CN115725569A - Antibacterial peptide LL37 gene, transgenic corn containing antibacterial peptide LL37 and application - Google Patents
Antibacterial peptide LL37 gene, transgenic corn containing antibacterial peptide LL37 and application Download PDFInfo
- Publication number
- CN115725569A CN115725569A CN202211113246.0A CN202211113246A CN115725569A CN 115725569 A CN115725569 A CN 115725569A CN 202211113246 A CN202211113246 A CN 202211113246A CN 115725569 A CN115725569 A CN 115725569A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- gene
- corn
- transgenic
- transgenic corn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention provides an antibacterial peptide LL37 gene, a transgenic corn containing the antibacterial peptide LL37 and application, and belongs to the technical field of genetic engineering, wherein the nucleotide sequence of the LL37 gene is shown as SEQ ID No. 1. The result shows that the antibacterial peptide LL37 gene can obviously inhibit the resistance to rhizoctonia solani and/or fusarium graminearum. The result of obtaining a target gene band by amplifying in transgenic corn shows that the antibacterial peptide LL37 gene is integrated into the genome of the corn. The transgenic corn has high content of the antibacterial peptide LL37, and the corn can be used as a bioreactor to carry out industrial production on the antibacterial peptide LL37, so that the production cost is reduced. The transgenic corn can also obviously inhibit the resistance to rhizoctonia solani and/or fusarium graminearum, the disease resistance of the corn is improved, meanwhile, the antibacterial peptide LL37 is an endogenous substance of a human body, and the transgenic corn containing the antibacterial peptide LL37 is used for preparing feed additives and/or food, so that the safety is good.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to an antibacterial peptide LL37 gene, transgenic corn containing antibacterial peptide LL37 and application.
Background
The antibacterial peptide (ABP) is a small molecular polypeptide which is widely existed in a natural organism and has broad-spectrum antibacterial activity, can resist the invasion of external microorganisms, and consists of 20-60 amino acid residues, and most of the active polypeptides have the characteristics of strong basicity, thermal stability, broad-spectrum antibacterial property and the like, and are important components of a biological natural immune defense system. Although the antibacterial peptide has spectrum antibacterial activity, the killing effect on different bacterial strains still has certain limitation, and the antibacterial spectrum is to be expanded.
Corn plays an important role in agricultural economy and agricultural production as a major food and feed crop in the world, and as an important industrial raw material. But the fungal pathogens have great harm to the corn, such as corn sheath blight from the seedling stage to the adult stage, and mainly harm leaf sheaths, leaves, fruit ears and stalks; fusarium graminearum in corn causes crop diseases such as corn root rot, and the like, has great harm to rhizome parts of the crops such as corn and the like by secreting toxin and some cell wall hydrolase, and biotoxin generated by the fusarium graminearum in the infection process also poses great threat to human and livestock health and food safety, so that the harm of corn fungal pathogens becomes a serious problem restricting corn production.
In recent years, important agronomic characters of corn are genetically improved by applying transgenic technologies such as gene guns, agrobacterium mediation, pollen tube channels and the like, and great progress is made in the aspects of new transgenic varieties such as insect resistance, herbicide resistance, drought resistance, salt tolerance and the like, but certain aspects of the corn gene method operation technology have great difficulty, and the important agronomic characters are mainly represented by great influence of genotype on the establishment of a corn receptor system, whether a transformed exogenous gene can be expressed in corn cells or not, and the exogenous gene can undergo a complex expression regulation, silencing, loss, gene separation, recombination and the like in the genetic transmission process, so that the difficulty in obtaining the transgenic corn with antibacterial performance is increased, and related reports of corn bioreactors containing antibacterial peptides do not exist at present. In addition, the direct expression of the antimicrobial peptide gene in a microorganism may cause suicide of the host microorganism and make it impossible to obtain an expression product. Therefore, it is necessary to find a way to reduce the production cost of antimicrobial peptides.
Disclosure of Invention
In view of the above, the present invention aims to provide an antibacterial peptide LL37 gene, a transgenic corn containing antibacterial peptide LL37 and applications thereof.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides an antibacterial peptide LL37 gene, wherein the nucleotide sequence of the LL37 gene is shown as SEQ ID No. 1.
The invention provides a plant expression vector, which contains the nucleotide sequence of the LL37 gene.
Preferably, the expression vector takes a pCAMBIA3301 vector as a skeleton, and the LL37 gene shown in SEQ ID No.1 is connected between NcoI and BstEII of the pCAMBIA3301 vector.
The invention provides a preparation method of transgenic corn containing antibacterial peptide LL37, which comprises the following steps:
the plant expression vector is transferred into young maize embryos through agrobacterium mediation to obtain transgenic maize containing the antibacterial peptide LL37.
The invention provides an application of the antibacterial peptide LL37 gene in antifungal.
Preferably, the fungus comprises rhizoctonia solani and/or fusarium graminearum.
The invention provides a method for producing antibacterial peptide LL37 by using corn as a bioreactor, which comprises the following steps: and planting the transgenic corn containing the antibacterial peptide LL37 obtained by the preparation method, and extracting the antibacterial peptide LL37.
The invention provides application of the transgenic corn containing the antibacterial peptide LL37 obtained by the preparation method in antifungal.
Preferably, the fungus comprises rhizoctonia solani and/or fusarium graminearum.
The invention provides application of the transgenic corn containing the antibacterial peptide LL37 obtained by the preparation method in preparation of feed additives and/or food.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides an antibacterial peptide LL37 gene, transgenic corn containing the antibacterial peptide LL37 and application thereof, and experimental results show that the antibacterial peptide LL37 gene can obviously inhibit the resistance to rhizoctonia solani and/or fusarium graminearum. The result of obtaining a target gene band by amplifying in transgenic corn shows that the antibacterial peptide LL37 gene is integrated into the genome of the corn. The transgenic corn has high content of the antibacterial peptide LL37, and the corn can be used as a bioreactor to carry out industrial production on the antibacterial peptide LL37, so that the production cost is reduced. The transgenic corn can also obviously inhibit the resistance to rhizoctonia solani and/or fusarium graminearum, the disease resistance of the corn is improved, meanwhile, the antibacterial peptide LL37 is an endogenous substance of a human body, and the transgenic corn containing the antibacterial peptide LL37 is used for preparing feed additives and/or food, so that the safety is good.
Drawings
FIG. 1 is a map of plant expression vector pCAMBIA 3301;
FIG. 2 is a map of plant expression vector p3301-35S-LL 37;
FIG. 3 shows different T 0 The PCR identification result of transgenic maize plant, wherein M is DNA Marker, and lanes 1-11 are different T 0 Transgenic corn plants are replaced, lane 12 is non-transgenic corn, lane 13 is plasmid, lane 14 is water;
FIG. 4 shows the effect of protein extract of transgenic maize line 8 containing the antimicrobial peptide LL37 on Rhizoctonia solani, wherein A is a control group, B is 0.2. Mu.g of coating protein, and C is 0.4. Mu.g of coating protein;
FIG. 5 shows the effect of the protein extract of the transgenic maize line 8 containing the antimicrobial peptide LL37 on Fusarium graminearum, wherein A is a control group, B is a coating protein amount of 0.2. Mu.g, and C is a coating protein amount of 0.4. Mu.g;
FIG. 6 is a graph showing the statistical results of the areas of the visible hyphae of Rhizoctonia solani in the protein extracts of the transgenic maize lines 8, 9 and 10 containing the antimicrobial peptide LL 37;
FIG. 7 is a graph showing the statistical results of the areas of the visible hyphae of fusarium graminearum in the protein extract of the transgenic maize lines 8, 9 and 10 containing the antimicrobial peptide LL 37;
FIG. 8 is a plot of Rhizoctonia solani-infected plants, wherein A and C are transgenic maize plants containing the antimicrobial peptide LL37, and B and D are non-transgenic maize Z31;
FIG. 9 shows the case of fusarium graminearum infected plants, where A and C are transgenic maize plants containing the antimicrobial peptide LL37 and B and D are non-transgenic maize Z31.
Detailed Description
The invention provides an antibacterial peptide LL37 gene, wherein the nucleotide sequence of the LL37 gene is shown as SEQ ID No. 1.
<xnotran> LL37 , LL37 atgctgctgggcgacttcttcaggaagtccaaggagaagatcggcaaggagttcaagaggatcgtgcagaggatcaaggacttcctgaggaacctggtgccgaggaccgagtcctga (SEQ ID No. 1). </xnotran>
The invention provides a plant expression vector, which contains the nucleotide sequence of the LL37 gene.
In the present invention, the expression vector preferably has pCAMBIA3301 vector (see FIG. 1) as a backbone. As a preferred embodiment, the LL37 gene shown in SEQ ID No.1 is ligated between NcoI and BstEII of the pCAMBIA3301 vector, so that the LL37 gene is under the control of the 35S promoter. In the invention, after the plant expression vector p3301-35S-LL37 is transformed into escherichia coli competent cells, screening is carried out, and positive cloning plasmids are picked. The Escherichia coli of the present invention is preferably TOP10. The source of the pCAMBIA3301 vector in the present invention is not particularly limited, and any known or commercially available product in the art may be used.
The invention provides a preparation method of transgenic corn containing antibacterial peptide LL37, which comprises the following steps:
the plant expression vector is mediated by agrobacterium and transformed into young maize embryos to obtain transgenic maize containing the antibacterial peptide LL37.
In the invention, the agrobacterium is preferably agrobacterium LBA4404, and the maize variety preferably comprises maize inbred line Z31.
The invention provides an application of the antibacterial peptide LL37 gene in antifungal.
In the present invention, the fungus preferably comprises rhizoctonia solani and/or fusarium graminearum.
The invention provides a method for producing antibacterial peptide LL37 by using corn as a bioreactor, which comprises the following steps: and planting the transgenic corn containing the antibacterial peptide LL37 obtained by the preparation method, and extracting the antibacterial peptide LL37.
According to the method for producing the antibacterial peptide LL37, the expression level of the antibacterial peptide LL37 in the transgenic corn is detected by ELISA, and the result shows that the content of the antibacterial peptide LL37 in the transgenic corn is as high as 49.35ng/gFW.
The invention provides application of the transgenic corn containing the antibacterial peptide LL37 obtained by the preparation method in antifungal.
In the present invention, the fungus preferably comprises rhizoctonia solani and/or fusarium graminearum.
The invention provides application of the transgenic corn containing the antibacterial peptide LL37 obtained by the preparation method in preparation of feed additives and/or food.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
1.1 preparation of transgenic maize containing the antimicrobial peptide LL37
(1) Construction of plant expression vector p3301-35S-LL37
<xnotran> LL37 , LL37 atgctgctgggcgacttcttcaggaagtccaaggagaagatcggcaaggagttcaagaggatcgtgcagaggatcaaggacttcctgaggaacctggtgccgaggaccgagtcctga (SEQ ID No. 1). </xnotran> The vector pCAMBIA3301 was digested with NcoI and BstEII, the GUS gene was excised, and the above-mentioned antibacterial peptide LL37 gene was ligated between NcoI and BstEII in the pCAMBI3301 plant expression vector, so that the LL37 gene was regulated by 35S promoter, thereby constructing plant expression vector p3301-35S-LL37 (shown in FIG. 2).
(2) Transforming the p3301-35S-LL37 plant expression vector successfully constructed in the step (1) into a colon bacillus TOP10 competent cell, shaking the colon bacillus containing the p3301-35S-LL37 plant expression vector at 37 ℃ overnight, extracting positive plasmids, transferring the positive plasmids into agrobacterium LBA4404, plating and culturing, selecting agrobacterium monoclonal PCR identification, infecting maize inbred line Z31 immature embryos with the positive cloned agrobacterium, transforming to obtain T31 immature embryos 0 Transgenic maize plants are generated.
Extraction of T 0 The DNA of the transgenic plant is identified by PCR, and the identification result is shown in figure 3.
As can be seen from the results in fig. 3, the non-transgenic corn control did not amplify any bands; the transgenic plants in lanes 2 and 6 were not amplified to the band of interest, indicating that these two plants are negative non-transgenic maize plants; the target gene band is amplified in the transgenic corn strains with different lanes, and the positive transgenic corn event is obtained by screening through the preparation method.
1.2 antibacterial test of transgenic corn containing antibacterial peptide LL37
In order to research the inhibition effect of the humanized antibacterial LL37 gene on different strains, three transgenic corn strains of 8, 9 and 10 are selected from the identified positive transgenic corn events, the leaves in the jointing stage are taken, the total protein of the leaves is extracted, and a subsequent antibacterial test is carried out.
1.2.1 8, 9 and 10 transgenic corn plant leaf protein extracting solution antibacterial test
Detecting the expression level of LL37 in the transgenic corn by ELISA: in order to determine the content of the antimicrobial peptide LL37 in the total protein of 8, 9 and 10 transgenic maize lines, an enzyme-linked immunosorbent assay (ELISA) experiment of LL37 was carried out on the leaves of positive plants at the seedling stage. Determining the OD value of standard protein, setting 3 times of repetition for each group, drawing standard curve, determining the OD value of its sample to calculate the total transgenic plantThe content of the antimicrobial peptide LL37 in the protein was found to be y =0.0816x-0.0057 (R) in the formula after the standard curve was plotted, as shown in Table 1 2 ＝0.9897)。
TABLE 1 content of antimicrobial peptide LL37 in transgenic maize lines 8, 9, 10
The results in Table 1 show that the content of the antimicrobial peptide LL37 in the total protein of 8, 9 and 10 transgenic maize plants is 49.35ng/gFW, 32.90 ng/gFW and 46.59ng/gFW respectively.
8. No. 9 and No. 10 transgenic corn plant leaf protein extract has influence on the activity of fungi: in order to verify the inhibition of the humanized antibacterial peptide LL37 on fungi, rhizoctonia solani strain AG1-IA and Fusarium graminearum strain X-42 are selected to carry out experiments, the strains are activated, the Rhizoctonia solani and the Fusarium graminearum are activated for 72 hours in an incubator at 25 ℃ to ensure that the strains have the same activity, protein extracting solutions containing 0.2 mu g and 0.4 mu g of transgenic plant leaves are respectively and uniformly coated on a PDA culture medium in a super clean workbench, a non-transgenic corn Z31 leaf protein extracting solution is coated on a control group, then a bacterial cake with the diameter of 4mm is punched by hyphae of the activated strains, the bacterial cake is inoculated on the PDA culture medium coated with the protein extracting solution and is cultured in the incubator at 25 ℃ for 72 hours, and the observed area is shown in figures 4-5. The area of visible hyphae added with different amounts of protein extract was analyzed for one-way anova, see FIGS. 6-7.
From the results of fig. 4 to 5, it is clear that the growth of hyphae of the experimental group of sheath blight and fusarium graminearum to which the protein extract was added was inhibited compared to the control group, and the hyphae tip was sparse compared to the control group, the hyphae became thin and weak, and the branches were rare.
As is clear from the results of FIGS. 6 to 7, the areas of the hyphae of the control group were significantly reduced when the protein extracts of 0.2. Mu.g and 0.4. Mu.g were added to Rhizoctonia solani. The area of the added 0.2 mu g of protein extracting solution of the fusarium graminearum is not obviously changed relative to the area of the hyphae of a control group, and the area of the added 0.4 mu g of protein extracting solution is obviously reduced relative to the area of the hyphae of the control group, so that the hyphae are thin and weak, and the density is reduced.
1.2.2 Effect of transgenic maize plants on the Activity of Rhizoctonia solani and Fusarium graminearum
Respectively taking fungus cakes of a rhizoctonia solani strain AG1-IA and a fusarium graminearum strain X-42 with the diameters of 4mm, sticking the fungus cakes to the leaf wounds of a transgenic positive plant and a non-transgenic corn Z31, culturing for 48-72 h, and observing the infected condition of the leaves.
The results in FIG. 8 show that after the plant is infected by the sheath blight disease, the transgenic maize leaves still appear green and grow strongly without obvious marks infected by the sheath blight disease; and the leaves of the non-transgenic maize Z31 curl and yellow and are covered with hyphae, which shows that the transgenic positive plants have certain resistance to rhizoctonia solani.
The results in FIG. 9 show that after the fusarium graminearum infects the plants, the leaves of the transgenic positive plants still keep green, grow strongly and have no hypha; and the leaves of the non-transgenic corn Z31 are yellow and are wrapped by hyphae, which shows that the transgenic positive plants have certain resistance to fusarium graminearum.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Claims (10)
1. An antibacterial peptide LL37 gene, which is characterized in that the nucleotide sequence of the LL37 gene is shown as SEQ ID No. 1.
2. A plant expression vector comprising the nucleotide sequence of the LL37 gene of claim 1.
3. The plant expression vector of claim 2, wherein the expression vector comprises a pCAMBIA3301 vector as a backbone, and the LL37 gene shown in SEQ ID No.1 is ligated between NcoI and BstEII of the pCAMBIA3301 vector.
4. A preparation method of transgenic corn containing antibacterial peptide LL37 is characterized by comprising the following steps:
the plant expression vector of claim 2 or 3 is transformed into young maize embryos by agrobacterium-mediated transformation to obtain transgenic maize containing the antimicrobial peptide LL37.
5. The use of the antimicrobial peptide LL37 gene of claim 1 for combating fungi.
6. Use according to claim 5, wherein the fungus comprises Rhizoctonia solani and/or Fusarium graminearum.
7. A method for producing an antibacterial peptide LL37 by using corn as a bioreactor, which is characterized by comprising the following steps: planting the transgenic corn containing the antibacterial peptide LL37 obtained by the preparation method of claim 4, and extracting the antibacterial peptide LL37.
8. Application of the transgenic corn containing the antibacterial peptide LL37 obtained by the preparation method of claim 4 in resisting fungi.
9. Use according to claim 8, wherein the fungus comprises rhizoctonia solani and/or fusarium graminearum.
10. Application of the transgenic corn containing the antibacterial peptide LL37 obtained by the preparation method of claim 4 in preparing feed additives and/or food.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211113246.0A CN115725569A (en) | 2022-09-14 | 2022-09-14 | Antibacterial peptide LL37 gene, transgenic corn containing antibacterial peptide LL37 and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211113246.0A CN115725569A (en) | 2022-09-14 | 2022-09-14 | Antibacterial peptide LL37 gene, transgenic corn containing antibacterial peptide LL37 and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115725569A true CN115725569A (en) | 2023-03-03 |
Family
ID=85293194
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211113246.0A Pending CN115725569A (en) | 2022-09-14 | 2022-09-14 | Antibacterial peptide LL37 gene, transgenic corn containing antibacterial peptide LL37 and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115725569A (en) |
-
2022
- 2022-09-14 CN CN202211113246.0A patent/CN115725569A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Abdallah et al. | Stable integration and expression of a plant defensin in tomato confers resistance to fusarium wilt | |
| JP2020511472A (en) | Systems and methods for biological control of plant pathogens | |
| CN110734482B (en) | Lilium regale WRKY transcription factor gene LrWRKY4 and application thereof | |
| CN102816773A (en) | Application of OsWRKY28 transcription factor gene of rice in improvement of plant disease resistance | |
| CN101358190A (en) | Artificial synthetic high gene order expression high virulence protein for lepidoptera pest and use thereof | |
| US7767801B2 (en) | Tissue specific promoters | |
| Yu et al. | Cloning and functional identification of PeWRKY41 from Populus× euramericana | |
| CN112313338A (en) | Recombinant gene | |
| CN113913457A (en) | Method for inhibiting or killing dichocrocis punctiferalis and application thereof | |
| CN113754748A (en) | Polypeptide immune activator for improving insect resistance and disease resistance of rice | |
| CN112159821B (en) | Application of corn elicitor peptide gene ZmPep1 in improving verticillium wilt resistance of plants | |
| US20180216131A1 (en) | Artificially synthesized insect-resistant protein, biological materials associated therewith, and use thereof | |
| KR100994443B1 (en) | Antibiotics marker free soybean having resistance against two herbicides | |
| CN103320448B (en) | Lilium regle bZIP transcription factor LrbZIP1 and application | |
| CN1936002A (en) | Method for separating bidirectional promoter and its use | |
| CN115725569A (en) | Antibacterial peptide LL37 gene, transgenic corn containing antibacterial peptide LL37 and application | |
| CN100396776C (en) | Method for breeding anti-disease wheat and its special gene | |
| CN114507673A (en) | Method for inhibiting or killing black cutworm and application | |
| CN113699181A (en) | Silencing vector for silencing cupula mori G protein alpha subunit coding gene CsGPA3 and application and method thereof | |
| CN109295068B (en) | Pseudo-ginseng sweet protein gene PnTLP2 and application | |
| CN107058376B (en) | Method for preventing and treating hemipteran pests of crops | |
| Vershinina et al. | Associative Symbiosis between Rhizobia and Transgenic Tomatoes Increases Plant Resistance to Fuzarium oxysporum f. sp. lycopersici | |
| KR101161276B1 (en) | Vascular tissue-specific promoter and expression vector comprising the same | |
| CN104878027A (en) | Juglans sigillata Dode ribonuclease gene JsRNase and application thereof | |
| WO2019169625A1 (en) | Artificially improved insecticidal protein, gene encoding same, and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |