CN110760536A

CN110760536A - Construction method of methanol bioconversion strain, constructed strain and application

Info

Publication number: CN110760536A
Application number: CN201810826759.3A
Authority: CN
Inventors: 郑平; 王钰; 孙际宾; 凡立稳; T·菲利伯特; 马延和
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2018-07-25
Filing date: 2018-07-25
Publication date: 2020-02-07

Abstract

The invention discloses a method for constructing a methanol rapid utilization strain, which comprises the steps of firstly constructing a basic strain for forcibly utilizing methanol and xylose. And secondly, performing adaptive evolution on the basic strains by using methanol and xylose as carbon sources to obtain the strains with remarkably accelerated growth speed. Finally, the activity of the downstream metabolic pathway related enzyme of ribulose-5-phosphate in the strain is enhanced. The invention also discloses the constructed methanol biotransformation strain and a method for performing methanol biotransformation by using the strain. The strain can be used for methanol bioconversion by taking methanol and xylose as carbon sources, even taking methanol as a unique carbon source, and the conversion efficiency of the methanol is obviously improved. The invention also discloses mutants of some enzymes in the bacterial strain of the invention and a method for performing methanol biotransformation by using the mutants.

Description

Construction method of methanol bioconversion strain, constructed strain and application

Technical Field

The invention relates to the field of biotechnology. In particular, the invention relates to a method for increasing the methanol bioconversion efficiency of a strain, to a strain obtained by such a method and to the use of such a method and the obtained strain for the bioconversion of methanol.

Background

Methanol is a liquid one-carbon resource, is a primary platform product for gasifying coal chemical industry, shale gas chemical industry and industrial and agricultural wastes, and is also an important chemical raw material. The synthesis method of the methanol is various and has wide sources, and can utilize petrochemical resources such as coal, natural gas and the like as raw materials, and can also utilize biomass resources such as agricultural waste straws, municipal organic waste, industrial organic waste such as organic waste residues and steel mill tail gas or carbon dioxide as raw materials. Rich raw material sources and ensures the supply of methanol. The methanol production capacity in China exceeds 5000 million tons/year in 2015, and continuously increases at a rate of 10% -20% per year. At present, the methanol productivity in China reaches 8000 ten thousand tons per year, which accounts for more than 50% of the total international amount and shows an excessive trend. The development of a methanol high-value conversion technology has important strategic significance for extending a methanol industrial chain, relieving excess production energy, increasing industrial added value and cultivating emerging methanol economy, and becomes a field to be developed urgently in the current methanol chemical industry (Chenjun Jun, Chen Guangda, 2016; Zhang Shixin et al, 2013).

The methanol conversion technology by the Chinese chemical method has a leading position internationally, and key technologies such as methanol to olefin and the like break through and are popularized and implemented in industry in recent years, thereby preliminarily showing the good prospect of methanol economy. But the types of products which can be obtained by the chemical conversion of the methanol are less, the carbon chain of the products is shorter, and the structure is simpler. Compared with chemical conversion, the methanol biotransformation has the characteristics of various products, high product selectivity, green and environment-friendly process and the like, and can synthesize various complex long carbon chain products. Therefore, it is of great importance to develop a methanol bioconversion method and a methanol-based bio-manufacturing industry. At present, the price of the methanol in China is about 2000 yuan/ton, which is far lower than that of glucose (more than 3000 yuan/ton) which is a common biomass raw material, the average carbon atom reduction degree (kappa) of the methanol is as high as 6, which is higher than that of glucose (kappa) 4, xylose (kappa) 4 and glycerol (kappa) 4.7) which are common biomass raw materials, and the methanol can provide a large amount of reducing power for biosynthetic chemicals, so that the conversion rate of the product can be greatly improved. Therefore, methanol is expected to become a new raw material platform for biological fermentation and biological manufacturing industries.

Due to the important significance of methanol bioconversion, in recent years, a great deal of manpower and material resources have been invested in the academic world and the industrial world to study the methanol bioconversion pathway and develop a platform strain that can utilize methanol as a sole carbon source. Although natural microorganisms capable of utilizing methanol exist in the nature, the growth speed is slow, the methanol utilization efficiency is low, and due to the lack of genetic modification tools, the metabolic engineering of the natural microorganisms is difficult, so that the methanol bioconversion utilization is greatly limited. However, from these natural microorganisms, researchers have found a plurality of methanol bioconversion pathways, such as ribulose monophosphate pathway (RuMP pathway), xylulose monophosphate pathway, ribulose diphosphate pathway, serine cycle, and the like. Among them, the RuMP pathway is a methanol bioconversion pathway that is currently studied and applied in many ways. In the RuMP pathway, methanol is first oxidized to formaldehyde by methanol dehydrogenase (Mdh), formaldehyde is catalyzed with ribulose-5-phosphate (Ru5P) to produce hexulose-6-phosphate (H6P) by 3-hexulose-6-phosphate synthase (Hps), H6P is catalyzed by 6-phospho-3-hexulose isomerase (Phi) to produce fructose-6-phosphate (F6P), F6P is utilized into the glycolytic pathway, or Ru5P is regenerated by carbon rearrangement of the pentose phosphate pathway (whittaker, w.b., sandova, n.r., Bennett, r.k., Fast, a.g., papova, e.t.,2015.Synthetic methylation: engineering process of the biochemical and biological analysis of the biological synthesis of the enzyme, 165.175, biological analysis of the enzyme, 7.33, biological analysis of the enzyme, biological synthesis of the enzyme production of the biological synthesis of the enzyme production of the biological synthesis of the current of the enzyme production of the current of the synthesis of the enzyme production of the synthesis of the production of the enzyme of the production of the.

Compared with natural methanol utilization strains, common platform strains have clear genetic background and efficient genetic manipulation tools. The analysis of the methanol biotransformation way and the development of the synthetic biology technology greatly accelerate the construction of the methanol biological utilization platform strain. In 2015, Witthoff et al, Germany, inactivated the enzymes AdhE and Ald, and expressed Mdh, Hps and Phi in Corynebacterium glutamicum. The obtained genetically engineered strain could not grow in mineral salt medium with methanol as sole carbon source, and could grow and consume small amount of methanol with glucose added as additional carbon source (Witthoff, s., Schmitz, k., Niedenfuhr, s., Noh, k., Noack, s., Bott, m., Marienhagen, j.,2015.Metabolic engineering of coryneform bacterium for methanol synthesis. appl. environ. microbiol.81, 2215-2225). In the same year, five researchers in Switzerland, France, the Netherlands, Germany and Norway collaborated to inactivate the enzyme FrmA in E.coli, while expressing Mdh, Hps and Phi. The obtained genetically engineered strain cannot grow in an inorganic salt medium with methanol as a sole carbon source. Investigators catalyzed by resting cells¹³C means of labeling methanol, using mass spectrometry techniques, very little methanol utilization by the cells was detected (M ü ller, j.e., Meyer, f., Litsanov, b., Kiefer, p., Potthoff, e., Heux, s., Quax, w.j., wendis, v.f., Brautaset, t., portatis, j.c., Vorholt, j.a.,2015.Engineering Escherichia coli for methanol conversion, metal.en.28, 190-201).

In 2016, researchers in Price et al in the United states utilized Mdh, Hps and Phi multienzyme complexes to improve methanol utilization efficiency, but even with the multienzyme complexes, growth using methanol as the sole carbon source could not be achieved, and methanol bioconversion could only be achieved by resting cell catalyzed methanol methods (Price, J.V., Chen, L., Whitaker, W.B., Papout sakis, E., Chen, W.,2016.Scaffoldless engineered enzyme assembly for enhanced methanol bioconversion, Proc. Natl.Acad.Sci.U.S.A.113, 12691-12696).

In 2017, researchers of whittaker et al in the united states inactivated the enzyme FrmA in e.coli while expressing Mdh with superior enzyme activity properties, as well as Hps and Phi. The obtained genetically engineered strain could not grow in mineral salts medium with methanol as sole carbon source, and with the addition of yeast powder as additional carbon source, the genetically engineered strain could grow and consume small amounts of methanol (whittaker, w.b., Jones, j.a., Bennett, k., Gonzalez, j., vernacchia, v.r., Collins, s.m., Palmer, m.a., Schmidt, s.a., aniniewicz, m.r., Koffas, m.a., Papoutsakis, e.t.,2017.Engineering conversion of methane to particulate in Escherichia coli.ab.eng.39, 49-59). In the same year, Rohlhill et al in the United states used formaldehyde inducible promoters to control the expression of genes involved in methanol utilization, although this increased the efficiency of methanol utilization, the growth of genetically engineered strains still required yeast powder and methanol as carbon sources (Rohlhill, J., Sandoval, N.R., Papous, E.T.,2017.Sort-seq a pro to engineering a used formaldehyde-absorbent promoter for regulated Escherichia coli growth on methane. Synth. biol.6, 1584-1595). In 2017, chinese researchers used a linear methanol bioconversion pathway instead of the commonly used RuMP pathway to construct e.coli bioconversion of methanol, although¹³The C-labelling experiment confirmed that methanol was used by genetically engineered strains to synthesize some metabolites, but the strains were still unable to grow using methanol as the sole carbon source (Wang, X., Wang, Y., Liu, J., Li, Q., Zhang, Z., ZHEN, P., Lu, F., Sun, J.,2017.Biologicalconversion of methanol by analyzed Escherichia coli carbon linear transformation pathway 4, 41).

In 2018, researchers of Bennett et al in the United states inactivated the enzyme FrmA in E.coli, and expressed Mdh, Hps and Phi, as well as pentose phosphate pathway key enzymes derived from the natural methanol-utilizing bacterium Bacillus methanolicus. The obtained genetically engineered strain cannot grow in an inorganic salt culture medium with methanol as a unique carbon source, and can grow and utilize a small amount of methanol under the condition of additionally adding glucose or yeast powder. For example, in mineral salts medium containing methanol and glucose, the genetically engineered strain consumes about 275mM glucose and only 38.3mM methanol, with a ratio of methanol to glucose utilization of about 0.14:1(Bennett, R.K., Gonzalez, J.E., Whitaker, W.B., Antoniewicz, M.R., Papoutsakis, E.T.,2018.Expression of heterologous non-oxidative phosphate sodium chloride bacteria strain and phosphate isocyanate amplification reaction and synthesis bacterial strain methyl alcohol, method.45, 75-85). In the same year, researchers such as Meyer and the like in Switzerland further modify E.coli, express Mdh, Hps and Phi, inactivate phosphogluconate dehydratase Edd, ribose-5-phosphate isomerase RpiAB and malate dehydrogenase Maldh, and combine adaptive evolution to obtain a genetic engineering strain which must use gluconic acid and methanol for growth. While this study enhanced the use of methanol by e.coli, genetically engineered strains still required gluconic acid as an additional carbon source. Since the existing genetic engineering platform strains all need yeast powder, glucose or gluconic acid as an extra carbon source to realize the methanol bioconversion, researchers such as Gonzalez in the United states and the like deeply research the effect of co-utilizing methanol and various cosubstrates. This also suggests that engineering platform strains to have the ability to grow using methanol as the sole carbon source is a very challenging and difficult task.

A recent study in 2018 indicated that methanol bioconversion is very difficult and that the reaction of methanol oxidation to form formaldehyde is a key reaction limiting methanol bioconversion efficiency. To circumvent this problem, researchers from germany produced formaldehyde by sarcosine oxidation instead of methanol oxidation, expressed the sarcosine oxidases Sox, Hps and Phi in e. In the discussion section of this research paper, research teams also describe their efforts in methanol bioconversion studies. The research team replaced sarcosine oxidase Sox with Mdh and tried to replace sarcosine with methanol, but the obtained genetically engineered strain still could not utilize methanol in the presence of xylose as an additional carbon source.

Due to the difficulty and complexity of methanol bioconversion research work, no research institution or enterprise constructs a platform strain capable of growing by using methanol as a unique carbon source at home and abroad at present, so that the development and application of methanol bioconversion are greatly limited.

Disclosure of Invention

The invention aims to provide a method for constructing a strain biotransformation strain.

Another object of the present invention is to provide a strain for high efficiency methanol bioconversion and the use of such strain for bioconversion of methanol.

It is another object of the present invention to provide mutants of enzymes, the introduction of which leads to an improved methanol bioconversion capability of said strains.

In a first aspect, the present invention provides a method for constructing a methanol bioconversion strain, the method comprising the steps of:

1) constructing a basic strain for forced co-utilization of methanol and xylose, which is characterized by comprising but not limited to: A. enhancing the activity of xylose metabolic pathway related enzymes in the strain or introducing exogenous xylose metabolic pathway related enzymes, B, weakening the activity of downstream metabolic pathway related enzymes of ribulose-5-phosphate in the strain, C, enhancing the activity of ribulose monophosphate pathway related enzymes;

2) and (3) carrying out adaptive evolution on the basic strains to obtain the strains with remarkably accelerated growth speed. The adaptive evolution uses a culture medium which does not contain glucose and contains methanol and xylose as carbon sources;

3) enhancement 2) the activity of a downstream metabolic pathway-related enzyme of ribulose-5-phosphate in the growth-accelerating strain.

In a preferred embodiment, the step 1) may further include: carrying out adaptive evolution on the strains meeting A and B at the same time to obtain strains with remarkably accelerated growth speed; the adaptive evolution uses a medium that does not contain glucose, but contains ribose and xylose as carbon sources.

In a preferred embodiment, the step 3) may further include: carrying out adaptive evolution on the strain obtained in the step 3) to obtain a strain with remarkably accelerated growth speed; the adaptive evolution uses a culture medium which does not contain glucose but contains methanol and xylose as main carbon sources, and the proportion of xylose can be gradually reduced to zero in the evolution process.

The adaptive evolution refers to a process that a strain grows and expands in a culture medium with a specific formula, and mutants which can adapt to the environment of the culture medium are gradually enriched into dominant strains, and the adaptive evolution can be realized by batch culture repeated transfer culture, continuous culture or combination and the like; the times of repeated transfer culture by batch culture are not less than 4; by continuous culture, for example, by using a fermenter, the total volume of the fed liquid is not less than two tank volumes.

In specific embodiments, the xylose metabolic pathway-related enzyme is a xylose isomerase;

the downstream metabolic pathway-related enzyme of ribulose-5-phosphate is ribose phosphate isomerase;

the ribulose monophosphate pathway-related enzymes are methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi).

In specific embodiments, the strain is Escherichia coli (Escherichia coli), Corynebacterium glutamicum (Corynebacterium glutamicum), Bacillus subtilis (Bacillus subtilis); corynebacterium glutamicum (Corynebacterium glutamicum) is preferred.

In a preferred embodiment, enhancing the activity of enzymes associated with the xylose metabolic pathway in said strain can be achieved by one or a combination of the following methods: expressing a coding gene of homologous or heterologous xylose isomerase, and/or increasing the copy number of the coding gene in the strain, and/or modifying the promoter of the coding gene to enhance the transcription initiation rate, and/or modifying the translation regulatory region of messenger RNA carrying the coding gene to enhance the translation strength.

In a preferred embodiment, said attenuating the activity of an enzyme associated with a metabolic pathway downstream of ribulose-5-phosphate is a deletion of ribose phosphate isomerase.

In a preferred embodiment, attenuating the downstream metabolic pathway of ribulose-5-phosphate in said strain may be achieved by one or a combination of the following methods: the coding gene of the ribose phosphate isomerase is partially or completely knocked out, the gene is inactivated by mutation, the transcription or translation of the coding gene is weakened by changing a gene promoter or a translation regulating region, the mRNA stability of the coding gene is weakened by changing a gene sequence, the enzyme structure is unstable, and the like.

In a preferred embodiment, the enhancement of the ribulose monophosphate pathway in the strain means the enhancement of the activities of methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi) in the strain; or introducing exogenous methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi).

In a preferred embodiment, enhancing the activity of said enzymes associated with the metabolic pathway downstream of ribulose-5-phosphate means that ribose phosphate isomerase is expressed in the strain.

In a preferred embodiment, the method further comprises determining the methanol bioconversion of the resulting strain.

In a preferred embodiment, the methanol bioconversion strain has a molar ratio of methanol to xylose utilization of 3:1 or more, preferably 3.5:1 or more, more preferably 7:1 or more.

In a preferred embodiment, the strain obtained by the method can grow by using methanol as a sole carbon source, so that the strain can be used for performing the bioconversion of methanol.

In a preferred embodiment, the strain may not comprise the ribulose monophosphate pathway itself or comprise the ribulose monophosphate pathway.

In a second aspect, the present invention provides a high efficiency methanol bioconversion strain, prepared by:

2) and (3) carrying out adaptive evolution on the basic strains to obtain the strains with remarkably accelerated growth speed. The adaptive evolution uses a culture medium which does not contain glucose and contains methanol and xylose as main carbon sources;

In a preferred embodiment, the step 1) may further include: and (3) carrying out adaptive evolution on the bacterial strains meeting the requirements of A and B at the same time to obtain the bacterial strains with remarkably accelerated growth speed. The adaptive evolution uses a medium that does not contain glucose, but contains ribose and xylose as the main carbon sources.

In a preferred embodiment, the step 3) may further include: performing adaptive evolution on the strain obtained in the step 3) to obtain the strain with remarkably accelerated growth speed. The adaptive evolution described uses a medium that does not contain glucose, but contains methanol and xylose as the main carbon sources.

The adaptive evolution refers to a process that a strain grows and expands in a culture medium with a specific formula, and mutants which can adapt to the environment of the culture medium are gradually enriched into dominant strains, and can be realized by batch culture repeated transfer culture, continuous culture or combination and the like. The times of repeated transfer culture by batch culture are not less than 4; by continuous culture, for example, by using a fermenter, the total volume of the fed liquid is not less than two tank volumes.

In preferred embodiments, the ribulose monophosphate pathway in the strain enhances or introduces an exogenous ribulose monophosphate pathway.

In a preferred embodiment, enhancing the ribulose monophosphate pathway in said strain means enhancing the activity of methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi) in said strain; or introducing exogenous methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi).

In a preferred embodiment, the high efficiency transformation methanol-utilizing strain is enhanced in the activities of methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi), or exogenous methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi) are introduced; and the activity of the xylose isomerase is enhanced or exogenous xylose isomerase is introduced; and knock-out of ribose phosphate isomerase.

In a specific embodiment, the strain is Escherichia coli (Escherichia coli), Corynebacterium glutamicum (Corynebacterium glutamicum), Bacillus subtilis (Bacillus subtilis), preferably Corynebacterium glutamicum (Corynebacterium glutamicum).

In a preferred embodiment, the strain is prepared using the method of the first aspect.

In a preferred embodiment, the methanol bioconversion strain has a methanol to xylose utilization molar ratio of 3:1 or more, preferably 3.5:1 or more, more preferably 7: 1.

In a preferred embodiment, the strain can grow using methanol as the sole carbon source, thereby performing the bioconversion of methanol.

In a third aspect, the invention provides a high-efficiency methanol bioconversion strain, which is a strain preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No. 15944.

In a fourth aspect, the invention provides the use of a strain according to the second aspect for the bioconversion of methanol and the production of subsequent products from methanol.

In a preferred embodiment, the production of the subsequent product by using methanol refers to the production of amino acids, organic alcohols and the like by using methanol.

In a preferred embodiment, the production of amino acids by methanol refers to the production of amino acids such as glutamic acid, lysine, threonine, methionine, and derivatives thereof; glutamic acid is preferred.

In a fifth aspect, the present invention provides a method for bioconversion of methanol, comprising performing bioconversion of methanol using the strain constructed by the construction method of the first aspect or the strain of the second aspect.

In a preferred embodiment, the process utilizes methanol and xylose in a molar ratio of 3:1 or greater, preferably 3.5:1 or greater, more preferably 7:1 or greater.

In a preferred embodiment, the method utilizes methanol as the sole carbon source for the bioconversion of methanol.

In a sixth aspect, the present invention provides a method for increasing methanol bioconversion ability of a strain comprising the following polypeptides:

a sugar metabolism multifunctional regulator (AtlR) with the mutation of the 146 th amino acid to S; and/or

Chaperone active ATPase (Cgl2030) with mutation of amino acid 179 to S; and/or

The 145 th amino acid is mutated into cytochrome C oxidase subunit III (CtaE) of A; and/or

O-acetylhomoserine sulfhydrylase (MetY) with mutation of amino acid 419 to D; and/or

Amino acid 194 mutated to a dual regulator of the cellular morphology, antibiotic sensitivity and osmoregulatory genes (MtrA) of Q; and/or

Uridine utilization and ribose uptake transcriptional repressor (UriR) with amino acid 195 mutated to I; and/or

Putative protein (Cgl1520) with amino acid 192 mutated to V; and/or

An uncharacterized membrane protein (Cgl2424) with amino acid 149 mutated to E; and/or

The amino acid at position 35 was mutated to the putative protein of V (Cgl 2998).

In a preferred embodiment, the strain is a strain that is itself capable of methanol bioconversion.

In a preferred embodiment, the strain obtained by the method utilizes methanol and xylose as carbon sources, preferably methanol as the sole carbon source for the bioconversion of methanol.

In a seventh aspect, the present invention provides a strain having an improved methanol bioconversion ability obtained by the method of the sixth aspect.

In an eighth aspect, the present invention also provides the following polypeptides:

Chaperone active ATPase (Cgl2030) with mutation of amino acid 179 to S; and/or

Putative protein (Cgl1520) with amino acid 192 mutated to V; and/or

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Detailed Description

The inventor has conducted extensive and intensive studies to realize that the insufficient supply of ribulose-5-phosphate, another important raw material for fixing formaldehyde by biological reaction, in vivo, may be the key to the great biological toxicity of formaldehyde and the great difficulty in engineering design and modification of methanol metabolism. It is sought to enable strains that bioconvert methanol to utilize xylose to provide ribulose 5-phosphate and to reduce consumption of ribulose 5-phosphate by other metabolic pathways, to subsequently increase activity of methanol utilization-related enzymes and the ribulose monophosphate carbon fixation pathway in the strains, to increase the rate of methanol and xylose co-utilization by adaptive evolution, and finally to complement downstream metabolic pathways of ribulose 5-phosphate, the resulting strains being capable of even growth and bioconversion of methanol with methanol as sole carbon source. The present invention has been completed based on this finding.

Definition of terms

The term "exogenous" as used herein means that a system contains material that was not originally present. For example, an enzyme is "exogenous" to a strain by introducing a gene encoding the enzyme into the strain, which is not originally present in the strain, by transformation or the like, and expressing the enzyme in the strain.

The term "enhance" as used herein refers to increasing, enhancing, augmenting or elevating the activity of a protein, such as an enzyme. In view of the teachings of the present invention and the prior art, it will also be understood by those skilled in the art that "enhancing" as used herein shall also include enhancing the activity of an enzyme by expressing a heterologous encoding gene for that enzyme. In particular embodiments, enhancing the activity of an enzyme may be achieved by expressing an endogenous or heterologous coding gene for the enzyme, and/or increasing the copy number of the coding gene, and/or modifying the promoter of the coding gene to increase the rate of transcription initiation, and/or modifying the translational regulatory region of the messenger RNA carrying the coding gene to increase translational strength, and/or modifying the coding gene itself to increase mRNA stability, protein stability, release of feedback inhibition of the protein, and the like.

Similarly, the term "attenuation" as used herein refers to the reduction, attenuation, reduction or complete elimination of the activity of a protein, e.g., an enzyme. In specific embodiments, the reduction of the activity of the enzyme may be achieved by partial or complete knock-out of the gene encoding the enzyme, by mutational inactivation or partial inactivation of the gene, by alteration of the promoter or translational regulatory region of the gene such that its transcription or translation is attenuated, by alteration of the gene sequence such that its mRNA stability is reduced or the enzyme structure is unstable, or by a combination thereof.

The term "enzyme associated with xylose metabolic pathway" as used herein refers to an enzyme involved in xylose metabolic pathway of a microorganism; i.e., an enzyme that confers the ability of the microorganism to utilize xylose for growth. In a specific embodiment, the xylose metabolic pathway-related enzymes of the present invention include, but are not limited to, xylose isomerase. As is known to those skilled in the art, xylose isomerase consists of two enzymes, xylA and xylB, and the strain utilizes xylose only when both enzymes are present. Some strains have both genes, and some strains, such as C.glutamicum, have only xylB.

Furthermore, in view of the teachings of the present invention and the prior art, it will be readily appreciated by those of ordinary skill in the art that the present invention can utilize various sources of xylose metabolic pathway-related enzymes, which can be any microorganism so long as the enzymes impart the ability of the microorganism to utilize xylose for growth. In a specific embodiment, the xylose metabolic pathway-related enzymes used in the present invention, such as xylose isomerase, are of E.coli origin.

The term "downstream metabolic pathway-related enzyme of ribulose-5-phosphate" as used herein refers to an enzyme that synthesizes other substances using ribulose-5-phosphate as a substrate, thereby consuming ribulose-5-phosphate. In a specific embodiment, the downstream metabolic pathway-related enzyme of ribulose-5-phosphate is ribose phosphate isomerase.

The term "ribulose monophosphate (RuMP) pathway" as used herein has the meaning conventionally understood by a person skilled in the art, i.e. a methanol bioconversion pathway in a microorganism. In the RuMP pathway, methanol is first oxidized to formaldehyde by methanol dehydrogenase (Mdh), formaldehyde and ribulose-5-phosphate (Ru5P) are catalyzed by 3-hexulose-6-phosphate synthase (Hps) to produce hexulose-6-phosphate (H6P), H6P is catalyzed by 6-phospho-3-hexulose isomerase (Phi) to produce fructose-6-phosphate (F6P), F6P is utilized into the glycolytic pathway, or carbon rearrangement is performed through the pentose phosphate pathway to regenerate Ru 5P. Accordingly, the term "ribulose monophosphate (RuMP) pathway" as used herein includes various enzymes such as methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi).

The term "adaptive evolution" as used herein has the meaning conventionally understood by those skilled in the art, that is, by using serial transfer or serial culture, etc., to allow microorganisms to grow in a specific environment (e.g., a specific culture medium) through serial division and passage, spontaneous or artificial mutation results in enrichment of individuals that can adapt to the environment and grow faster during the process. Specifically, taking a continuous passage way as an example, the "adaptive evolution" described herein includes three technical means, one of which is to inoculate a strain overexpressing a xylose isomerase gene and knocking out a ribose-phosphate isomerase gene into a culture medium (for example, CGXII culture medium) not containing glucose, add ribose and xylose to the culture medium, and perform continuous passage, wherein the more the number of passages is, the better the number is, and in particular, 10 to 30 continuous passages can be performed, so that the strain can rapidly grow by utilizing ribose and xylose; secondly, the strain expressing xylose isomerase genes, knocking out ribose phosphate isomerase genes, and expressing methanol dehydrogenase genes, hexulose 6-phosphate synthase genes and hexulose 6-phosphate isomerase genes is inoculated to a culture medium (such as CGXII culture medium) without glucose, methanol and xylose are added into the culture medium for continuous passage, the more the passage times are, the better the passage times are, and during specific implementation, continuous passage for 10-30 times can be carried out, so that the strain can rapidly grow by using the methanol and the xylose; and thirdly, inoculating the strains obtained by continuous passage in the methanol and xylose culture medium and further supplementing the strains obtained by the downstream metabolic pathway of ribulose-5-phosphate into a culture medium (such as CGXII culture medium) without glucose, adding methanol and xylose into the culture medium, and carrying out continuous passage, wherein the proportion of xylose can be gradually reduced to zero in the evolution process, the more the passage times are, the better the passage times are, and the continuous passage can be carried out for 10-30 times. When the continuous culture mode is used for adaptive evolution, the used culture medium and carbon source are the same as those used in the continuous passage mode, the more the total volume of the liquid flowing into the culture tank is, the better the culture tank is, and the volume of at least two tanks can be realized in specific implementation.

The term "bioconversion" as used herein has the meaning conventionally understood by those skilled in the art, i.e., the conversion of methanol to environmentally benign products (e.g., carbon dioxide), or bacterial and various chemicals, using enzymes, resting cells, or living cells.

The "methanol bioconversion efficiency" or "methanol bioconversion rate" of the strain of the present invention can be measured by the ratio of the strain to the amount of methanol and other carbon sources utilized. For example, the strains of the invention utilize a molar ratio of methanol to glucose or xylose during the bioconversion of methanol. In a further embodiment, the strain of the invention is capable of performing even the production and bioconversion of methanol with methanol as sole carbon source. Thus, the "methanol bioconversion efficiency" or "methanol bioconversion rate" of a strain of the invention can also be measured by the rate of methanol utilization by the strain. For example, the strain of the present invention has a methanol utilization rate per cell body in the process of bioconversion of methanol.

The methanol biotransformation strain of the invention and the construction method thereof

The term "methanol bioconversion strain", "strain for bioconversion of methanol" or "strain of the present invention" as used herein has the same meaning and refers to a microorganism that biologically converts methanol so that methanol can be converted into environmentally friendly products (e.g., carbon dioxide) or into bacteria, amino acids, organic acids, polyols, etc. by means of the methanol bioconversion strain.

In a specific embodiment, the invention provides a method for improving methanol bioconversion efficiency of a strain by exogenously expressing xylose metabolic pathway-related enzymes, such as xylose isomerase, in a strain for bioconverting methanol, so that the strain can utilize xylose or enhance the activity of xylose metabolic pathway-related enzymes, and simultaneously reducing the consumption of ribulose 5-phosphate by other metabolic pathways, such as knocking out or inactivating ribose phosphate isomerase, then increasing the activity of ribulose monophosphate pathway in the strain, constructing a basic strain for forced co-utilization of methanol and xylose, using adaptive evolution to enhance the growth rate of the strain utilizing methanol and xylose, and then increasing the activity of downstream metabolic pathway-related enzymes of ribulose 5-phosphate in the evolved strain. By further combining the technical means of adaptive evolution, the obtained strain not only remarkably improves the methanol bioconversion efficiency, but also has a molar ratio of methanol to xylose of more than 3:1, preferably more than 3.5:1, and more preferably more than 7: 1; the strains of the invention are even capable of growth and bioconversion of methanol with methanol as sole carbon source.

Specifically, the methanol bioconversion strain of the present invention can be constructed by a method comprising:

3) enhancing 2) the activity of a downstream metabolic pathway-related enzyme of ribulose-5-phosphate in the growth-accelerating strain;

in a preferred example, the step 1) may further include: carrying out adaptive evolution on the strains meeting A and B at the same time to obtain strains with remarkably accelerated growth speed; the adaptive evolution uses a medium that does not contain glucose, but contains ribose and xylose as carbon sources.

In a preferred example, the step 3) may further include: carrying out adaptive evolution on the strain obtained in the step 3) to obtain a strain with remarkably accelerated growth speed; the adaptive evolution uses a culture medium which does not contain glucose but contains methanol and xylose as main carbon sources, and the proportion of xylose can be gradually reduced to zero in the evolution process.

Based on the teaching of the prior art, the skilled worker knows how to achieve the above-described enhancement or reduction of the enzymatic activity or the introduction of exogenous enzymes.

For example, enhancing the activity of enzymes associated with the xylose metabolic pathway in said strain can be achieved by one or a combination of the following methods: expressing a coding gene of homologous or heterologous xylose isomerase, and/or increasing the copy number of the coding gene in the strain, and/or modifying the promoter of the coding gene to enhance the transcription initiation rate, and/or modifying the translation regulatory region of messenger RNA carrying the coding gene to enhance the translation strength.

The attenuation includes deleting downstream metabolic pathway-related enzymes of ribulose-5-phosphate. In particular embodiments, attenuating the downstream metabolic pathway of ribulose-5-phosphate in said strain may be achieved by one or a combination of the following methods: the coding gene of the ribose phosphate isomerase is partially or completely knocked out, the gene is inactivated by mutation, the transcription or translation of the coding gene is weakened by changing a gene promoter or a translation regulating region, the mRNA stability of the coding gene is weakened by changing a gene sequence, the enzyme structure is unstable, and the like.

Based on the teachings of the present invention, it will be appreciated by those skilled in the art that the methanol bioconversion strain of the present invention may itself comprise the ribulose monophosphate pathway described above, or an exogenous ribulose monophosphate pathway may be introduced. For example, enhancing the activity of methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexuloisomerase (Phi) in the strain; or introducing exogenous methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi). Thus, the methanol bioconversion strain of the present invention may be a methanol bioconversion strain constructed de novo, i.e., comprising the ribulose monophosphate pathway constructed de novo and enhancing the activity of xylose metabolic pathway-related enzymes in said strain or introducing exogenous xylose metabolic pathway-related enzymes and attenuating the activity of downstream metabolic pathway-related enzymes of ribulose-5-phosphate in said strain; further modifications to strains already comprising the RuMP pathway are also possible.

In a preferred embodiment, the activity of methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi) is enhanced in the strain of the present invention, or exogenous methanol dehydrogenase (Mdh), 3-hexulose-6-phosphate synthase (Hps) and 6-phospho-3-hexulose isomerase (Phi) are introduced; the activity of the xylose isomerase is enhanced or exogenous xylose isomerase is introduced; and knock out ribose phosphate isomerase.

The strain of the present invention may be any methanol bioconversion strain that can be constructed by the above-described method, including but not limited to Corynebacterium glutamicum (Corynebacterium glutamicum), Escherichia coli (Escherichia coli), Bacillus subtilis (Bacillus subtilis), and preferably Corynebacterium glutamicum (Corynebacterium glutamicum). In a specific embodiment, the high efficiency methanol bioconversion strain of the present invention is a strain deposited in China general microbiological culture Collection center (CGMCC No. 15944) with the collection number of CGMCC No.15944 in 6/15 of 2018.

The invention has the advantages that:

1. the invention provides a brand new idea for constructing the bacterial strain with improved methanol bioconversion efficiency, skillfully combines metabolic engineering modification and adaptive evolution technology, and gradually realizes high-efficiency methanol bioconversion by forced co-utilization of methanol and xylose, thereby solving the problem of low methanol utilization efficiency in the prior art and the problem of toxicity caused by mismatching of formaldehyde generation speed and utilization speed in the methanol bioconversion process; and

2. the strain can grow and carry out methanol bioconversion by taking methanol as a main carbon source and even taking methanol as a unique carbon source, achieves the effect exceeding the level reported by all the prior art, and provides an excellent platform strain for methanol bioconversion; and

3. the strain provided by the invention has the advantages that the methanol bioconversion efficiency is remarkably improved, so that the strain has remarkable economic value and social value, a foundation is laid for realizing methanol bioconversion and methanol chemical industry, and the methanol is really expected to become a new raw material platform for biological fermentation and biological manufacturing industries.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

The reagents and starting materials used in the present invention are commercially available.

Examples

Example 1 expression of xylose isomerase Gene in Corynebacterium glutamicum

Expressing xylose isomerase gene in Corynebacterium glutamicum (C.glutamicum) to construct Corynebacterium glutamicum capable of growing on xylose.

(1) Coli MG1655 as a template, and single-stranded nucleotides xylA-F (gaaacagaattaattaagcttccaaaggagttgagaatgcaagcctattttgaccag, SEQ ID NO:1) and xylA-R (caaaac agccaagctgaattcttatttgtcgaacagataatggttt, SEQ ID NO:2) as primers, by PCR method, a fragment of xylose isomerase-encoding gene xylA was amplified.

(2) Plasmid pXMJ19 was digested with the restriction enzymes HindIII and EcoRI and linearized.

(3) The xylA fragment and the linearized pXMJ19 plasmid were ligated using the Cloneexpress II One Step Cloning Kit (Biotech, Inc., Nujinomoto Zan) to construct pXMJ19-xylA plasmid.

(4) With reference to the literature (Ruan, Y., Zhu, L., Li, Q.,2015., Improving the electro-transformation efficiency of Corynebacterium glutamicum by watering cells and creating the cytoplastic membrane flux. Biotechnol. Lett.37, 2445-2452), competent cells of C.glutamicum ATCC 13032. delta. adhE. ald were prepared, the above-mentioned plasmid pXMJ19-xylA was transformed into C.glutamicum ATCC 13032. delta. adhE. ald, and a strain C.glutamicum ATCC 13032. delta. adhE. ald (pXMJ19-xylA) expressing the xylose isomerase gene xylA was constructed.

Example 2 knocking out the ribophosphate isomerase Gene in Corynebacterium glutamicum

The present inventors knocked out the ribose phosphate isomerase gene rpiB in strain C.glutamcum ATCC13032 delta adhE delta ald (pXMJ 19-xylA).

(1) An upstream homology arm fragment for knocking out the rpiB gene was amplified by a PCR method using a genomic DNA of C.glutamicum ATCC13032 as a template and single-stranded nucleotides DeltarpiB-F1 (gagctcggtacccggggatccctcattccgtttcgcagcat, SEQ ID NO:3) and DeltarpiB-R1 (ggtgcgattccgtggtctgctccaaggtatac, SEQ ID NO:4) as primers.

(2) A downstream homology arm fragment for knocking out the rpiB gene was amplified by a PCR method using a genomic DNA of C.glutamicum ATCC13032 as a template and single-stranded nucleotides DeltarpiB-F2 (gcagaccacggaatcgcacctgtcgttcctaa, SEQ ID NO:5) and DeltarpiB-R2 (caggtcgactctagaggatccaccagacacaaaatcagcagaagta, SEQ ID NO:6) as primers.

(3) The plasmid pK18mobsacB was digested with the restriction enzyme BamHI to linearize the plasmid.

(4) The upstream homology arm fragment, the downstream homology arm fragment, and the linearized pK18mobsacB plasmid were ligated using the Clonexpress MultiS One Step Cloning Kit (NyVon NuoZan Biotechnology Co., Ltd.) to construct the pK18mobsacB- Δ rpiB plasmid.

(5) With reference to the literature (Ruan, Y., Zhu, L., Li, Q.,2015., Improving the electro-transformation efficiency of Corynebacterium glutamicum by watering cells and creating the cytoplastic membrane flux, Biotechnol. Lett.37, 2445-2452), competent cells of C.glutamicum ATCC 13032. delta. adhE. ald (pXMJ19-xylA) were prepared, and the above pK18 mobsacB-. DELTA.rpiB plasmid was transformed into C.glutamicum ATCC 13032. delta. adhE. ald (pXMJ 19-xA). According to the method of the literature, the rpiB gene was knocked out, and a strain C.glutamicum ATCC 13032. delta. adhE. delta. al. rpiB (pXMJ19-xylA) expressing xylose isomerase gene xylA and knocking out ribose phosphate isomerase gene rpiB was constructed.

Example 3 Adaptation of Ribose and xylose as carbon sources

To enhance the ability of the resulting strains to grow without using glucose as a carbon source, the inventors performed adaptive evolution of the strains obtained in example 2, as follows:

(1) strain c. glutamicum ATCC13032 Δ adhE Δ ald Δ rpiB (pXMJ19-xylA) was cultured using CGXII medium without glucose, supplemented with 26.6mM ribose, 26.6mM xylose, 1mM Isopropylthiogalactoside (IPTG) and 5mg/L chloramphenicol. CGXII medium formulations are described in the literature (Keilhauer, C., egg, L., Sahm, H.,1993.Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvC operon. J. bacteriol.175, 5595-5603). The culture temperature is 30 ℃, the rotating speed of a shaking table is 220rpm, the shaking bottle is 250mL, and the liquid loading is 50 mL.

(2) After 24 hours of culture, the culture was used as a seed solution, inoculated with the above CGXII medium without glucose, and added with 26.6mM ribose, 26.6mM xylose, 1mM Isopropylthiogalactoside (IPTG) and 5mg/L chloramphenicol, and the second round of culture was continued. The culture temperature is 30 ℃, the rotating speed of a shaking table is 220rpm, the shaking bottle is 250mL, and the liquid loading is 50 mL.

(3) And (4) repeating the step (2). After the tenth round of culture, the culture broth was diluted appropriately, plated on the above CGXII medium plate without glucose, and 26.6mM ribose, 26.6mM xylose, 1mM Isopropylthiogalactoside (IPTG) and 5mg/L chloramphenicol were added. The culture temperature was 30 ℃.

(4) Larger colonies were picked from the plate and expanded to obtain a mutant C.glutamicum ATCC 13032. delta. adhE. delta. ald. delta. rpiB (pXMJ19-xylA) RX1 which grew rapidly on ribose and xylose.

Example 4 expression of methanol dehydrogenase, hexulose 6-phosphate synthase and hexulose 6-phosphate isomerase genes in Corynebacterium glutamicum

To construct the RuMP pathway in c.glutamcum, allowing the strain to have the ability to utilize methanol as a carbon source, the methanol dehydrogenase gene mdh, the ketohexose 6-phosphate synthase gene hps and the ketohexose 6-phosphate isomerase gene phi were expressed in the strain c.glutamcum ATCC13032 Δ adhE Δ ald Δ rpiB (pXMJ19-xylA) RX1 as follows:

(1) the mdh gene fragment was amplified by the PCR method using the genomic DNA of Bacillus stearothermophilus DSM 2334 as a template and the single-stranded nucleotides mdhBs2334-F (ataacaatttcacacaggccaaaggagttgagaatgaaagcagcagtagttaacgaat, SEQ ID NO:7) and mdhBs2334-R (ggatccccgggtaccgagctctcaatcctccttcaattttagtacg, SEQ ID NO:8) as primers.

(2) The pEC-XK99E plasmid was linearized by the method of PCR using pEC-XK99E plasmid as a template and the single-stranded nucleotides pEC-XK99E-F (cggtacccggggatcctcta, SEQ ID NO:9) and pEC-XK99E-R (cctgtgtgaaattgttatccgctc, SEQ ID NO:10) as primers.

(3) The mdh gene fragment and the linearized pEC-XK99E plasmid were ligated using the Clonexpress II One Step Cloning Kit (Biotech, Inc., Nuo Wei Zan, Nanjing) to construct pEC-XK99E-mdh plasmid.

(4) The hps and phi gene fragments were amplified by PCR using genomic DNA of Bacillus methanolica MGA3 as a template and the single-stranded nucleotides hps-phi-F1(aatgagagctcggtacccgggttgacattgattaatccatgtgctataatggactagtgcaaggagatatagatatggaacttcaattagctctagatttg, SEQ ID NO:11) and hps-phi-R (cgactctagaggatccccgggctactcaagattagcatgtcttccgt, SEQ ID NO:12) as primers.

(5) The plasmid pEC-XK99E-mdh was digested with the restriction enzyme XmaI to linearize the plasmid.

(6) The above hps and phi gene fragments were ligated with linearized pEC-XK99E-mdh plasmid using the Clonexpress II One Step Cloning Kit (Biotech, Inc., Nanjing Novowed), to construct pEC-XK99E-mdh-hps-phi plasmid.

(7) With reference to the literature (Ruan, Y., Zhu, L., Li, Q.,2015., Improving the electro-transformation efficiency of Corynebacterium glutamicum by watering cells and creating the cytoplastic membrane flux, Biotechnol. Lett.37,2445-2452.), competent cells of C.glutamicum ATCC 13032. delta. adhE. aldDeltarpiB (pXMJ19-xylA) RX1 were prepared and the above-mentioned plasmid pEC-XK99E-mdh-hps-phi was transformed into C.glutamicum ATCC 13032. delta. aldhEaldDeltarpiB (pXMJ19-xylA) 1. Constructing and obtaining a strain C.glutamicum ATCC13032 delta adhE delta ald delta rpiB (pXMJ19-xylA, pEC-XK99E-mdh-hps-phi) for expressing xylose isomerase gene xylA, knocking out ribose phosphate isomerase gene rpiB and expressing methanol dehydrogenase gene mdh, hexulose 6-phosphate synthase gene hps and hexulose 6-phosphate isomerase gene phi.

Note: the operations carried out in this example, that is, the expression of methanol dehydrogenase, hexulose 6-phosphate synthase and hexulose 6-phosphate isomerase genes in Corynebacterium glutamicum may be carried out after adaptive evolution using ribose and xylose as carbon sources; it can also be performed before expressing xylose isomerase gene in C.glutamicum, knocking out ribose-phosphate isomerase gene in C.glutamicum and performing adaptive evolution using ribose and xylose as carbon source.

Example 5 adaptive evolution of methanol and xylose as carbon sources

To enhance the ability of the resulting strains to grow without using glucose as a carbon source, the inventors performed adaptive evolution of the strains obtained in example 4, as follows:

(1) strain c. glutamicum ATCC13032 Δ adhE Δ ald Δ rpiB (pXMJ19-xylA, pEC-XK99E-mdh-hps-phi) was cultured using CGXII medium without glucose, supplemented with 125mM methanol, 26.6mM xylose, 1mM Isopropylthiogalactoside (IPTG), 5mg/L chloramphenicol, and 15mg/L kanamycin. CGXII medium formulations are described in the literature (Keilhauer, C., egg, L., Sahm, H.,1993.Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J. bacteriol.175, 5595-5603). The culture temperature is 30 ℃, the rotating speed of a shaking table is 220rpm, the shaking bottle is 250mL, the liquid loading capacity is 50mL, and the shaking bottle is sealed by using an airtight sealing film.

(2) When the cultured cells entered the late logarithmic phase, the culture was used as a seed solution, inoculated with the above CGXII medium without glucose, and added with 125mM methanol, 26.6mM xylose, 1mM Isopropylthiogalactoside (IPTG), 5mg/L chloramphenicol and 15mg/L kanamycin, and the second round of culture was continued. The culture temperature is 30 ℃, the rotating speed of a shaking table is 220rpm, the shaking bottle is 250mL, and the liquid loading is 50 mL.

(3) And (4) repeating the step (2). After the twentieth round of culture, the culture broth was appropriately diluted, plated on the above CGXII medium plate without glucose, and 125mM methanol, 26.6mM xylose, 1mM Isopropylthiogalactoside (IPTG), 5mg/L chloramphenicol and 15mg/L kanamycin were added. The culture temperature was 30 ℃.

(4) A larger colony was picked from the plate and amplified to obtain a mutant C.glutamicum ATCC 13032. delta. adhE. delta. ald. delta. rpiB (pXMJ19-xylA, pEC-XK99E-mdh-hps-phi) MX1 which grew rapidly on methanol and xylose.

Example 6 anaplementation of the rpiB Gene in C.glutamicum

The inventor further supplements rpiB gene in the strain obtained in the example 5, and the specific steps are as follows:

(1) a rpiB gene fragment was amplified by a PCR method using the genomic DNA of C.glutamicum ATCC13032 as a template and the single-stranded nucleotides rpiB-F (gaaacagaattaattaagcttccaaaggagttgagaatgcgcgtataccttggagcag, SEQ ID NO:13) and rpiB-R (tgcattctcaactcctttggttattcgttaggaacgacaggtgcg, SEQ ID NO:14) as primers.

(2) The RBS-bearing xylA gene fragment was amplified by PCR using pXMJ19-xylA plasmid as a template and the single-stranded nucleotides RBS-xylA-F (ctgtcgttcctaacgaataaccaaaggagttgagaatgcaag, SEQ ID NO:15) and RBS-xylA-R (aaaacagccaagctgaattcttatttgtcgaacagataatggtttac, SEQ ID NO:16) as primers.

(3) Using pBR322 plasmid as template, and single-stranded nucleotides tet-F (caggagctaaggaagctaaacagggttattgtctcatgagcggat, SEQ ID NO:17) and tet-R (gcaccaataact gccttaaatcaggtcgaggtggcccg, SEQ ID NO:18) as primers, a tet fragment carrying the tetracycline resistance gene was amplified by PCR.

(4) A first pXMJ19 plasmid fragment was amplified by PCR using pXMJ19 plasmid as a template and the single-stranded nucleotides pXMJ19-part1-F (tttagcttccttagctcctgaaaatctc, SEQ ID NO:19) and pXMJ19-part1-R (aagcttaattaattctgtttcctgtg, SEQ ID NO:20) as primers.

(5) A second partial pXMJ19 plasmid fragment was amplified by PCR using the pXMJ19 plasmid as a template and the single-stranded nucleotides pXMJ19-part2-F (gaattcagcttggctgttttggc, SEQ ID NO:21) and pXMJ19-part2-R (tttaaggcagttattggtgcccttc, SEQ ID NO:22) as primers.

(6) The above 5 fragments were ligated using Clonexpress II MultiS One Step Cloning Kit (Nanjing Novowed Biotechnology Co., Ltd.) to construct pXMJ19-tet-rpiB-xylA plasmid.

(7) With reference to the literature (Ruan, Y., Zhu, L., Li, Q.,2015., Improving the electrophoresis-transformation efficiency of Corynebacterium glutamicum by fermentation cell and incubation of the cytoplastic membrane fluidity, Biotechnol. Lett.37,2445-2452.), competent cells of C.glutamicum ATCC 13032. delta. adhE. aldeDeltarpiB (pXMJ19-xylA, pEC-XK99E-mdh-hps-phi) MX1 were prepared, and the above-mentioned pXMJ 5-tet-iB-xylA plasmid was transformed into the C.glutamicum 13032. delta. adherE. aldeDeltaHphB (pXMJ19-xylA, pEC-XK 99E-mdh-hps-phi. MX), and the strain was constructed by constructing pXMJ 5-tet-dhidH-Xyla A (pXMJ 5-xylA-75-Xkl. Alphb, pXMJ-78-Xylo. E. Pat. E. TM. E.10-Hphb, ATCC # 78-Xylol-pHj-Xylol-pHi (pXMJ-Xylol-pHmXylol-pHj-MX.31, pXM-78).

Example 7 comparison of methanol utilization efficiency

To compare the methanol utilization efficiency, the applicant carried out the following steps:

(1) strains C.glutamicum ATCC 13032. delta. adhE. delta. ald. rpiB (pXMJ19-xylA, pEC-XK99E-mdh-hps-phi) MX1 and C.glutamicumeMCC 13032. delta. adhE. delta. ald (pXMJ19-xylA, pEC-XK99E-mdh-hps-phi) were cultured using CGXII medium without glucose, supplemented with 125mM methanol, 26.6mM xylose, 1mM Isopropylthiogalactoside (IPTG), 5mg/L chloramphenicol and 25mg/L kanamycin, respectively. CGXII medium formulations are described in the literature (Keilhauer, C., egg, L., Sahm, H.,1993.Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J. bacteriol.175, 5595-5603). The culture temperature is 30 ℃, the rotating speed of a shaking table is 220rpm, the shaking bottle is 250mL, the liquid loading capacity is 50mL, and the shaking bottle is sealed by using an airtight sealing film.

(2) Sampling is carried out at regular time, and the concentration of the residual methanol and xylose in the culture solution is detected. The method for detecting the concentration of the methanol and the xylose comprises the following steps: a high-speed liquid chromatograph (Shimadzu research UFLC) from Shimadzu and an Aminex HPX-87H column (300X 7.8mM) from Bio-Rad were used, the column temperature was 55 ℃, the detector was a differential refractometer, the detector temperature was 55 ℃, and the mobile phase was 5mM H₂SO₄The flow rate was 0.5mL/min, and the amount of sample was 10. mu.L. Before the injection detection, the culture broth samples were centrifuged at 12,000 Xg for 10 minutes, and the supernatant was used for detection.

(3) When the concentration of methanol and xylose in the culture solution did not decrease any more, the culture was stopped. The consumption of methanol and xylose by the strain was calculated and the results are shown in table 1.

TABLE 1 consumption of methanol and xylose by different strains

By adopting the method, the ribose phosphate isomerase gene rpiB is knocked out, the downstream transformation path of Ru5P is blocked, the molar utilization ratio of the engineering strain to methanol and an auxiliary carbon source is improved from 0.59:1 to 3.83:1 by about 6.5 times, and the maximum methanol utilization speed of unit thalli is improved from 0.12 mmol/gCDW.h to 0.86 mmol/gCDW.h by about 7.2 times. Compared with the highest index of the prior art (methanol to glucose molar ratio of 1.45:1), the invention is improved by about 2.64 times. Under the condition of the utilization rate of the converted carbon atoms, the highest level of the prior art is 0.24:1, while the level of the invention can reach 0.766:1, which is improved by about 3.19 times. Therefore, the method can obviously improve the utilization efficiency of the strain to the methanol, and has important application value.

Example 8 analysis of methanol utilization efficiency at high methanol concentration

(1) Strain c. glutamicum ATCC13032 Δ adhE Δ ald Δ rpiB (pXMJ19-xylA, pEC-XK99E-mdh-hps-phi) MX1 was cultured using CGXII medium without glucose, supplemented with 468.8mM methanol, 28.2mM xylose, 1mM Isopropylthiogalactoside (IPTG), 5mg/L chloramphenicol, and 25mg/L kanamycin. CGXII medium formulations are described in the literature (Keilhauer, C., egg, L., Sahm, H.,1993.Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J. bacteriol.175, 5595-5603). The culture temperature is 30 ℃, the rotating speed of a shaking table is 220rpm, the shaking bottle is 250mL, the liquid loading capacity is 50mL, and the shaking bottle is sealed by using an airtight sealing film.

(3) When the concentration of methanol and xylose in the culture solution did not decrease any more, the culture was stopped. The consumption of methanol and xylose by the strain was calculated: the total consumption of methanol is 203.2mM, the consumption of xylose is 28.2mM, the consumption of methanol is 7.2:1, and the maximum methanol consumption rate per cell reaches 2.45 mmol/gCDW.h.

Compared with the highest index of the prior art (methanol to glucose molar ratio of 1.45:1), the invention is improved by about 4.97 times. Under the condition of the utilization rate of the converted carbon atoms, the highest level of the prior art is 0.24:1, while the level of the invention can reach 1.44:1, which is improved by about 6 times. Therefore, the method can obviously improve the utilization efficiency of the strain to the methanol, and has important application value.

Example 9 cultivation of Corynebacterium glutamicum using methanol as carbon Source

(1) The strain C.glutamicum MEOH-1 was cultured using CGXII medium without glucose, with the addition of 50mM methanol, 1mM isopropyl thiogalactoside (IPTG), 0.5mg/L tetracycline and 15mg/L kanamycin. CGXII medium formulations are described in the literature (Keilhauer, C., egg, L., Sahm, H.,1993.Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J. bacteriol.175, 5595-5603). The culture temperature is 30 ℃, the rotating speed of a shaking table is 220rpm, the shaking bottle is 250mL, the liquid loading capacity is 50mL, and the shaking bottle is sealed by using an airtight sealing film. Upon cultivation, it was observed that the strain C.glutamicmemOH-1 could grow and the amount of methanol in the culture liquid was reduced.

(2) The strain C.glutamicum MEOH-1 was cultured in batch in a fermenter, using glucose-free CGXII medium, with the addition of 1mM Isopropylthiogalactoside (IPTG), 0.5mg/L tetracycline and 15mg/L kanamycin, and the CGXII medium formulation was referred to (Keilhauer, C., Eggeling, L., Sahm, H.,1993. Isooleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J.Bacteriol.175, 5595-5603). Inoculating the strain C.glutamcum MEOH-1 into a fermentation tank containing the culture medium, adopting a DO-STAT control strategy, automatically regulating and controlling the addition amount of a methanol solution according to the dissolved oxygen change in the fermentation tank, controlling the concentration of methanol in the fermentation tank to be at a critical concentration which is close to 0g/L, and enabling the strain C.glutamcum MEOH-1 to grow continuously.

Example 10 mutation of different enzymes enhances methanol bioconversion ability of strains

The whole genome of C.glutamicum MEOH-1 obtained in example 6 above was sequenced, and some of the genes were found to have mutations, as shown in the following table. Through functional verification of the mutations, the mutations are found to improve the methanol biotransformation capability of the strain.

In addition, based on the construction concept of the methanol bioconversion strain provided by the invention, it is obvious for those skilled in the art to adopt the concept of the invention, that is, to adopt the same concept in other strains to construct the methanol bioconversion strain and carry out the bioconversion of methanol, such as weakening the activity of ribose phosphate isomerase in escherichia coli, enhancing xylose isomerase activity, and introducing ribulose monophosphate pathway to carry out adaptive evolution on the strains; or weakening the activity of ribose phosphate isomerase in a strain (such as bacillus subtilis) containing ribulose monophosphate pathway, enhancing the activity of xylose isomerase and carrying out adaptive evolution on the strain.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> construction method of methanol bioconversion strain, constructed strain and application

<130>P2018-0564

<160>31

<170>PatentIn version 3.5

<210>1

<211>57

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gaaacagaat taattaagct tccaaaggag ttgagaatgc aagcctattt tgaccag 57

<210>2

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

caaaacagcc aagctgaatt cttatttgtc gaacagataa tggttt 46

<210>3

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gagctcggta cccggggatc cctcattccg tttcgcagca t 41

<210>4

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ggtgcgattc cgtggtctgc tccaaggtat ac 32

<210>5

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gcagaccacg gaatcgcacc tgtcgttcct aa 32

<210>6

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

caggtcgact ctagaggatc caccagacac aaaatcagca gaagta 46

<210>7

<211>58

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ataacaattt cacacaggcc aaaggagttg agaatgaaag cagcagtagt taacgaat 58

<210>8

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ggatccccgg gtaccgagct ctcaatcctc cttcaatttt agtacg 46

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cggtacccgg ggatcctcta 20

<210>10

<211>24

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

cctgtgtgaa attgttatcc gctc 24

<210>11

<211>101

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

aatgagagct cggtacccgg gttgacattg attaatccat gtgctataat ggactagtgc 60

aaggagatat agatatggaa cttcaattag ctctagattt g 101

<210>12

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

cgactctaga ggatccccgg gctactcaag attagcatgt cttccgt 47

<210>13

<211>58

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

gaaacagaat taattaagct tccaaaggag ttgagaatgc gcgtatacct tggagcag 58

<210>14

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

tgcattctca actcctttgg ttattcgtta ggaacgacag gtgcg 45

<210>15

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ctgtcgttcc taacgaataa ccaaaggagt tgagaatgca ag 42

<210>16

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

aaaacagcca agctgaattc ttatttgtcg aacagataat ggtttac 47

<210>17

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

caggagctaa ggaagctaaa cagggttatt gtctcatgag cggat 45

<210>18

<211>38

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

gcaccaataa ctgccttaaa tcaggtcgag gtggcccg 38

<210>19

<211>28

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

tttagcttcc ttagctcctg aaaatctc 28

<210>20

<211>26

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

aagcttaatt aattctgttt cctgtg 26

<210>21

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

gaattcagct tggctgtttt ggc 23

<210>22

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

tttaaggcag ttattggtgc ccttc 25

<210>23

<211>279

<212>PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>23

Met Ile Pro Ala Ser Ser Gln Glu Lys Arg Arg Glu Arg Ile Val Ser

1 5 10 15

Tyr Val Thr Arg His Gly Phe Ala Arg Val Glu Ala Leu Ala Glu Leu

20 25 30

Phe Glu Val Ser Ala Met Thr Ile His Arg Asp Leu Glu Ala Leu Ala

35 40 45

Ala Asp Asn Leu Val Glu Arg Ile Arg Gly Gly Ala Arg Ser Val Ser

50 55 60

Pro Ser Met Ser Glu Leu Ala Val Glu Gln Arg Arg His Leu His Arg

65 70 75 80

Thr Val Lys Glu Ala Leu Cys Thr Ala Ala Ala Arg Leu Ile Pro Glu

85 90 95

Gly Ala Val Val Ala Ile Asp Asp Ser Thr Thr Leu Glu Ser Leu Val

100 105 110

Glu Lys Leu Pro Gln Arg Ser Pro Ser Ala Leu Ile Thr His Ser Leu

115 120 125

Lys Thr Met Ala Asp His Arg Val Arg Ala Gly Met Ser Asp Ile Arg

130 135 140

Leu Ile Ala Cys Ala Gly Leu Tyr Phe Ala Glu Thr Asp Ser Phe Leu

145 150 155 160

Gly Lys Ala Thr Ser Ala Gln Leu Asn Glu Leu Ser Ala Asp Ile Ser

165 170 175

Phe Val Ser Thr Thr Ala Val Arg Ala Thr Gly Glu Val Pro Ala Leu

180 185 190

Phe His Pro Asp Met Glu Ala Ala Asp Thr Lys Arg Ala Leu Ile Gly

195 200 205

Ile Gly Ser Val Arg Val Leu Val Val Asp Ser Ser Lys Phe Gly Ser

210 215 220

Ala Gly Val Phe Lys Val Ala Ser Ile Glu Glu Phe Asp His Ile Ile

225230 235 240

Ile Asp Gln Gln Cys Thr Arg Glu Gln Arg Asp Leu Leu Arg Asn Ser

245 250 255

Arg Ala Gln Ile His Val Ile Asp His Asn Gly Asp Glu Ile Leu Asp

260 265 270

Thr Pro Thr Glu Glu Asp Phe

275

<210>24

<211>507

<212>PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>24

Met Ala Leu Gly Arg Thr Ile Ser Thr Ala Gln Leu Gly Val Gln Ala

1 5 10 15

Lys Ile Val Arg Val Glu Ala Asn Val Gly Pro Gly Leu Pro Gly Thr

20 25 30

Tyr Ile Val Gly Leu Ala Asp Thr Ala Ile Ser Glu Ser Arg Asp Arg

35 40 45

Ile Lys Thr Ala Val Gln Asn Ser Gly Leu Met Trp Pro Lys Thr Lys

50 55 60

Val Ile Ile Asn Leu Ser Pro Ala Ser Met Arg Lys Gln Gly Ser Gln

65 70 75 80

Cys Asp Leu Ala Met Thr Val Ala Val Leu Val Ala His Gly Ser Asn

85 90 95

Pro Lys Ala Lys Phe His Ala Gln Asn Thr Leu Phe Leu Gly Glu Val

100 105 110

Ala Leu Asp Gly Thr Leu Leu Pro Val Thr Gly Val Leu Pro Ala Leu

115 120 125

Leu Ala Ala Lys Glu Glu Gly Ile Gly Lys Ile Val Ile Pro Glu Gly

130 135 140

Asn Ala Gln Glu Ala Gly Leu Val Glu Asp Pro Ser Val Phe Leu Ala

145 150 155 160

His Ser Ile Asp Gln Val Leu Arg Trp Leu Asp Gly Glu Glu Ala Leu

165 170 175

Pro Gln Pro Gly Leu Phe Asn Asp Glu Asn Ser Leu Lys Leu Pro Asp

180 185 190

Met Arg Asp Val Val Gly Gln Pro Glu Ala Arg Phe Ala Ala Glu Val

195 200 205

Ala Ala Ala Gly Gly His His Met Leu Met Ile Gly Pro Pro Gly Ser

210 215 220

Gly Lys Ser Met Ile Ala Glu Arg Ile Pro Ser Leu Leu Pro Glu Leu

225 230 235 240

Ser Pro Gln Gln Met Ile Glu Ala Thr Ala Val His Ser Val Val Gly

245 250 255

Arg Thr Phe Ser Gly Pro Val Ser Arg Ala Pro Phe Ile Ser Pro His

260 265 270

His Asn Val Ser Lys Ala Ala Leu Leu Gly Gly Gly Ser Gly Ser Pro

275 280 285

Leu Pro Gly Ala Ile Ser Leu Ala His His Gly Val Leu Phe Leu Asp

290 295 300

Glu Val Ser Glu Ile Pro Ala Ser Ile Leu Asp Ser Leu Arg Thr Pro

305 310 315 320

Leu Glu Tyr Gly Ser Ile Arg Ile Ile Arg Ser Arg His Asp Val Thr

325 330 335

Phe Pro Ala Gln Phe Gln Leu Ile Leu Ala Ala Asn Pro Cys Arg Cys

340 345 350

Gly Ala Glu Gln Pro Gln Glu Cys Val Cys Ser Gly Ser Ala Arg Ala

355 360 365

Thr Tyr Leu Asn Asn Leu Ser Gly Pro Leu Arg Asp Arg Leu Asp Met

370 375 380

Val Val Ala Thr His Ser Lys Gly Ala Val Leu Arg Ser Asp Asp Val

385 390 395 400

Glu Ala Ser Ala Pro Ile Ala Asp Arg Val Ala Gln Ala Arg Glu Arg

405 410 415

Ala Ala Phe Arg Trp Arg Arg Ser Gly Leu Gly Asn Leu Val Asn Ala

420 425 430

His Val Asp Pro His Phe Leu Arg Arg Asn Phe Ala Ala Thr Glu Asp

435 440 445

Ala Met Val Tyr Leu Gly Ala Phe Leu Ala Glu Gly Thr Ile Ser Gln

450 455 460

Arg Gly Cys Asp Arg Ala Ile Lys Leu Gly Trp Thr Leu Cys Asp Leu

465 470 475 480

Asp Gly Glu Gln Gln Pro Asn Leu Asp His Ile Ala Arg Ala Met Glu

485 490 495

Leu Arg Gly Thr Thr Tyr Ser Glu Val Ala Ala

500 505

<210>25

<211>205

<212>PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>25

Met Thr Ser Ala Val Gly Asn Thr Gly Met Ala Ala Pro Gln Arg Val

1 5 10 15

Ala Ala Leu Asn Arg Pro Asn Met Val Ser Val Gly Thr Ile Val Phe

20 25 30

Leu Ser Gln Glu Leu Met Phe Phe Ala Gly Leu Phe Ala Met Tyr Phe

35 40 45

Val Ser Arg Ala Asn Gly Leu Ala Asn Gly Ser Trp Gly Glu Gln Thr

50 55 60

Asp His Leu Asn Val Pro Tyr Ala Leu Leu Ile Thr Val Ile Leu Val

65 70 75 80

Ser Ser Ser Val Thr Cys Gln Phe Gly Val Phe Ala Ala Glu Arg Gly

85 90 95

Asp Val Tyr Gly Leu Arg Lys Trp Phe Leu Val Thr Ile Ile Leu Gly

100 105 110

Ser Ile Phe Val Ile Gly Gln Gly Tyr Glu Tyr Ile Thr Leu Val Gly

115 120 125

His Gly Leu Thr Ile Gln Ser Ser Val Tyr Gly Ser Ala Phe Phe Ile

130 135 140

Thr Thr Gly Phe His Ala Leu His Val Ile Ala Gly Val Met Ala Phe

145 150 155 160

Val Val Val Leu Met Arg Ile His Lys Ser Lys Phe Thr Pro Ala Gln

165 170 175

Ala Thr Ala Ala Met Val Val Ser Tyr Tyr Trp His Phe Val Asp Val

180 185 190

Val Trp Ile Gly Leu Phe Ile Thr Ile Tyr Phe Ile Gln

195 200 205

<210>26

<211>437

<212>PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>26

Met Pro Lys Tyr Asp Asn Ser Asn Ala Asp Gln Trp Gly Phe Glu Thr

1 5 10 15

Arg Ser Ile His Ala Gly Gln Ser Val Asp Ala Gln Thr Ser Ala Arg

20 25 30

Asn Leu Pro Ile Tyr Gln Ser Thr Ala Phe Val Phe Asp Ser Ala Glu

35 40 45

His Ala Lys Gln Arg Phe Ala Leu Glu Asp Leu Gly Pro Val Tyr Ser

50 55 60

Arg Leu Thr Asn Pro Thr Val Glu Ala Leu Glu Asn Arg Ile Ala Ser

65 70 75 80

Leu Glu Gly Gly Val His Ala Val Ala Phe Ser Ser Gly Gln Ala Ala

85 90 95

Thr Thr Asn Ala Ile Leu Asn Leu Ala Gly Ala Gly Asp His Ile Val

100 105 110

Thr Ser Pro Arg Leu Tyr Gly Gly Thr Glu Thr Leu Phe Leu Ile Thr

115 120 125

Leu Asn Arg Leu Gly Ile Asp Val Ser Phe Val Glu Asn Pro Asp Asp

130 135 140

Pro Glu Ser Trp Gln Ala Ala Val Gln Pro Asn Thr Lys Ala Phe Phe

145 150 155 160

Gly Glu Thr Phe Ala Asn Pro Gln Ala Asp Val Leu Asp Ile Pro Ala

165 170 175

Val Ala Glu Val Ala His Arg Asn Ser Val Pro Leu Ile Ile Asp Asn

180 185 190

Thr Ile Ala Thr Ala Ala Leu Val Arg Pro Leu Glu Leu Gly Ala Asp

195 200 205

Val Val Val Ala Ser Leu Thr Lys Phe Tyr Thr Gly Asn Gly Ser Gly

210 215 220

Leu Gly Gly Val Leu Ile Asp Gly Gly Lys Phe Asp Trp Thr Val Glu

225 230 235 240

Lys Asp Gly Lys Pro Val Phe Pro Tyr Phe Val Thr Pro Asp Ala Ala

245 250 255

Tyr His Gly Leu Lys Tyr Ala Asp Leu Gly Ala Pro Ala Phe Gly Leu

260 265 270

Lys Val Arg Val Gly Leu Leu Arg Asp Thr Gly Ser Thr Leu Ser Ala

275 280 285

Phe Asn Ala Trp Ala Ala Val Gln Gly Ile Asp Thr Leu Ser Leu Arg

290 295 300

Leu Glu Arg His Asn Glu Asn Ala Ile Lys Val Ala Glu Phe Leu Asn

305 310 315 320

Asn His Glu Lys Val Glu Lys Val Asn Phe Ala Gly Leu Lys Asp Ser

325 330 335

Pro Trp Tyr Ala Thr Lys Glu Lys Leu Gly Leu Lys Tyr Thr Gly Ser

340 345 350

Val Leu Thr Phe Glu Ile Lys Gly Gly Lys Asp Glu Ala Trp Ala Phe

355 360 365

Ile Asp Ala Leu Lys Leu His Ser Asn Leu Ala Asn Ile Gly Asp Val

370 375 380

Arg Ser Leu Val Val His Pro Ala Thr Thr Thr His Ser Gln Ser Asp

385 390 395 400

Glu Ala Gly Leu Ala Arg Ala Gly Val Thr Gln Ser Thr Val Arg Leu

405 410 415

Ser Val Gly Ile Glu Thr Ile Asp Asp Ile Ile Ala Asp Leu Glu Gly

420 425 430

Gly Phe Ala Ala Ile

435

<210>27

<211>226

<212>PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>27

Met Ser Gln Lys Ile Leu Val Val Asp Asp Asp Pro Ala Ile Ser Glu

1 5 10 15

Met Leu Thr Ile Val Leu Ser Ala Glu Gly Phe Asp Thr Val Ala Val

20 25 30

Thr Asp Gly Ala Leu Ala Val Glu Thr Ala Ser Arg Glu Gln Pro Asp

35 40 45

Leu Ile Leu Leu Asp Leu Met Leu Pro Gly Met Asn Gly Ile Asp Ile

50 55 60

Cys Arg Leu Ile Arg Gln Glu Ser Ser Val Pro Ile Ile Met Leu Thr

65 70 75 80

Ala Lys Thr Asp Thr Val Asp Val Val Leu Gly Leu Glu Ser Gly Ala

85 90 95

Asp Asp Tyr Val Asn Lys Pro Phe Lys Ala Lys Glu Leu Val Ala Arg

100 105 110

Ile Arg Ala Arg Leu Arg Ala Thr Val Asp Glu Pro Ser Glu Ile Ile

115 120 125

Glu Val Gly Asp Leu Ser Ile Asp Val Pro Ala His Thr Val Lys Arg

130 135 140

Asn Gly Ala Glu Ile Ser Leu Thr Pro Leu Glu Phe Asp Leu Leu Leu

145 150 155 160

Glu Leu Ala Arg Lys Pro Gln Gln Val Phe Thr Arg Glu Glu Leu Leu

165 170 175

Gly Lys Val Trp Gly Tyr Arg His Ala Ser Asp Thr Arg Leu Val Asn

180 185 190

Val His Val Gln Arg Leu Arg Ala Lys Ile Glu Lys Asp Pro Glu Asn

195 200 205

Pro Gln Ile Val Leu Thr Val Arg Gly Val Gly Tyr Lys Thr Gly His

210 215 220

Asn Asp

225

<210>28

<211>346

<212>PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>28

Met Ala Thr Glu Lys Phe Arg Pro Thr Leu Lys Asp Val Ala Arg Gln

1 5 10 15

Ala Gly Val Ser Ile Ala Thr Ala Ser Arg Ala Leu Ala Asp Asn Pro

20 25 30

Ala Val Ala Ala Ser Thr Arg Glu Arg Ile Gln Gln Leu Ala Ser Asp

35 40 45

Leu Gly Tyr Arg Ala Asn Ala Gln Ala Arg Ala Leu Arg Ser Ser Arg

50 55 60

Ser Asn Thr Ile Gly Val Ile Val Pro Ser Leu Ile Asn His Tyr Phe

65 70 75 80

Ala Ala Met Val Thr Glu Ile Gln Ser Thr Ala Ser Lys Ala Gly Leu

85 90 95

Ala Thr Ile Ile Thr Asn Ser Asn Glu Asp Ala Thr Thr Met Ser Gly

100 105 110

Ser Leu Glu Phe Leu Thr Ser His Gly Val Asp Gly Ile Ile Cys Val

115 120 125

Pro Asn Glu Glu Cys Ala Asn Gln Leu Glu Asp Leu Gln Lys Gln Gly

130 135 140

Met Pro Val Val Leu Val Asp Arg Glu Leu Pro Gly Asp Ser Thr Ile

145 150 155 160

Pro Thr Ala Thr Ser Asn Pro Gln Pro Gly Ile Ala Ala Ala Val Glu

165 170 175

Leu Leu Ala His Asn Asn Ala Leu Pro Ile Gly Tyr Leu Ser Gly Pro

180 185 190

Met Asp Thr Ser Thr Gly Arg Glu Arg Leu Glu Asp Phe Lys Ala Ala

195 200 205

Cys Ala Asn Ser Lys Ile Gly Glu Gln Leu Val Phe Leu Gly Gly Tyr

210 215 220

Glu Gln Ser Val Gly Phe Glu Gly Ala Thr Lys Leu Leu Asp Gln Gly

225 230 235 240

Ala Lys Thr Leu Phe Ala Gly Asp Ser Met Met Thr Ile Gly Val Ile

245 250 255

Glu Ala Cys His Lys Ala Gly Leu Val Ile Gly Lys Asp Val Ser Val

260 265 270

Ile Gly Phe Asp Thr His Pro Leu Phe Ala Leu Gln Pro His Pro Leu

275 280 285

Thr Val Ile Asp Gln Asn Val Glu Gln Leu Ala Gln Arg Ala Val Ser

290 295 300

Ile Leu Thr Glu Leu Ile Ala Gly Thr Val Pro Ser Val Thr Lys Thr

305 310 315 320

Thr Ile Pro Thr Ala Leu Ile His Arg Glu Ser Ile Ile Asn Ser Thr

325 330 335

Leu Arg Lys Lys Asp Gly Leu Pro Asn Glu

340 345

<210>29

<211>269

<212>PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>29

Met Ser Ile Pro Phe Ser Val Leu Gln Asp Tyr Leu Asp Leu Ile Ser

1 5 10 15

Pro Glu Ala Leu Pro Gln Ile Pro Gln Pro Pro Ala Pro Ala Pro Thr

20 25 30

Ala Pro Gln Leu Pro Pro Ala Pro Asp Pro His Ser Ile Glu Trp Pro

35 40 45

Ile Phe Pro Pro Asp Arg Ile Ser Ala Asn Gly Arg Arg Tyr Tyr Glu

50 55 60

Pro Gln Thr Arg Leu Glu Phe Met Arg Ile Tyr Thr Thr Leu Pro His

65 70 75 80

Gly Tyr Arg Gln Pro Phe Leu Lys Ala Asn Asn Ile Gly His Cys Thr

85 90 95

Val Arg Thr Trp Leu Ala Ala Ile Ser Thr Phe Ser Arg Leu Pro His

100 105 110

Ala Phe Asp Asp Ala His Arg Phe Gly Ile Glu Arg Thr Thr Pro Val

115 120 125

Asp Asp Val Thr Thr Leu Thr Ala Asp Asp Lys Arg Asp Leu Val Ile

130 135 140

Gly Tyr Leu Ala Gln Pro His Gly Gln GlyGln Gln Phe Leu Thr Phe

145 150 155 160

Tyr Gln Leu Arg Lys His Thr Ile Met Ala Trp Cys Ala Ala Met Thr

165 170 175

Asp Gly Asp Leu Asp Ala Asp Ile Ser Pro Arg Gln Ile Gly Leu Met

180 185 190

Thr Thr Arg Thr Val Val Glu Ile Val Arg Leu Arg His Met Ile Ala

195 200 205

Gln Gln Leu Glu Arg Ala Thr Ile Met Glu Asn Glu Tyr Leu Lys Glu

210 215 220

Ile Ala Ala Leu Lys Lys Glu Leu Ala His Tyr Lys Gln Lys Asp His

225 230 235 240

Gln Asn Gln Met Val Ile Asp Ile Leu Gly Lys Ala Ile Gly Thr Arg

245 250 255

Pro Asn Pro Gly Glu Gly Leu Asp Glu Glu Asp Ala Thr

260 265

<210>30

<211>232

<212>PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>30

Met Ile Pro Leu Gly Ile Ile His Gln Ile Leu Gln Pro Gly Glu Ala

1 510 15

Leu Leu Pro Tyr Ala Ile Val Gly Leu Val Ile Leu Leu Pro Ser Ser

20 25 30

Trp Leu Pro Arg Trp Ala Val Ala Val Leu Gly Glu Val Ser Leu Val

35 40 45

Pro Ala Val Val Phe Gly Gly Gly Phe Leu Leu Ile Pro Ser Met Phe

50 55 60

Leu Ile Gly Ser Ala Leu Val Arg Tyr Gly Val Val Asp Arg Ala Glu

65 70 75 80

Asn Ala Pro Arg Ala Met Gly Val Phe Phe Ala Val Ser Ala Ala Ile

85 90 95

Ala Ile Pro Thr Leu Ile Ile Gln Ala Arg Asp Ile Thr Ser Ser Gly

100 105 110

Phe Ser Ile Val Ser Thr Val Ala Gly Leu Ala Leu Gly Gly Val Tyr

115 120 125

Ile Ser Leu Val Leu Leu Ala Leu His Thr Pro Ile Arg Gly Ala Leu

130 135 140

Ala Ala Val Phe Ala Pro Leu Gly Arg Met Ala Leu Thr Asn Tyr Ile

145 150 155 160

Gly Ala Thr Ile Leu Met Leu Ile Gly Gly Leu Ile Val Asp Leu Pro

165 170175

His Ser Thr Ser Trp Thr Ala Thr Val Leu Leu Ala Ala Gly Ile Leu

180 185 190

Ile Ile Gln Glu Leu Leu Ser Ala Leu Trp Leu Arg His Tyr Thr Gln

195 200 205

Gly Pro Leu Gly Tyr Leu Trp Arg Trp Val Thr Trp Gly Ser Arg Ser

210 215 220

Pro Phe Leu Thr Arg Ser Ala Ser

225 230

<210>31

<211>495

<212>PRT

<213> Corynebacterium glutamicum (Corynebacterium glutamicum)

<400>31

Met Ser Ile Gly Phe Asp Arg Asp Leu Tyr Ile Lys Met Gln Ser Gln

1 5 10 15

His Ile Asn Glu Arg Arg Glu Gln Ile Gly Gly Lys Leu Tyr Leu Glu

20 25 30

Met Gly Gly Lys Leu Phe Asp Asp Met His Ala Ser Arg Val Leu Pro

35 40 45

Gly Phe Thr Pro Asp Asn Lys Ile Ala Met Leu Thr Glu Leu Lys Asp

50 55 60

Glu Leu Glu Ile Leu Val Ala Ile Asn Ala Lys Asp Leu Glu Arg Lys

6570 75 80

Lys Thr Arg Ala Asp Leu Asp Ile Ser Tyr Glu Glu Asp Val Leu Arg

85 90 95

Leu Ile Asp Val Phe Arg Glu Leu Gly Phe Leu Ala Glu His Val Val

100 105 110

Leu Thr Gln Leu Glu Asp Asp Asn Tyr Gln Ala Leu Ala Phe Lys Gln

115 120 125

Arg Leu Glu Arg Leu Gly Leu Lys Val Ala Val His Arg Val Ile Pro

130 135 140

Gly Tyr Pro Thr Asp Ala Arg Arg Ile Val Ser Glu Glu Gly Phe Gly

145 150 155 160

Ile Asn Glu Tyr Val Glu Thr Thr Arg Asn Leu Val Val Val Thr Ala

165 170 175

Pro Gly Pro Gly Ser Gly Lys Leu Ala Thr Cys Leu Ser Gln Ile Tyr

180 185 190

Gly Asp His Gln Arg Gly Ile Lys Ser Gly Tyr Ala Lys Phe Glu Thr

195 200 205

Phe Pro Ile Trp Asn Leu Pro Leu Glu His Pro Val Asn Leu Ala Tyr

210 215 220

Glu Ala Ala Thr Ala Asp Leu Asp Asp Ile Asn Ile Ile Asp Pro Phe

225 230 235 240

His Leu Ala Ala Tyr Asp Thr Lys Ala Thr Ser Tyr Asn Arg Asp Val

245 250 255

Glu Val Phe Pro Leu Leu Lys Thr Met Leu Glu Met Leu Ser Gly Ser

260 265 270

Ser Pro Tyr Lys Ser Pro Thr Asp Met Gly Val Asn Met Val Gly Ser

275 280 285

Ala Ile Ile Asp Asp Ala Ala Cys Gln Glu Ala Ala Arg Gln Glu Ile

290 295 300

Val Arg Arg Tyr Phe Lys Ala Leu Val Asp Glu Arg Arg Glu Glu Gln

305 310 315 320

Asp Asp Thr Ile Ser Ala Arg Ile Ala Ile Val Met Ser Lys Ala Gly

325 330 335

Cys Thr Val Glu Asp Arg Arg Val Val Ala Arg Ala Leu Asp Val Glu

340 345 350

Glu Ser Thr Gly Ala Pro Gly Cys Ala Ile Glu Leu Asn Asp Gly Arg

355 360 365

Leu Val Thr Gly Lys Thr Ser Glu Leu Leu Gly Cys Ser Ala Ala Met

370 375 380

Val Leu Asn Ala Leu Lys Glu Leu Ala Gly Ile Asp Arg Ser Val Asp

385 390395 400

Leu Leu Ser Pro Glu Ser Ile Glu Pro Ile Gln Ser Leu Lys Thr Gln

405 410 415

His Leu Gly Ser Arg Asn Pro Arg Leu His Thr Asp Glu Val Leu Ile

420 425 430

Ala Leu Ser Val Ser Ala Ala Asn Ser Glu Thr Ala Arg Arg Ala Leu

435 440 445

Asp Glu Leu Lys Asn Leu Arg Gly Cys Asp Val His Thr Thr Thr Ile

450 455 460

Leu Gly Ser Val Asp Glu Gly Ile Phe Arg Asn Leu Gly Val Leu Val

465 470 475 480

Thr Ser Glu Pro Lys Tyr Gln Arg Lys Ala Leu Tyr Arg Lys Arg

485 490 495

Claims

1. A method of constructing a methanol bioconversion strain, the method comprising the steps of:

2. The method of claim 1, wherein the enzyme associated with xylose metabolic pathway is xylose isomerase;

3. The method of claim 1 or 2, wherein the strain is Escherichia coli (Escherichia coli), Corynebacterium glutamicum (Corynebacterium glutamicum), Bacillus subtilis (Bacillus subtilis); corynebacterium glutamicum (Corynebacterium glutamicum) is preferred.

4. A high efficiency methanol bioconversion strain, said strain prepared by the steps of:

5. The strain of claim 4, wherein the enzyme associated with the xylose metabolic pathway is xylose isomerase;

6. The strain according to claim 4 or 5, wherein the strain is Escherichia coli (Escherichia coli), Corynebacterium glutamicum (Corynebacterium glutamicum), Bacillus subtilis (Bacillus subtilis), preferably Corynebacterium glutamicum (Corynebacterium glutamicum).

7. The high-efficiency methanol bioconversion strain is a strain preserved in the China general microbiological culture Collection center (CGMCC) No.15944 with the preservation number of CGMCC.

8. Use of a strain according to any one of claims 4 to 7 for the bioconversion of methanol and the utilization of methanol for the production of subsequent products.

9. A method for bioconversion of methanol, comprising bioconversion of methanol using the strain constructed by the construction method of any one of claims 1 to 3 or the strain of any one of claims 4 to 7.

10. A method for increasing the methanol bioconversion ability of a strain, comprising administering to said strain a composition comprising:

Chaperone active ATPase (Cgl2030) with mutation of amino acid 179 to S; and/or

Putative protein (Cgl1520) with amino acid 192 mutated to V; and/or