CN115725486A - Bacillus thuringiensis using methanol as carbon source and application thereof - Google Patents

Abstract

The invention discloses a bacillus thuringiensis using methanol as a carbon source and application thereof, wherein methanol dehydrogenase MdH, mdH activator protein AcT, 3-hexulose-6-phosphate synthase HpS, 6-phosphate-3-hexanone isomerase PhI and NADH dehydrogenase NdH are introduced into wild bacillus thuringiensis, so that the bacillus thuringiensis consumes 0.71g/L of methanol firstly, and further, the consumption of the methanol is increased to 11.7 times by replacing a Pveg promoter with the mutated Pveg promoter to 8.3g/L.

Description

Bacillus thuringiensis using methanol as carbon source and application thereof

Technical Field

The invention relates to bacillus thuringiensis using methanol as a carbon source and application thereof, belonging to the technical field of biological engineering.

Background

Bacillus thuringiensis (Bacillus thuringiensis) plays a great role in pest control as a gram-positive microorganism, and is a microbial insecticide which is most deeply researched, most rapidly developed and most widely applied in recent years. Bacillus thuringiensis has the insect-preventing principle that its strain can produce endotoxin and exotoxin to stop pests from eating, and the pests die due to hunger, blood destruction and nerve poisoning. In addition, as a microorganism generally regarded as safe, it grows fast, has great potential in the application of synthetic biology field, and is suitable as a host for protein expression and metabolic engineering. Methanol has many advantages as a potential renewable carbon source for microorganisms, such as low price, easy availability and environmental protection. However, bacillus thuringiensis which utilize methanol as a carbon source have been developed.

Disclosure of Invention

In order to solve the technical problems, the invention provides the bacillus thuringiensis which can utilize the methanol as a carbon source, and the utilization efficiency of the methanol is improved by means of metabolic engineering.

The first purpose of the invention is to provide a bacillus thuringiensis using methanol as a carbon source, which heterologously expresses methanol dehydrogenase MdH, mdH activator AcT, 3-hexulose-6-phosphate synthase HpS, 6-phospho-3-hexuloisomerase PhI and NADH dehydrogenase NdH in a host.

Furthermore, the amino acid sequence of the methanol dehydrogenase MdH is shown in SEQ ID NO.1, and the amino acid sequence of the MdH activator protein AcT is shown in SEQ ID NO. 2.

Furthermore, the amino acid sequence of the HpS is shown as SEQ ID NO.3, and the amino acid sequence of the PhI is shown as SEQ ID NO. 4.

Furthermore, the amino acid sequence of the NADH dehydrogenase NdH is shown in SEQ ID NO. 5.

The methanol dehydrogenase MdH and the MdH activator AcT are derived from Bacillus methanolicus MGA3, 3-hexulose-6-phosphate synthase HpS, 6-phospho-3-hexuloisomerase PhI and NADH dehydrogenase NdH from Bacillus subtilis.

Furthermore, the 3-hexulose-6-phosphate synthase HpS, the 6-phospho-3-hexuloisomerase PhI and the NADH dehydrogenase NdH are promoted to be expressed by adopting a Pveg promoter, and the methanol dehydrogenase MdH and the MdH activator protein AcT are promoted to be expressed by adopting a P566 promoter.

Furthermore, the nucleotide sequence of the Pveg promoter is shown as SEQ ID NO.6, SEQ ID NO.10 or SEQ ID NO. 11.

Further, the nucleotide sequence of the P566 promoter is shown as SEQ ID NO. 7.

Furthermore, the host is wild type Bacillus thuringiensis HD-1 (GenBank number: CP 001903).

The second purpose of the invention is to provide the application of the bacillus thuringiensis in agriculture and food.

Further, the application takes methanol as a carbon source, and the target product is produced by fermenting bacillus thuringiensis.

The invention has the beneficial effects that:

according to the invention, methanol dehydrogenase MdH, mdH activator protein AcT, 3-hexulose-6-phosphate synthase HpS, 6-phospho-3-hexone isomerase PhI and NADH dehydrogenase NdH are introduced into wild type Bacillus thuringiensis, so that the Bacillus thuringiensis can consume 0.71g/L of methanol, and further, the Pveg promoter is replaced by the mutated Pveg promoter, so that the consumption of the methanol is increased to 11.7 times and reaches 8.3g/L.

Drawings

FIG. 1 shows the methanol assimilation pathway introduced in Bacillus thuringiensis.

Detailed Description

The present invention is further described below in conjunction with specific examples to enable those skilled in the art to better understand the present invention and to practice it, but the examples are not intended to limit the present invention.

Relates to materials and methods:

the strain is as follows: wild type Bacillus thuringiensis HD-1 (GenBank: CP 001903).

Inorganic salt culture medium: 5g/L glucose, 10g/L methanol, 1g/L tryptone, 0.5g/L yeast extract, 1g/L NaCl,17g/L Na ₂ HPO ₄ ，3g/L KH ₂ PO ₄ ，0.6g/L NH ₄ Cl,0.21g/L citric acid monohydrate, 0.015g/L CaCl ₂ ·H ₂ O，2.5g/L MgSO ₄ ·7H2O，0.1mg/L CoCl ₂ ·H ₂ O，0.1mg/L CuSO ₄ ·5H ₂ O，13.5mg/L FeCl ₃ ·6H ₂ O，0.33mg/L MnSO ₄ ·H ₂ O，3.8mg/L ZnSO ₄ ·7H ₂ O, pH adjusted to 7.0 using ammonia.

LB medium (g/L): tryptone 10, yeast powder 5, naCl 10

SG buffer solution: each L of the extract contains 93.1g of sucrose and 150mL of glycerol

0.1M PBS: each 100mL of the solution contains K ₂ HPO ₄ 1.4g、KH ₂ PO ₄ 0.52g

1M MgCl ₂ : mgCl content per 100mL ₂ ·6H ₂ O 20.33g

EP buffer: 1L of SG-containing buffer, 0.1M PBS 5mL, 1.0M MgCl ₂ 500μL。

Example 1: electrotransformation of Bacillus thuringiensis

And (3) competent preparation: single colonies were first picked in 5mL LB medium and activated overnight at 30 ℃. Then transferring the strain to a fresh LB culture medium according to the inoculation amount of 1/100, culturing at 30 ℃ and 220r/min until the OD600 is about equal to 1.0-1.3 (about 2 h), and then cooling in an ice bath for 10-30min, wherein the whole competence preparation and transformation process are carried out under the low-temperature condition. After cooling, the bacterial solution was centrifuged at 5000r/min at 4 ℃ for 5min, and the cells were collected and the supernatant was discarded. Then washing the thalli with precooled EP buffer for 2 times under the same conditions, washing the thalli with precooled SG buffer for 1 time, and finally suspending the thalli in SG buffer (about 1.5 mL) to make the competence OD600 about 50-70; and subpackaging the competent 50 mu L/tube into a centrifuge tube, storing at-80 ℃ for later use, or subpackaging the competent 500 mu L/tube into a centrifuge tube, and subpackaging at present.

And (3) an electric conversion process: placing 1 tube of competent cells on ice, adding 3-5 μ L of plasmid DNA (the concentration of plasmid is more than 100ng/μ L, and Escherichia coli JM110 is used as a cloning host, otherwise the plasmid is subjected to restrictive cutting to cause transformation failure), slightly shaking and uniformly mixing, adding into a 1mm precooled electric rotating cup after ice bath for 10-30min, and quickly adding 500 μ L of LB culture medium preheated at 37 ℃ after 1.25kV electric shock; after the culture is resumed at 37 ℃ and 220r/min for 2h, the resistant plate is coated and cultured in an incubator at 37 ℃ overnight.

Example 2: construction of methanol with Bacillus thuringiensis

Firstly, a helper plasmid pBMB-ESC (with a sequence of SEQ ID NO. 8) is constructed to realize the high-efficiency recombination of the bacillus thuringiensis HD-1. The construction of the integration frame of the linear plasmid (SEQ ID NO. 9) expressing methanol utilization gene cluster adopts a fusion PCR mode. The specific operation is as follows: firstly, designing a recombination frame with the homologous arm length of 500-1000bp, and using a primer HD-Meth-1F: tggagcaggctgttatatacatgcgaagg, HD-Meth-1R: the left arm was amplified by gaaattgttattcgctccgtcgcgctcacggtgtcatttggac using primers HD-Meth-2F: cacgtgtgacggacggaggcggataaatttcacaggaacacc, HD-Meth-2R: gcaagctgtaatttttatacctcctcttcactacacacg amplification of spectinomycin resistance protein expression cassette using primer HD-Meth-3F: GTGaaagagggtgataaatggaattatacctgtcatgacctcgtc, HD-Meth-3R: ccgtcctttatatctcttagaaggtttgcgtggtgagtgaac amplifies the expression cassettes for 3-hexulose-6-phosphate synthase HpS and 6-phosphate-3-hexanone isomerase PhI using primers HD-Meth-4F: ccacgcaaaccttgaatagataggacggggatatacgatgtcaaaac, HD-Meth-4R: the NdH expression cassette was amplified using the primers HD-Meth-5F: ccaaagcattcctttccggttcgttgttcgtgctgactgacttgc, HD-Meth-5R: the expression cassette of the erythromycin resistance protein is amplified by ggccgtttttgtctagggacccttttagctcctttgg, and a primer HD-Meth-6F is used: ctaaagggtccctagacaaaaaacggcctctcgaaaataggttg, HD-Meth-6R: amplifying the MdH expression cassette by CAGTTTGCCCATTTTTCTCACCTCTCTCTCTCCTATAATTCATTACATCGTTTTTTTGATATATATCAC, and using a primer HD-Meth-7F: GAAAGGAGGTGAGAAAAAATGGGGCAAACTGTTTGAAGAAAAAACGATC, HD-Meth-7R: gccccagcgtggtatcatttattatgtttcaggcttcttgcagc amplification of the AcT expression cassette using primers HD-Meth-8F: CGCTGAAACATAATAATGAtcacgctggggcataactactttgtg, HD-Meth-8R: the right arm was amplified by caattacggctgtgcttctctcctcg. The corresponding linear plasmid/genome integration operation after purification of the obtained DNA fragment was:

the strains containing pBMB-ESC plasmid were first made competent, xylose was added to the final concentration of 3% when the OD600 of the strain was about 0.5, and the culture was continued until the OD600 was about 1.0-1.3. The remaining operations were the same as those for the electrotransformation plasmid. When in electrotransformation, the DNA fragments need to be single, 5 mu L of DNA fragments with the concentration of more than 200 ng/mu L are added, and then the mixture is cultured for 3 hours. The rest operations are the same as those of the electrotransformation plasmid, and the final DNA integration frame realizes the recombination and editing of the prophage GIL16 genome to obtain the bacillus thuringiensis containing a complete methanol utilization way.

The methanol consumption level of this bacillus thuringiensis was tested: single colonies were first picked in 5mL LB medium and cultured overnight at 37 ℃. Then transferring the strain to an inorganic salt culture medium according to the inoculation amount of 1/100, culturing at 37 ℃ and 220r/min for 24h, and centrifuging to take the supernatant. And respectively measuring the methanol content in the empty culture medium and the fermentation supernatant, and calculating the methanol consumption. The methanol consumption was determined to be 0.71g/L in the presence of Bacillus thuringiensis in mineral salts medium.

Example 3: construction of bacillus thuringiensis capable of efficiently utilizing methanol

On the basis of the above-mentioned methanol utilization of Bacillus thuringiensis, the expression level of the cluster comprising the 3-hexulose-6-phosphate synthase HpS, 6-phospho-3-hexanone isomerase PhI and NADH dehydrogenase NdH genes was altered by using the mutated Pveg promoter. The Pveg promoter was replaced with the middle expression level mutant sequence (SEQ ID NO.10, relative transcription strength of 27.8% of Pveg promoter) and the low expression level mutant sequence (SEQ ID NO.11, relative transcription strength of 3.9% of Pveg promoter), respectively. Methanol consumption was measured to increase to 2.2g/L when the mutant sequence was expressed at the medium level and 8.3g/L when the mutant sequence was expressed at the low level. After the metabolic engineering is transformed, the consumption of the methanol is increased to 11.7 times, and the efficient utilization of the bacillus thuringiensis methanol is realized.

Comparative example 1: determination of methanol consumption of wild type Bacillus thuringiensis

The methanol consumption levels of wild-type bacillus thuringiensis were tested: single colonies were first picked in 5mL LB medium and cultured overnight at 37 ℃. Then transferring the strain to an inorganic salt culture medium according to the inoculation amount of 1/100, culturing at 37 ℃ and 220r/min for 24h, and centrifuging to take the supernatant. And respectively measuring the methanol content in the empty culture medium and the fermentation supernatant, and calculating the methanol consumption. Through determination, the wild type bacillus thuringiensis does not consume methanol in an inorganic salt culture medium.

The above-mentioned embodiments are merely preferred embodiments for fully illustrating the present invention, and the scope of the present invention is not limited thereto. The equivalent substitution or change made by the technical personnel in the technical field on the basis of the invention is all within the protection scope of the invention. The protection scope of the invention is subject to the claims.

Claims (10)

1. A Bacillus thuringiensis using methanol as a carbon source, wherein the Bacillus thuringiensis heterologously expresses methanol dehydrogenase MdH, mdH activator AcT, 3-hexulose-6-phosphate synthase HpS, 6-phospho-3-hexuloisomerase PhI and NADH dehydrogenase NdH in a host.

2. The bacillus thuringiensis according to claim 1, wherein the amino acid sequence of the methanol dehydrogenase MdH is shown in SEQ ID No.1, and the amino acid sequence of the MdH activator AcT is shown in SEQ ID No. 2.

3. A Bacillus thuringiensis according to claim 1, wherein the 3-hexulose 6-phosphate synthase HpS has the amino acid sequence set forth in SEQ ID No.3 and the 6-phosphate 3-hexuloisomerase PhI has the amino acid sequence set forth in SEQ ID No. 4.

4. The bacillus thuringiensis according to claim 1, wherein the NADH dehydrogenase NdH has the amino acid sequence shown in SEQ ID No. 5.

5. The Bacillus thuringiensis of claim 1, wherein the 3-hexulose-6-phosphate synthase HpS, the 6-phospho-3-hexuloisomerase PhI, and the NADH dehydrogenase NdH are expressed using Pveg promoter, and the methanol dehydrogenases MdH and MdH activator protein AcT are expressed using P566 promoter.

6. A Bacillus thuringiensis according to claim 5, wherein the Pveg promoter has the nucleotide sequence shown in SEQ ID No.6, SEQ ID No.10 or SEQ ID No. 11.

7. A Bacillus thuringiensis according to claim 5, wherein the P566 promoter has the nucleotide sequence shown in SEQ ID No. 7.

8. A bacillus thuringiensis according to claim 1 wherein said host is wild-type bacillus thuringiensis having GenBank accession number CP 001903.

9. Use of a bacillus thuringiensis according to any one of claims 1 to 8 in agriculture or in food.

10. The use of claim 9, wherein the use is for the fermentative production of a desired product using bacillus thuringiensis using methanol as a carbon source.

Images