.,Niederweis,M.&Gundlach,J.H.Single-molecule DNA detection with an engineered MspA protein nanopore.Proceedings of the National Academy of Sciences105,20647–20652(2008).

6.Goyal,P.et al.Structural and mechanistic insights into the bacterial amyloid secretion channel CsgG.Nature516,250–253(2014).

7.Cao,C.et al.Mapping the sensing spots of aerolysin for single oligonucleotides analysis.Nature Communications9,2823(2018).

8.Wendell,D.et al.Translocation of double-stranded DNA through membrane-adapted phi29 motor protein nanopores.Nature Nanotechnology4,765–772(2009).

9.Manrao,E.A.et al.Reading DNA at single-nucleotide resolution with a mutant MspA nanopore and phi29 DNA polymerase.Nature Biotechnology30,349–353(2012).

10.Bowden,R.et al.Sequencing of human genomes with nanopore technology.Nature Communications10,1869(2019).

11.Wang,Y.,Zheng,D.,Tan,Q.,Wang,M.X.&Gu,L.-Q.Nanopore-based detection of circulating microRNAs in lung cancer patients.Nature Nanotechnology6,668–674(2011).

12.Thakur,A.K.&Movileanu,L.Real-time measurement of protein–protein interactions at single-molecule resolution using a biological nanopore.Nature Biotechnology37,96–104(2019).

13.Astier,Y.,Braha,O.&Bayley,H.Toward single molecule DNA sequencing:Direct identification of ribonucleoside and deoxyribonucleoside 5′-monophosphates by using an engineered protein nanopore equipped with a molecular adapter.Journal of the American Chemical Society128,1705–1710(2006).

14.Clarke,J.et al.Continuous base identification for single-molecule nanopore DNA sequencing.Nature nanotechnology4,265–70(2009).

15.Jeong,K.-B.et al.Alpha-Hederin Nanopore for Single Nucleotide Discrimination.ACS Nano13,1719–1727(2019).

16.Venta,K.et al.Differentiation of Short,Single-Stranded DNA Homopolymers in Solid-State Nanopores.ACS Nano7,4629–4636(2013).

17.Garaj,S.et al.Graphene as a subnanometre trans-electrode membrane.Nature467,190–193(2010).

18.Booth,I.R.&Blount,P.The MscS and MscL Families of Mechanosensitive Channels Act as Microbial Emergency Release Valves.Journal of Bacteriology194,4802–4809(2012).

19.Akitake,B.,Anishkin,A.&Sukharev,S.The“Dashpot”Mechanism of Stretch-dependent Gating in MscS.The Journal of General Physiology125,143–154(2005).

20.Bass,R.B.Crystal Structure of Escherichia coli MscS,a Voltage-Modulated and Mechanosensitive Channel.Science298,1582–1587(2002).

21.Lee,J.-Y.,Na,I.Y.,Park,Y.K.&Ko,K.S.Genomic variations between colistin-susceptible and-resistant Pseudomonas aeruginosa clinical isolates and their effects on colistin resistance.Journal of Antimicrobial Chemotherapy69,1248–1256(2014).

22.Machiyama,H.,Tatsumi,H.&Sokabe,M.Structural changes in the cytoplasmic domain of the mechanosensitive channel MscS during opening.Biophysical journal97,1048–57(2009).

23.Feng,J.et al.Identification of single nucleotides in MoS2 nanopores.Nature Nanotechnology10,1070–1076(2015).

24.Gamini,R.,Sotomayor,M.,Chipot,C.&Schulten,K.Cytoplasmic Domain Filter Function in the Mechanosensitive Channel of Small Conductance.Biophysical Journal101,80–89(2011).

25.Perozo,E.&Rees,D.C.Structure and mechanism in prokaryotic mechanosensitive channels.Current Opinion in Structural Biology13,432–442(2003).

26.Maksaev,G.&Haswell,E.S.MscS-Like 10 is a stretch-activated ion channel from Arabidopsis thaliana with a preference for anions.Proceedings of the National Academy of Sciences109,19015–19020(2012).

27.Rozevsky,Y.et al.Quantification of mRNA Expression Using Single-Molecule Nanopore Sensing.ACS nano acsnano.0c06375(2020).doi:10.1021/acsnano.0c06375

28.Ouldali,H.et al.Electrical recognition of the twenty proteinogenic amino acids using an aerolysin nanopore.Nature biotechnology38,176–181(2020).

29.LEI,J.&FRANK,J.Automated acquisition of cryo-electron micrographs for single particle reconstruction on an FEI Tecnai electron microscope.Journal of Structural Biology150,69–80(2005).

30.Zheng,S.Q.et al.MotionCor2:anisotropic correction of beam-induced motion for improved cryo-electron microscopy.Nature Methods14,331–332(2017).

31.Punjani,A.,Rubinstein,J.L.,Fleet,D.J.&Brubaker,M.A.cryoSPARC:algorithms for rapid unsupervised cryo-EM structure determination.Nature Methods14,290–296(2017).

32.Punjani,A.,Zhang,H.&Fleet,D.J.Non-uniform refinement:Adaptive regularization improves single particle cryo-EM reconstruction.bioRxiv2019.12.15.877092(2019).doi:10.1101/2019.12.15.877092

33.Wang,W.et al.The Structure of an Open Form of an E.coli Mechanosensitive Channel at 3.45 A Resolution.Science321,1179–1183(2008).

34.Jurcik,A.et al.CAVER Analyst 2.0:analysis and visualization of channels and tunnels in protein structures and molecular dynamics trajectories.Bioinformatics(Oxford,England)34,3586–3588(2018).

35.Smart,O.S.,Goodfellow,J.M.&Wallace,B.A.The pore dimensions of gramicidin A.Biophysical journal65,2455–60(1993).

36.Kefauver,J.M.,Ward,A.B.&Patapoutian,A.Discoveries in structure and physiology of mechanically activated ion channels.Nature587,567–576(2020).

37.Hurst AC,Petrov E,Kloda A,Nguyen T,Hool L,Martinac B.MscS,the bacterial mechanosensitive channel of small conductance.Int J Biochem Cell Biol.2008；40(4):581-585.

38.Malcolm,H.R.and Maurer,J.A.(2012),The Mechanosensitive Channel of Small Conductance(MscS)Superfamily:Not Just Mechanosensitive Channels Anymore.ChemBioChem,13:2037-2043.

SEQUENCE LISTING

<110> Sichuan university

<120> biological ehmitic pore system based on small conductance mechanical force sensitive channel

<150> CN2021110062606

<151> 2021-08-30

<150> CN2021110042496

<151> 2021-08-30

<160> 8

<170> PatentIn version 3.5

<210> 1

<211> 278

<212> PRT

<213> Pseudomonas aeruginosa

<400> 1

Met Glu Leu Asn Tyr Asp Arg Leu Val Gln Gln Thr Glu Ser Trp Leu

1 5 10 15

Pro Ile Val Leu Glu Tyr Ser Gly Lys Val Ala Leu Ala Leu Leu Thr

20 25 30

Leu Ala Ile Gly Trp Trp Leu Ile Asn Thr Leu Thr Gly Arg Val Gly

35 40 45

Gly Leu Leu Ala Arg Arg Ser Val Asp Arg Thr Leu Gln Gly Phe Val

50 55 60

Gly Ser Leu Val Ser Ile Val Leu Lys Ile Leu Leu Val Val Ser Val

65 70 75 80

Ala Ser Met Ile Gly Ile Gln Thr Thr Ser Phe Val Ala Ala Ile Gly

85 90 95

Ala Ala Gly Leu Ala Ile Gly Leu Ala Leu Gln Gly Ser Leu Ala Asn

100 105 110

Phe Ala Gly Gly Val Leu Ile Leu Leu Phe Arg Pro Phe Lys Val Gly

115 120 125

Asp Trp Ile Glu Ala Gln Gly Val Ala Gly Thr Val Asp Ser Ile Leu

130 135 140

Ile Phe His Thr Val Leu Arg Ser Gly Asp Asn Lys Arg Ile Ile Val

145 150 155 160

Pro Asn Gly Ala Leu Ser Asn Gly Thr Val Thr Asn Tyr Ser Ala Glu

165 170 175

Pro Val Arg Lys Val Ile Phe Asp Val Gly Ile Asp Tyr Asp Ala Asp

180 185 190

Leu Lys Asn Ala Gln Asn Ile Leu Leu Ala Met Ala Asp Asp Pro Arg

195 200 205

Val Leu Lys Asp Pro Ala Pro Val Ala Val Val Ser Asn Leu Gly Glu

210 215 220

Ser Ala Ile Thr Leu Ser Leu Arg Val Trp Val Lys Asn Ala Asp Tyr

225 230 235 240

Trp Asp Val Met Phe Met Phe Asn Glu Lys Ala Arg Asp Ala Leu Gly

245 250 255

Lys Glu Gly Ile Gly Ile Pro Phe Pro Gln Arg Val Val Lys Val Val

260 265 270

Gln Gly Ala Met Ala Asp

275

<210> 2

<211> 286

<212> PRT

<213> Escherichia coli

<400> 2

Met Glu Asp Leu Asn Val Val Asp Ser Ile Asn Gly Ala Gly Ser Trp

1 5 10 15

Leu Val Ala Asn Gln Ala Leu Leu Leu Ser Tyr Ala Val Asn Ile Val

20 25 30

Ala Ala Leu Ala Ile Ile Ile Val Gly Leu Ile Ile Ala Arg Met Ile

35 40 45

Ser Asn Ala Val Asn Arg Leu Met Ile Ser Arg Lys Ile Asp Ala Thr

50 55 60

Val Ala Asp Phe Leu Ser Ala Leu Val Arg Tyr Gly Ile Ile Ala Phe

65 70 75 80

Thr Leu Ile Ala Ala Leu Gly Arg Val Gly Val Gln Thr Ala Ser Val

85 90 95

Ile Ala Val Leu Gly Ala Ala Gly Leu Ala Val Gly Leu Ala Leu Gln

100 105 110

Gly Ser Leu Ser Asn Leu Ala Ala Gly Val Leu Leu Val Met Phe Arg

115 120 125

Pro Phe Arg Ala Gly Glu Tyr Val Asp Leu Gly Gly Val Ala Gly Thr

130 135 140

Val Leu Ser Val Gln Ile Phe Ser Thr Thr Met Arg Thr Ala Asp Gly

145 150 155 160

Lys Ile Ile Val Ile Pro Asn Gly Lys Ile Ile Ala Gly Asn Ile Ile

165 170 175

Asn Phe Ser Arg Glu Pro Val Arg Arg Asn Glu Phe Ile Ile Gly Val

180 185 190

Ala Tyr Asp Ser Asp Ile Asp Gln Val Lys Gln Ile Leu Thr Asn Ile

195 200 205

Ile Gln Ser Glu Asp Arg Ile Leu Lys Asp Arg Glu Met Thr Val Arg

210 215 220

Leu Asn Glu Leu Gly Ala Ser Ser Ile Asn Phe Val Val Arg Val Trp

225 230 235 240

Ser Asn Ser Gly Asp Leu Gln Asn Val Tyr Trp Asp Val Leu Glu Arg

245 250 255

Ile Lys Arg Glu Phe Asp Ala Ala Gly Ile Ser Phe Pro Tyr Pro Gln

260 265 270

Met Asp Val Asn Phe Lys Arg Val Lys Glu Asp Lys Ala Ala

275 280 285

<210> 3

<211> 282

<212> PRT

<213> Thermoanaerobacter tengcongensis

<400> 3

Met Trp Ala Asp Ile Tyr His Lys Leu Val Glu Ile Tyr Asp Ile Lys

1 5 10 15

Ala Val Lys Phe Leu Leu Asp Val Leu Lys Ile Leu Ile Ile Ala Phe

20 25 30

Ile Gly Ile Lys Phe Ala Asp Phe Leu Ile Tyr Arg Phe Tyr Lys Leu

35 40 45

Tyr Ser Lys Ser Lys Ile Gln Leu Pro Gln Arg Lys Ile Asp Thr Leu

50 55 60

Thr Ser Leu Thr Lys Asn Ala Val Arg Tyr Ile Ile Tyr Phe Leu Ala

65 70 75 80

Gly Ala Ser Ile Leu Lys Leu Phe Asn Ile Asp Met Thr Ser Leu Leu

85 90 95

Ala Val Ala Gly Ile Gly Ser Leu Ala Ile Gly Phe Gly Ala Gln Asn

100 105 110

Leu Val Lys Asp Met Ile Ser Gly Phe Phe Ile Ile Phe Glu Asp Gln

115 120 125

Phe Ser Val Gly Asp Tyr Val Thr Ile Asn Gly Ile Ser Gly Thr Val

130 135 140

Glu Glu Ile Gly Leu Arg Val Thr Lys Ile Arg Gly Phe Ser Asp Gly

145 150 155 160

Leu His Ile Ile Pro Asn Gly Glu Ile Lys Met Val Thr Asn Leu Thr

165 170 175

Lys Asp Ser Met Met Ala Val Val Asn Ile Ala Phe Pro Ile Asp Glu

180 185 190

Asp Val Asp Lys Ile Ile Glu Gly Leu Gln Glu Ile Cys Glu Glu Val

195 200 205

Lys Lys Ser Arg Asp Asp Leu Ile Glu Gly Pro Thr Val Leu Gly Ile

210 215 220

Thr Asp Met Gln Asp Ser Lys Leu Val Ile Met Val Tyr Ala Lys Thr

225 230 235 240

Gln Pro Met Gln Lys Trp Ala Val Glu Arg Asp Ile Arg Tyr Arg Val

245 250 255

Lys Lys Met Phe Asp Gln Lys Asn Ile Ser Phe Pro Tyr Pro Arg Thr

260 265 270

Thr Val Ile Leu Ser Glu Lys Lys Thr Asn

275 280

<210> 4

<211> 274

<212> PRT

<213> Helicobactor pylori

<400> 4

Met Asp Glu Ile Lys Thr Leu Leu Val Asp Phe Phe Pro Gln Ala Lys

1 5 10 15

His Phe Gly Ile Ile Leu Ile Lys Ala Val Ile Val Phe Cys Ile Gly

20 25 30

Phe Tyr Phe Ser Phe Phe Leu Arg Asn Lys Thr Met Lys Leu Leu Ser

35 40 45

Lys Lys Asp Glu Ile Leu Ala Asn Phe Val Ala Gln Val Thr Phe Ile

50 55 60

Leu Ile Leu Ile Ile Thr Thr Ile Ile Ala Leu Ser Thr Leu Gly Val

65 70 75 80

Gln Thr Thr Ser Ile Ile Thr Val Leu Gly Thr Val Gly Ile Ala Val

85 90 95

Ala Leu Ala Leu Lys Asp Tyr Leu Ser Ser Ile Ala Gly Gly Ile Ile

100 105 110

Leu Ile Ile Leu His Pro Phe Lys Lys Gly Asp Ile Ile Glu Ile Ser

115 120 125

Gly Leu Glu Gly Lys Val Glu Ala Leu Asn Phe Phe Asn Thr Ser Leu

130 135 140

Arg Leu His Asp Gly Arg Leu Ala Val Leu Pro Asn Arg Ser Val Ala

145 150 155 160

Asn Ser Asn Ile Ile Asn Ser Asn Asn Thr Ala Cys Arg Arg Ile Glu

165 170 175

Trp Val Cys Gly Val Gly Tyr Gly Ser Asp Ile Glu Leu Val His Lys

180 185 190

Thr Ile Lys Asp Val Ile Asp Thr Met Glu Lys Ile Asp Lys Asn Met

195 200 205

Pro Thr Phe Ile Gly Ile Thr Asp Phe Gly Ser Ser Ser Leu Asn Phe

210 215 220

Thr Ile Arg Val Trp Ala Lys Ile Glu Asp Gly Ile Phe Asn Val Arg

225 230 235 240

Ser Glu Leu Ile Glu Arg Ile Lys Asn Ala Leu Asp Ala Asn His Ile

245 250 255

Glu Ile Pro Phe Asn Lys Leu Asp Ile Ala Ile Lys Asn Gln Asp Ser

260 265 270

Ser Lys

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 5

tagcttatca gactgatgtt ga 22

<210> 6

<211> 35

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 6

tcaggtgcag ttctcgactc ggtcttgatg tgggt 35

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 7

ttgtttgaat agtagttgtc tga 23

<210> 8

<211> 25

<212> DNA

<213> Artificial Sequence (Artifical Sequence)

<400> 8

tcaactcaat atgagtatgg tactg 25

Claims

1. Use of a hermite system for the detection of charged molecules, said hermite system comprising a hermite, an insulating film, a first medium and a second medium; said angstrom pore is embedded in said insulating film, said insulating film separates said first medium from said second medium, said angstrom pore provides a channel to connect said first medium and said second medium, said charged molecule located in said first medium interacts with said angstrom pore upon application of a driving force between said first medium and said second medium; the angstrom pore is an MscS angstrom pore having a radially symmetric and cylindrically shaped heptameric structure comprising 7 side openings and 1 bottom opening.

2. Use according to claim 1, wherein the charge properties and/or pore size of the openings are adjustable; the manner of adjustment of the opening optionally comprises subjecting the insulating film to a mechanical force stimulus, optionally comprising one or more of a change in the osmotic pressure difference of the medium across the insulating film, a direct physical stimulus of the insulating film by micro-needles and a stimulus of the insulating film by negative pressure of air pressure, and/or a change in the physical state of the insulating film.

3. Use according to claim 1, wherein the aperture of the opening is adjustable according to:

(1) Selecting the kind of the first medium and the second medium; and/or

4. The use of claim 1, wherein the pores of the Eimeria are derived from a bacillus, optionally including one or more of Pseudomonas aeruginosa, escherichia coli, thermoanaerobacter tengciensis and helicobacter pylori.

5. The use of claim 1, wherein the emmetropic pore is an MscS variant, which optionally comprises a side-hole volume variant and/or a side-hole charge variant.

6. The use of claim 1, wherein the charged molecule comprises one or more of a nucleotide, an amino acid, a peptide, a drug molecule.

7. The use of claim 1, wherein the hermite pore is a PaMscS variant, optionally including one or more of the following variants: 130A, 130H, 180R, 271I, 130S and 130P.

8. A biological angstrom pore system comprising an angstrom pore, an insulating film, a first medium and a second medium, said angstrom pore being embedded in the insulating film, said insulating film separating said first medium from said second medium, said angstrom pore providing a passageway connecting said first medium to said second medium; the angstrom pore is an MscS variant angstrom pore having a radially symmetric and cylindrically shaped heptameric structure comprising 7 side openings and 1 bottom opening, optionally a side hole volume variant and/or a side hole charge variant of MscS.

9. The biological nanopore system according to claim 8, wherein said nanopore is derived from a bacillus, optionally comprising one or more of pseudomonas aeruginosa, escherichia coli, anaerobacterium thermosaccharolyticum tengcum, and helicobacter pylori.

10. The biological emmer pore system of claim 8, wherein the emmer pore is a pammscs variant, optionally including one or more of the following variants: 130A, 130H, 180R, 271I, 130S and 130P.

11. The biological nanopore system according to claim 8, wherein the charge properties and/or pore size of the opening are adjustable; the manner of adjustment of the opening optionally comprises subjecting the insulating film to a mechanical force stimulus, optionally comprising one or more of a change in the osmotic pressure difference of the medium across the insulating film, a direct physical stimulus of the insulating film by micro-needles and a stimulus of the insulating film by negative pressure of air pressure, and/or a change in the physical state of the insulating film.

12. The biological ehmitic pore system of claim 8, wherein the pore size of said opening is adjustable according to:

(1) Selecting a type of the first medium and the second medium; and/or

13. Use of a biological ehrlichore system according to any of claims 8-12 for the detection of charged molecules, wherein said charged molecules comprise one or more of nucleotides, amino acids, peptides, drug molecules.