CN115721664A

CN115721664A - Application of bifidobacterium adolescentis in preparation of medicines for treating inflammation-related diseases

Info

Publication number: CN115721664A
Application number: CN202111011431.4A
Authority: CN
Inventors: 周安琪
Original assignee: Ruiwei Shenzhen Biotechnology Co ltd
Current assignee: Ruiwei Shenzhen Biotechnology Co ltd
Priority date: 2021-08-31
Filing date: 2021-08-31
Publication date: 2023-03-03
Also published as: WO2023029093A1

Abstract

The invention discloses an application of Bifidobacterium adolescentis (Bifidobacterium adolescentis) in preparing a medicament for treating inflammatory diseases. The invention also discloses application of the intestinal bacteria combination in preparing a medicament for treating and/or preventing inflammatory diseases, wherein the intestinal bacteria combination at least comprises Bifidobacterium adolescentis (Bifidobacterium adolescentis) and one or more different intestinal bacteria. The bifidobacterium adolescentis and the combination thereof with other intestinal bacteria and the metabolite thereof can regulate the immune homeostasis of a human body, thereby preventing and/or treating inflammation and/or related diseases caused by the inflammation.

Description

Application of bifidobacterium adolescentis in preparation of medicines for treating inflammation-related diseases

Technical Field

The invention belongs to the field of biological medicine, and particularly relates to application of Bifidobacterium adolescentis (Bifidobacterium adolescentis) in preparing a medicament for treating and preventing inflammation and/or related diseases caused by inflammation.

Background

Inflammation is a pathological condition caused by the stimulation of internal and external inflammatory factors and local injury to the body. Inflammation is the basis for the pathogenesis of a variety of chronic diseases, such as infectious diseases. Chronic inflammation can drive the processes of induction, promotion, malignant transformation, invasion and metastasis of cancer if the cause is not removed. In addition, the fatality rate of the related diseases caused by inflammation is high in the world, such as autoimmune diseases caused by chronic inflammation, tumors, aging, neurodegenerative or turbulent diseases, and pathogen or microorganism infection of bacteria, fungi, parasites, viruses, and the like. It can be said that all diseases are associated with inflammation and are caused by inflammatory reactions.

For example, the primary role of the immune system is to recognize and eliminate foreign antigens, which can lead to Autoimmune diseases (Autoimmune diseases) when the immune system falsely attacks the self-normal components. Autoimmune diseases refer to a group of diseases caused by the damage of self tissues, organs and even systems due to the immune response of the body to self antigens. It is estimated that about 7.6% to 9.4% of the population worldwide suffer from various types of autoimmune diseases. The annual cost of treating such diseases in the united states has exceeded $ 500 million. Systemic lupus erythematosus and rheumatoid arthritis are two typical diseases in autoimmune diseases, and in China, the prevalence rates of single and two diseases are 0.04% and 0.35% respectively. Autoimmune diseases are difficult to cure radically, and most patients need to take medicines for a long time or even for life.

As another example, alzheimer's Disease (AD) is a major dangerous neurodegenerative disease that endangers human health worldwide, and the disease mechanism has not been fully elucidated. However, recent progress and consensus are that infiltration, disturbance or imbalance of inflammatory cells or proinflammatory or anti-inflammatory factors in the brain, particularly infiltration, accumulation, disturbance or imbalance of T-lymphoid immune cells in the brain, are key causes of chronic lesions in brain nerves, marked pathological features such as amyloidosis and deposition of amyloid protein, and symptoms such as senile dementia. However, how to effectively control inflammatory infiltration and accumulation in the brain and thus prevent neurodegenerative diseases remains a major challenge.

In addition, aging is a systemic physiological process. However, inflammation and associated aging or degeneration of physiological functions caused by or accompanied by inflammation are currently considered to be the central immunological mechanisms of aging. How to control the aging process by effectively tuning inflammation is a major scientific question pending today.

In addition, immune system disorders play an important role in inflammation and/or related diseases caused by inflammation, and immune regulation gradually becomes a central link of pathogenesis. More and more researches show that under the pathological conditions of physiology and infection, inflammation such as tumor, transplantation immunity, autoimmune disease and the like and/or related diseases caused by inflammation, regulatory T cells (Tregs) exert immunosuppressive effect by releasing cytokines IL-10 and TGF-beta and reducing the production of inflammatory cytokines such as TNF-alpha.

At present, some important proinflammatory or inflammation-inhibiting factors become therapeutic targets of inflammation and related diseases. For example, tumor necrosis factor α (TNF- α) is a cytokine involved in systemic inflammation and autoimmune diseases. The research at present shows that a plurality of autoimmune diseases, inflammation and/or related diseases caused by inflammation are accompanied by abnormal up-regulation of TNF-alpha, and the antagonism of TNF-alpha can regulate the outcome of inflammation such as autoimmune diseases and the like and/or related diseases caused by inflammation. The current TNF-alpha targeted therapy has made significant progress in autoimmune diseases and other inflammatory and/or inflammatory-related diseases, such as adalimumab, which has been approved by the FDA in the United states, to alleviate joint damage in rheumatoid patients. However, some researches in recent years indicate that the long-term use of TNF-alpha targeting drugs can cause apoptosis of cells expressing TNF-alpha, so that adverse reactions such as severe infection, tuberculosis, pancytopenia, pulmonary fibrosis and the like are generated. Moreover, TNF- α targeted drugs are expensive to produce and expensive. Therefore, new comprehensive treatment means such as target treatment, immunotherapy and the like are found, and the research and development of the medicament which is safer, more effective, more economic, less in toxic and side effects and more convenient in administration mode is not easy.

Since the completion of the 2003 human genome project, many diseases that are predicted to be treatable have not made significant progress in the fields of treatment, prevention, and the like. The key factor is because recent scientific advances have begun to make clearer insights into the effects or control of human health and disease by microorganisms that are long-term coexisting with humans.

Human beings are poorly aware of the vast number of commensal microorganisms present in their own bodies. For example, only about 10 trillion bacteria are parasitic in the human intestinal tract. These groups supply nutrition to the human body, regulate metabolism, regulate the development of intestinal epithelium and induce innate immunity, and function as an important "organ" of the human body. Different strains can synthesize different vitamins necessary for human growth and development, and can also synthesize amino acids with protein residues, participate in the metabolism of saccharides and proteins, and simultaneously promote the absorption of mineral elements. These nutrients have an important health-promoting effect and, if they are lacking, they can cause various diseases. Since the Human Microbiome Project (HMP) was initiated in 2008 in the united states, the number and composition of microorganisms in 18 sites of the major 5-dimensional area of the Human body were analyzed by a systematic biology approach through a series of major actions in the field of microorganisms, and information on healthy Human body tables and all the microbiomes in the body was almost obtained, and it was found that different parts of the body had a great influence on the colonized microorganisms, which was much greater than the influence of the passage of time and individual differences.

Epigenetic refers to the stable and genetic change of gene expression profile or cell genotype caused by chromosome modification or remodeling without involving the change of nucleotide sequence of the gene, and the regulation and control modes mainly comprise DNA methylation, histone modification, chromosome modification or remodeling, non-coding RNA regulation and the like. During the occurrence of infectious inflammatory diseases, the epigenetics of the host can accurately and rapidly change the gene expression and regulate the immune response of organisms to microorganisms. Meanwhile, the bidirectional regulation relationship exists between host epigenetic regulation and intestinal microorganisms, and the intestinal bacteria can also play a decisive role in immune inflammatory reaction by regulating a specific host epigenetic mechanism. However, whether and how microorganisms in the human body exert epigenetic modification regulatory functions to achieve disease prevention and control is still not completely understood.

Long non-coding RNA (lncRNA) and micro RNA (miRNA) are the most important non-coding RNA family members and the most important gene and protein expression regulation and control modes, and play an important regulation and control role in the occurrence and development of inflammation and related diseases caused by inflammation like other epigenetic forms including DNA methylation, histone modification, chromatin modification or reconstruction and the like. Non-coding RNAs such as LncRNA and miRNA can also interact with other epigenetic forms, for example, lncRNA can regulate and control DNA methylation, histone modification, chromatin remodeling and other forms through various ways, and DNA methylation, chromatin remodeling and the like can also regulate and control the expression and function of non-coding RNAs such as lncRNA and miRNA; the complicated network relationship affects the occurrence and development of inflammation and/or related diseases caused by inflammation. However, it is still unknown whether and how microorganisms in humans control inflammation and inflammation-related disease processes or fates by epigenetic regulation via non-coding RNAs.

However, there are currently no reports of the use of epigenetically modified potent spatiotemporal regulatory functional enterobacteria for the treatment and prevention of autoimmune and/or inflammatory diseases.

Disclosure of Invention

The invention aims to provide a technical scheme capable of adjusting the immune homeostasis of a human body and further preventing and/or treating inflammation and/or related diseases caused by inflammation, aiming at solving the problem of the defects in the treatment of the inflammation and/or the related diseases caused by the inflammation at present.

In order to achieve the above object, the present invention provides the use of Bifidobacterium adolescentis (Bifidobacterium adolescentis) for the preparation of a medicament for the treatment and prevention of inflammation and/or associated diseases caused by inflammation.

Bifidobacterium adolescentis (Bifidobacterium adolescentis) is an intestinal bacterium with epigenetic modification and potent space-time regulation function. The epigenetic modification powerful space-time regulation function refers to the function that intestinal bacteria planted in the intestinal tract for a long time regulate and control effector molecules in the intestinal tract in an immunity long-time mode through epigenetic modes including but not limited to non-coding RNA modification, DNA modification and the like, and the effector molecules can also migrate to tissues with remote pathological changes to achieve the ectopic remote regulation and control effect. Wherein the epigenetic modification refers to one or more of noncoding RNA regulation, DNA modification, and protein modification. Non-coding RNA regulation includes, but is not limited to, long-chain non-coding RNA regulation, micro-RNA regulation. DNA modifications include, but are not limited to, histone modifications. Protein modifications include, but are not limited to, protein spatial structure modifications. Spatio-temporal regulation includes temporal regulation and spatial regulation. The time regulation function comprises but is not limited to that intestinal bacteria are planted in situ to continuously stimulate intestinal epithelial cells, so that the function of long-term immunity regulation is achieved. The spatial regulation function includes, but is not limited to, that intestinal bacteria and produced effector molecules enter the circulatory system and then migrate to the tissue with distal lesion, so as to achieve the effect of ectopic distal regulation.

Preferably, the bifidobacterium adolescentis is any one of the following: a clinically isolated strain of bifidobacterium adolescentis; bifidobacterium adolescentis subjected to gene recombination, modification or modification, attenuation, chemical treatment and physical treatment; a lysate of bifidobacterium adolescentis; and/or a culture supernatant of bifidobacterium adolescentis.

The invention also provides the use of a combination of intestinal bacteria comprising at least Bifidobacterium adolescentis (Bifidobacterium adolescentis) and one or more different intestinal bacteria for the manufacture of a medicament for the treatment and prevention of inflammation and/or associated diseases caused by inflammation.

Preferably, the different enterobacteria are selected from one or more of the following: parabacteroides gordonii (Parabacteroides goldsteinii), bifidobacterium infantis (Bifidobacterium infantis), exendiculum (Akkermansia spp.). For example, the enteric bacteria may be a combination of bifidobacterium adolescentis and parabacteroides gomerdae, a combination of bifidobacterium adolescentis and parabacteroides gomerdae and bifidobacterium infantis, a combination of bifidobacterium adolescentis and bifidobacterium infantis and icorma, a combination of bifidobacterium adolescentis and bifidobacterium incarnatum, a combination of bifidobacterium adolescentis and bifidobacterium infantis, a combination of bifidobacterium adolescentis and bifidobacterium gomerdae and bifidobacterium infantis and icorma.

The inventor researches and discovers that the enterobacteria have a powerful space-time regulation function of epigenetic modification and further influence the expression and secretion of proinflammatory or inflammation-inhibiting factors of a host so as to influence the outcome of inflammation and/or related diseases caused by inflammation.

The bifidobacterium adolescentis or the combination of the bifidobacterium adolescentis and the parabacteroides gordonii, the bifidobacterium infantis and the akmansia can improve social cognitive behavior state, improve spatial memory capacity and improve motor capacity so as to improve neurodegenerative or turbulent diseases including but not limited to alzheimer disease, autism and parkinson disease.

In addition, bifidobacterium adolescentis or its combination with Parabacteroides gomerdae, bifidobacterium infantis, and Ackermansia can improve survival rate, delay aging, and prolong life.

In addition, bifidobacterium adolescentis or a combination thereof with parabacteroides gordonii, bifidobacterium infantis and eckmann can regulate the expression of tight junction proteins including but not limited to intestinal tight junction protein (ZO-1), relieve inflammatory symptoms of intestinal tissues and repair intestinal barriers and intestinal functions.

The invention also provides application of the bifidobacterium adolescentis in preparing a medicament for regulating and controlling the expression of non-coding RNA of intestinal and parenteral distal tissues. Such non-coding RNAs include, but are not limited to, non-coding RNAs that modulate inflammatory diseases in and out of the gut. Bifidobacterium adolescentis can regulate dose-effect changes of non-coding RNA by participating in molecular processes including, but not limited to, shearing, processing, maturation, etc. of non-coding RNA. The molecular processes of shearing, processing and maturation of RNA include but are not limited to the molecular processes of shearing, processing and maturation involved in Dicer enzyme. The non-coding RNA can bind to mRNA molecules including, but not limited to, foxp3 to affect its protein translation, ultimately modulating immune homeostasis, and thus control inflammation.

Such non-coding RNAs include, but are not limited to, microRNAs. Preferably, the microrna (miRNA-31) comprises a sequence consisting of the sequence set forth as SEQ ID NO:1 (AGGCAAGAUGCUGGCAUAGCU). Preferably, said microrna comprises a sequence consisting of a sequence identical to SEQ ID NO:1, or a nucleotide sequence having at least 95% homology thereto.

The invention also provides application of the intestinal bacterium combination in preparing a medicament for regulating expression of non-coding RNA, wherein the intestinal bacterium combination at least comprises bifidobacterium adolescentis and one or more different intestinal bacteria.

Preferably, the different enterobacteria are selected from one or more of the following: parabacteroides gordonii (Parabacteroides goldsteinii), bifidobacterium infantis (Bifidobacterium infanis), exxoplasma (Akkermansia spp.).

In addition, the invention also provides application of the metabolite of the bifidobacterium adolescentis in preparing a medicament for treating inflammation-related diseases. The metabolite may be palmitoleic acid, or a derivative, modification, isomer, etc. of palmitoleic acid.

Furthermore, use of a metabolite of a combination of gut bacteria comprising at least bifidobacterium adolescentis and one or more different gut bacteria for the manufacture of a medicament for the treatment and/or prevention of inflammation related diseases. The metabolite may be palmitoleic acid, or a derivative, modification, isomer, etc. of palmitoleic acid. Preferably, the different enterobacteria are selected from one or more of the following: parabacteroides gomerdae, bifidobacterium infantis, ackermansia.

The invention also provides a pharmaceutical composition, which comprises pharmaceutically effective dose of Bifidobacterium adolescentis (Bifidobacterium adolescentis) and a pharmaceutically acceptable carrier. The pharmaceutical composition may further comprise one or more additional different enterobacteria selected from one or more of the following: parabacteroides gordonii (Parabacteroides goldsteinii), bifidobacterium infantis (Bifidobacterium infanis), exxoplasma (Akkermansia spp.).

The invention also provides a pharmaceutical composition, which comprises pharmaceutically effective dose of Bifidobacterium adolescentis (Bifidobacterium adolescentis) metabolite and pharmaceutically acceptable carrier. Preferably, the metabolite is a long chain fatty acid, in particular palmitoleic acid.

The long chain fatty acid (e.g. palmitoleic acid) may be any one or more of the following: stereoisomers, tautomers, geometric isomers, nitroxides, hydrates, solvates, metabolites, pharmaceutically acceptable salts or prodrugs of long chain fatty acids.

The salts include acidic or basic inorganic or organic salts.

The acidic inorganic salt includes hydrochloride, sulfate, phosphate, nitrate, carbonate, borate, sulfamate, or hydrobromide. The basic salt comprises sodium salt, potassium salt, lithium salt, magnesium salt, calcium salt or ammonium salt.

The organic salt includes acetate, propionate, butyrate, tartrate, maleate, hydroxymaleate, fumarate, citrate, lactate, mucate, gluconate, benzoate, succinate, oxalate, phenylacetate, methylsulfonate, p-toluenesulfonate, benzenesulfonate, p-aminosalicylate, aspartate, glutamate, edetate, stearate, palmitate, oleate, laurate, tannate, ascorbate, valerate or alkylammonium salt.

The metabolites including but not limited to the above metabolite forms can regulate immune homeostasis of distal tissues, thereby relieving inflammation and preventing and treating inflammation-related diseases. Immune responses include, but are not limited to, immune responses in which gut bacteria modulate the expression of non-coding RNAs or spatial potency resulting in a quantitative-effect change in regulatory T cells (tregs) equivalent to a subpopulation of T cells. The inflammation includes, but is not limited to, the destruction of the extra-intestinal tissues such as intestine, liver, brain, kidney, lung and brain and the like and (or) hemorrhage and (or) infiltration of inflammatory cells such as neutrophils and the like induced by the change of effector T cell subsets such as Treg and the like, tumors, aging, metabolic disorders, neurodegenerative diseases or turbulent diseases caused by inflammation, and diseases such as pathogen or microorganism infection such as bacteria, fungi, parasites, viruses and the like.

The enterobacteria and/or metabolites thereof can modulate signals including but not limited to type I interferon to regulate the proliferation and development of intestinal epithelial cells. Proliferation or repair of intestinal epithelial cells includes, but is not limited to, proliferation or repair of intestinal epithelial cells such as Pangolin cells, goblet cells, and the like. Type I Interferon signals include, but are not limited to, expression of Interferon-Stimulated Gene (ISG), IFN- β, and like signaling molecules.

The intestinal bacteria and/or metabolites thereof can regulate the expression of tight junction proteins including but not limited to ZO-1 and the like to repair intestinal barrier and intestinal function.

The combination of the enteric bacteria or the composition and the metabolite can regulate and control the expression of tight junction protein such as ZO-1 and the like so as to repair intestinal barriers and intestinal functions, maintain the development and the intestinal functions of intestines, relieve intestinal inflammation, repair intestinal function damage and prevent systemic inflammation and related diseases. Intestinal barriers include, but are not limited to, intestinal mucosal epithelial cells.

Preferably, the pharmaceutical composition is a tablet, a capsule, an oral liquid or a lyophilized powder.

Preferably, the pharmaceutical composition is formulated for oral administration, rectal administration, or delivery to the colon.

Preferably, the pharmaceutical composition further comprises a pH sensitive composition comprising one or more enteric polymers.

Preferably, the pharmaceutically acceptable carrier includes, but is not limited to, skim milk, lactose, glucose, sucrose, sorbitol, mannose, trehalose, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, fine crystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, or a combination of one or more of mineral oil.

The inflammation includes, but is not limited to, the expression and/or spatial change of histone (EZH 2) in the promoter region of IFN-gamma equivalent response factor results in CD3+ ⁺ CD4 ⁺ IFN-γ ⁺ And/or CD3 ⁺ CD8 ⁺ IFN-γ ⁺ Intestinal and extra-intestinal tissue destruction and/or bleeding and/or neutrophils induced by changes in dose-effect function of effector T cell subsetsInflammatory cell infiltration such as cell, tumor caused by inflammation, aging, alzheimer disease, autism, and neurodegenerative or disordered diseases such as Parkinson disease.

The inflammation includes, but is not limited to, diseases such as tumor, aging, neurodegenerative or disorder diseases such as Alzheimer's disease, autism, parkinson's disease, etc. caused by the destruction and/or bleeding of extra-intestinal tissues such as intestine, liver, brain, kidney, lung, and brain and/or infiltration of inflammatory cells such as neutrophils and inflammation due to the change of the dose-and-effect function of anti-inflammatory factors caused by the expression and/or spatial change of histone (EZH 2) in the promoter region.

The inflammation includes, but is not limited to, one or more diseases from the group of acute or chronic organ transplant rejection, graft versus host disease, inflammatory bowel disease, inflammatory skin disease, multiple sclerosis, arteriosclerosis, pancreatitis, acute bronchitis, chronic bronchitis, acute bronchiolitis, folliculitis, chronic bronchiolitis, osteoarthritis, gout, spondyloarthropathy, reiter's syndrome, psoriatic arthropathy, and a combination of inflammations caused by bacterial, fungal, viral infections.

Inflammation-related disorders include, but are not limited to, inflammatory symptoms resulting from autoimmune diseases. The autoimmune disease includes but is not limited to one or more of lupus erythematosus, hyperthyroidism, igA nephritis, type I or type II diabetes and its complications, xerophthalmia, rheumatoid arthritis, simple obesity, ankylosing spondylitis, bronchial asthma, neurodermatitis, ulcerative colitis, canker sores, psoriasis, vitiligo, behcet's disease, autoimmune iridocyclitis, autoimmune eczema, autoimmune uveitis, autoimmune conjunctivitis, autoimmune dry eye, autoimmune glaucoma, autoimmune cataract, allergic rhinitis, irritable bowel syndrome, and skin pruritus.

The related diseases caused by inflammation include, but are not limited to, one or more neurodegenerative diseases or turbulent diseases in Alzheimer's disease caused by inflammation, atherosclerosis, dermatitis, diverticulitis, fibromyalgia, hepatitis, irritable bowel syndrome, nephritis, parkinson's disease, tumors caused by chronic inflammation, and aging caused by chronic inflammation. The tumor caused by the chronic inflammation includes but is not limited to melanoma, or tumors related to breast, liver, lung, skin, oral cavity, esophagus, stomach, intestinal tract, kidney, prostate, brain, nervous system, bladder, lymph, pancreas, etc., in particular digestive tract tumors, such as intestinal tract tumors.

Drawings

Figure 1 shows the results of a comparison of social behavior index of enterobacteria treated and control mice.

FIG. 2 shows the results of comparing the spatial memory capacity of mice in the enterobacterial-treated group with those in the control group.

Fig. 3 shows the results of comparing the survival rates of mice in the enterics-treated group and the control group.

Figure 4 shows the number of amyloid plaques in the brains of senile dementia mice.

Figure 5 shows that enterobacteria significantly reduced IFN- γ expression in CD4+ T cells and CD8+ T cells.

Figure 6 shows the results of an exponential comparison of the residence of enterobacteria-treated versus control mice at the central platform.

FIG. 7 is a score of inflammatory symptoms in colon after reconstitution of intestinal bacteria in mice model for ulcerative colitis.

Figure 8 shows enterobacteria down-regulating Dicer enzyme expression.

Figure 9 shows that the enterobacteria composition significantly down-regulated expression of miRNA-31.

Fig. 10 shows the palmitoleic acid content in the plasma of mice.

Figure 11 shows that palmitoleic acid down-regulates the expression of miRNA-31.

Figure 12 shows that miRNA-31 down-regulates Foxp3 expression.

FIG. 13 shows the effect of palmitoleic acid metabolized by enterobacteria on intestinal tissue ISG15 expression.

FIG. 14 shows the effect of palmitoleic acid metabolized by intestinal bacteria on intestinal tissue IFN- β expression.

FIG. 15 shows the effect of palmitoleic acid on intestinal tight junction protein (ZO-1) expression.

Figure 16 shows the effect of a. Muciniphila, palmitoleic acid on ZO-1 expression.

Figure 17 shows the effect of a. Muciniphila, enterobacteria and enterobacteria combinations on the increase of ZO-1 expression by palmitoleic acid.

Figure 18 shows the effect of palmitoleic acid on intestinal function impairment due to intestinal inflammation.

Figure 19 is a comparison of the length of the rectum to caecum site in DSS-induced ulcerative colitis model mice.

Figure 20 shows the effect of palmitoleic acid and intestinal bacteria on the pathological lesions of ulcerative colitis.

Figure 21 shows the effect of palmitoleic acid on intestinal tumor control caused by or associated with ulcerative colitis.

Detailed Description

The present invention is further illustrated by the following examples. It should be understood that the following examples are illustrative of the present invention only, and are not intended to limit the scope of the present invention. For the sake of brevity, specific steps of conventional technical procedures (e.g., RNA sequencing, flow cytometry detection, cytokine microsphere detection, northern blot hybridization, western blot, etc.) well known to those skilled in the art are not described in detail in the examples below, but it is understood that these procedures are well known to and can be performed by those skilled in the art.

In this example, the following 4 enterobacteria strains were selected for the study: bifidobacterium adolescentis (Bifidobacterium adolescentis), bacteroides gordonii (Parabacteroides goldsteinii), bifidobacterium infantis (Bifidobacterium infantis), and Exchemanella (Akkermansia spp.). The composition of intestinal bacteria (GB ID NO:1 Bifidobacterium adolescentis) and intestinal bacteria (GB ID NO:2 Bifidobacterium adolescentis/paragonium gordonii/Bifidobacterium infantis/Exxormacrobium; GB ID NO:3 Bifidobacterium adolescentis/Bifidobacterium gordonii; GB ID NO:4 Bifidobacterium adolescentis/Bifidobacterium infantis; GB ID NO:5 Bifidobacterium adolescentis/Exxormacrobium, GB ID NO:6 Bifidobacterium adolescentis/paragonimiabacterium gordonii/Bifidobacterium infantis, GB ID NO:7 Bifidobacterium adolescentis/paragonimiactium gordonii/Exxormacrobium, GB ID NO:8 Bifidobacterium adolescentis/Bifidobacterium infantis/ExxoplasmaMansonia) are described and should not be construed as limiting the invention. The administration amount of each enteric bacteria is 1x10 ⁹ And (4) CFU. These enterobacteria are all available in a commercially available manner, for example from the microbiological depository (such as ATCC, CGMCC) or any other agency that deposits/sells standard strains. The genus Akkermansia (Akkermansia spp.) referred to in the present invention may be, for example, akkermansia muciniphila (a. Muciniphila, a species of the genus Akkermansia), or other species of the genus.

The metabolites selected from the above mentioned enterobacteria and their strain mixtures include various dominant long chain fatty acid products, palmitoleic acid is one of them, and palmitoleic acid is taken as an example herein, however, the metabolites of the above mentioned enterobacteria or enterobacteria combinations include, but are not limited to palmitoleic acid, and further include fatty acids such as palmitic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, arachidonic acid, eicosapentaenoic acid, docosahexaenoic acid, and other high active metabolites of enterobacteria.

Step 1, there is now increasing evidence that cerebral nerve damage caused by chronic inflammation long-term stimulation is a main pathogenic factor of some neurodegenerative or turbulent diseases such as Alzheimer's disease (also known as Alzheimer's disease, AD, commonly known as senile dementia), patients with the diseases usually show symptoms such as cognitive impairment and memory deterioration, and therefore, the research explores whether enterobacteria or enterobacteria combination can play a role in relieving cognitive impairment and improving spatial memory. The BABL/c mice begin sexual maturation at about 1 month after birth, and the life span of the BABL/c mice can reach more than 2 years at most, so the 18-month-old mice observed in the research can be regarded as typical aging mice. 54 18-month-old BABL/c mice were purchased from the Experimental animals center, guangdong province. Randomly dividing mice into 9 groups, each group comprises 6 mice, respectively treating the mice with antibiotic water containing ampicillin (1 mg/ml), streptomycin (5 mg/ml) and colistin (1 mg/ml) for one week, after one week, one group of gavage normal saline is used as control, and the rest is respectively gavage enterobacteria 1x10 ⁹ CFU or intestinal bacteria combination with equal proportion (i.e. total amount of all intestinal bacteria in the intestinal bacteria combination is 1x 10) ⁹ CFU, proportion of intestinal bacteria1) and intragastrically every two days for 4 weeks.

And 2, after the gavage in the step 1 is finished, carrying out Morris water maze (water maze instrument model LZ-GZ-WM) experiment on the mouse to detect and evaluate the spatial memory capacity of the mouse. Water maze experiment procedure: (1) The trial lasted 6 days and was trained 4 times per day for a fixed period of time. The mouse platform was trained on day one, placed in the middle of the first quadrant from day one to day five, and the rat was placed into a 120cm diameter pool facing the pool wall from any of the four starting points of the pool wall. The free video recording system records the time when the mouse finds the platform and the swimming path. The 4 trains were performed by placing mice into the water from the starting point of each of the four quadrants. After the mouse found the platform or the platform could not be found within 60 seconds (the latency period is recorded as 60 seconds), the experimenter leads the mouse to the platform, and the experimenter rests on the platform for 10 seconds and then carries out the next experiment. Sometimes the mouse may be dropped from the platform before the 5 second interval has been reached or it may jump into the water to continue swimming once this occurs, the mouse is replaced back on the platform and the time interval is re-timed to 5 seconds. This ensures that each mouse has equal time to observe and acquire spatial information after each experiment; (2) The animals were removed and dried under electric heating and returned to their cages. Training each animal for 4 times every day, wherein the interval between two times of training is 20min; and (3) on the sixth day, the platform is removed. The original position of the platform is marked by a circular ring on a computer screen, so that the times of passing through the original position of the platform can be recorded. Then the platform puts the mouse into water at the water inlet point of the opposite side quadrant, records the swimming path of the mouse within 60s, records the times of the mouse passing through the platform of the target quadrant, and observes the space positioning capability of the tested mouse.

And 3, after the gavage in the step 1 is finished, carrying out a three-compartment social experiment (three-compartment social box LZ-GZ-CPP-M) experiment on the mouse to detect and evaluate the social behavior index of the mouse. Three-compartment social experiments: (1) Before the experiment begins, empty cages are placed at two sides of the box, an experimental mouse is placed in the middle box, the channel partition plate is opened, the video is recorded for ten minutes, and the time for the nose of the mouse to contact the two cages is recorded (the distance for the mouse to contact the cages is less than 3 cm); (2) One side of the box is provided with the same age and sex group of mice, the other side of the box is provided with the empty cage, the experimental mouse is placed in the middle box, the channel partition plate is opened, and the video recording is carried out for ten minutes; (3) One side of the box is provided with the same-age and same-sex group of mice, the other side of the box is provided with the same-age and same-sex strange mice, the laboratory mice are placed in the middle box, the channel partition is opened, and the video recording is carried out for ten minutes. Social behavioral indices of mice were assessed according to videotaping.

Step 4, purchasing 54 Alzheimer's Disease (AD) model mice from the experimental animal center of Guangdong province, randomly dividing the mice into 9 groups, adding a mixture of ampicillin (1 mg/ml), streptomycin (5 mg/ml) and colistin (1 mg/ml) into drinking water of each group of 6 and 6 groups of mice to eliminate background intestinal flora of the mice, and then dividing the mice into a physiological saline solution group, enema tract bacteria (GB ID NO:1 Bifidobacterium adolescentis) and an intestinal bacteria combination (GB ID NO:2 Bifidobacterium adolescentis/Bifidobacterium gordonii/Bifidobacterium infantis/genus Eremophilus, GB ID NO:3 Bifidobacterium adolescentis/Bifidobacterium gordonii, GB ID NO:4 Bifidobacterium adolescentis/Bifidobacterium infantis, GB ID NO:5 Bifidobacterium adolescentis/Bifidobacterium infantis, GB ID NO:6 Bifidobacterium adolescentis/Bifidobacterium gordonii/Bifidobacterium infantis, GB/Bifidobacterium adolescentis/Bifidobacterium infantis, GB ID NO:8 Bifidobacterium adolescentis/Bifidobacterium infantis, GB ID NO:8 Bifidobacterium adolescentis/Bifidobacterium infantis experimental on the background flora of the mice are obtained. After 3 months, the ethological differences of 9 groups of mice are analyzed, then 9 groups of mice are killed, one part of the brain tissues of the mice are taken to detect and quantitatively analyze the activity of the brain tissue Abeta cleavage enzyme, the amount of Abeta protein and the number of starch atheromatous sediment plates, and the other part of the brain tissues are used for detecting the expression of IFN-gamma in CD4+ T cells and CD8+ T cells by flow cytometry.

And 5, because the intestinal bacteria (GB ID NO:1 bifidobacterium adolescentis) and the intestinal bacteria combination (GB ID NO:2 bifidobacterium adolescentis/paragonium gordonii/bifidobacterium infantis/icosanum; GB ID NO:3 bifidobacterium adolescentis/parabacteroides gordonii; GB ID NO:4 bifidobacterium adolescentis/bifidobacterium infantis; GB ID NO:5 bifidobacterium adolescentis/icosanum; GB ID NO:6 bifidobacterium adolescentis/paragonium gordonii/bifidobacterium infantis; GB ID NO:7 bifidobacterium adolescentis/parabacteroides gordonii/bifidobacterium infantis; GB ID NO:8 bifidobacterium adolescentis/bifidobacterium infantis/icosanum) are found to improve the social behaviors of the mouse model in the step 4, the improvement of the social behaviors of the bifidobacterium adolescentis and the like on other disease models is further analyzed. For this purpose, 54 model mice of Autism Spectrum (ASD) were purchased from the Experimental animals center of Guangdong province, randomly divided into 9 groups, and drinking water of 6 and 9 groups of mice was supplemented with a mixture of ampicillin (1 mg/ml), streptomycin (5 mg/ml) and colistin (1 mg/ml) to eliminate the background intestinal flora of the mice, and then divided into a saline-perfused group, enema tract bacteria (GB ID NO:1 Bifidobacterium adolescentis) and intestinal bacteria combination (GB ID NO:2 Bifidobacterium adolescentis/Bifidobacterium gordonae/Bifidobacterium infantis/Erwinia, GB ID NO:3 Bifidobacterium adolescentis/parabacteroides gordonii, GB ID NO:4 Bifidobacterium adolescentis/Bifidobacterium infantis, GB ID NO:5 Bifidobacterium adolescentis/Bifidobacterium infantis, GB ID NO:6 Bifidobacterium adolescentis/Bifidobacterium gordonii/Bifidobacterium infantis, GB/Bifidobacterium gordonii, GB ID NO:7 Bifidobacterium gordonii/Bifidobacterium infantis/Bifidobacterium, and Bifidobacterium adolescentis/Bifidobacterium. After 4 months, 9 groups of mice are analyzed for behavioral differences, e.g., central platform probe experiments, and then 9 groups of mice are sacrificed and analyzed.

Step 6, because the intestinal inflammation and dysfunction or damage are the key causes of the diseases related to the systemic inflammation and the neurodegenerative or turbulent diseases, whether the intestinal inflammation can be controlled or the intestinal barrier or function can be repaired is the key to prevent and treat the systemic diseases or the neurodegenerative or turbulent diseases. Therefore, 54C 57BL/6 mice were purchased from the Experimental animals center of Guangdong province for 6 to 8 weeks, and the mental status was good. Randomly dividing mice into 9 groups of 6 mice each, treating the mice with 2% DSS (dextran sulfate sodium salt (DSS) group for one week to construct ulcerative colitis model, after one week, treating the mice with antibiotic water containing ampicillin (1 mg/ml), streptomycin (5 mg/ml) and colistin (1 mg/ml) for one week, after one week, one group was perfused with normal saline as control, and the rest was separately perfused with gastrointestinal bacteria 1x10 ⁹ And (3) performing intragastric administration once every two days for 2 weeks by CFU or intestinal bacteria combination in equal proportion. After 2 weeks, the intestinal tissue of the mice was taken for pathological section and stained with hematoxylin-eosin (HE). Plasma was collected, the concentration of palmitoleic acid in plasma was measured using a palmitoleic acid kit (cat # F30221-A, fankew, shanghai, china), and spleen tissue was collectedAnd analyzing the relative expression quantity of miRNA-31 in the spleen by utilizing qPCR detection, and detecting the Dicer expression condition by using a western blot method.

And 7, because palmitoleic acid is the advantages and key metabolites of intestinal bacteria such as bifidobacterium adolescentis, parabacteroides gordonii, bifidobacterium infantis, and akkermansia, the analysis and identification of the advantages and the functions of the key metabolites for preventing and treating inflammation and inflammation-related diseases are the key for analyzing and identifying the functions of the intestinal bacteria or the intestinal bacteria formula or the composition for preventing and treating inflammation and inflammation-related diseases. Therefore, 14C 57BL/6 mice were purchased from the Experimental animals center of Guangdong province for 6 to 8 weeks, and their mental status was good. Mice were randomly divided into 2 groups of 7 mice each, 2 groups were a control group and a palmitoleic acid group (0.36 mM), and 2 groups of mice were administered pure water, palmitoleic acid collected from enterobacteria or enterobacteria combined culture solution, and directly added to water to prepare a working solution (0.36 mM) for 2 weeks. Mice were sacrificed 2 weeks later, spleens were collected and analyzed for relative expression of miRNA-31 in the spleens using qPCR detection.

Step 8, purchasing 14C 57BL/6 mice from the experimental animal center of Guangdong province for 6-8 weeks, and the mental state is good. Mice were randomly divided into 2 groups of 7 mice each, and 2 groups were a control group and an miRNA-31 antagonist group, respectively, and were fed normally for 2 weeks by intraperitoneal injection of a control antagonist (product No. micofftm, lebo biotechnology limited) and an miRNA-31 antagonist (product No. miR3N0000001-4, lebo biotechnology limited). After 2 weeks, the mice were sacrificed, and the spleens of the mice were collected to extract total proteins, and the expression of Foxp3 was detected by a western blot method.

Step 9, purchasing 14C 57BL/6 mice from the experimental animal center of Guangdong province for 6-8 weeks, and the mental state is good. Randomly dividing mice into 2 groups, wherein each group comprises 7 mice, the 2 groups respectively comprise a DSS (Dextran Sulfate Sodium Salt, DSS) group and a DSS + palmitoleic acid group, the mice are subjected to 2-DSS solution for one week to construct an ulcerative colitis model, the mice in the 2 groups are subjected to pure water and palmitoleic acid working solution (2 mM) after one week, the mice are killed after 1 week and 1 week of continuous drinking, one part of intestinal tissues of the mice are taken to be pathological sections, hematoxylin-eosin (HE) staining is carried out, the other part of intestinal tissues of the mice are subjected to ISG15 and IFN-beta relative expression quantity analysis, the total RN is extracted by a Trizol method, and the RevertAId F is used to extract the total RN (2)irst Strand cDNA Synthesis Kit (cat # K1622, saimearf) reverse transcribing into cDNA; (3) By using

Premix Ex TaqTM (Tli RNaseH Plus) (cat number DRR420A, takara) was subjected to fluorescent quantitative PCR. Taking intestinal tissues and the like, and detecting the expression of the intestinal tight junction protein (ZO-1) and the like by using a western blot method.

Step 10, purchase 120C 57BL/6 mice from the Experimental animals center in Guangdong province for 6-8 weeks with good mental status. Mice were randomly divided into 20 groups of 6 mice each, treated with 2% DSS (dextran sulfate sodium salt (DSS) solution for one week to construct ulcerative colitis model, one week later, mice were treated with drinking water containing ampicillin (1 mg/ml), streptomycin (5 mg/ml) and colistin (1 mg/ml) for one week, 10 of them were changed to drinking water containing 0.36mM palmitoleic acid after one week, the rest were changed to plain drinking water, 9 random groups containing palmitoleic acid and 9 random groups containing plain drinking water were separately gavaged with 1x10 of stomachs ⁹ CFU Akkermansia muciniphila (Ackermansia), intestinal bacteria (GB ID NO:1 Bifidobacterium adolescentis) and 1. Taking out the rectum of the mouse to the caecum part, measuring the length of the rectum, taking a part of intestinal tissues as pathological sections, staining by hematoxylin-eosin (HE), and carrying out system analysis on the intestinal inflammation and the function.

Step 11, 28C 57BL/6 mice were purchased from the Experimental animals center of Guangdong province for 6 to 8 weeks with good mental status. Mice were randomly divided into 3 groups, 7 mice per group, mice of each group were initially treated with water containing ampicillin (1 mg/ml), streptomycin (5 mg/ml) and colistin (1 mg/ml) in antibiotic for one week, after one week the first group of mice were treated with 2-pot DSS (dextran sulfate sodium salt (DSS) solution and Azoxymethane (AOM) together to construct ulcerative colitis-induced colon cancer model, the second group of mice were also treated with 2-pot DSS (dextran sulfate sodium salt (DSS) solution and Azoxymethane (AOM) together to construct ulcerative colitis-induced colon cancer model, the third group of mice were water-only control, and after 28 days, the first group was added with drinking water containing 0.36mM palmitoleic acid, the remaining two groups were left unchanged, mice were sacrificed after 75 days, tissues such as intestinal tracts were dissected and taken out, the mice were taken out to the rectal to the cecal site, the length thereof was measured, the number and size of intestinal tumors thereof were analyzed, a part of the intestinal tissues was pathologically sectioned, and the intestinal tract inflammation system was analyzed by eosin hematein-Hematoxylin (HE) staining and intestinal tract inflammation.

And (4) analyzing results:

after the antibiotic-treated aging mice were perfused with gastrointestinal bacteria (GB ID NO:1 Bifidobacterium adolescentis) and intestinal formulation bacteria or combination bacteria (GB ID NO:2 Bifidobacterium adolescentis/paragonium gordonii/Bifidobacterium infantis/Bifidobacterium gordonii; GB ID NO:3 Bifidobacterium adolescentis/Bifidobacterium gordonii; GB ID NO:4 Bifidobacterium adolescentis/Bifidobacterium infantis; GB ID NO:5 Bifidobacterium adolescentis/Bifidobacterium infantis; GB ID NO:6 Bifidobacterium adolescentis/Bifidobacterium gordonii/Bifidobacterium infantis; GB ID NO:7 Bifidobacterium adolescentis/Bifidobacterium gordonii/Bifidobacterium infantis; GB ID NO:8 Bifidobacterium adolescentis/Bifidobacterium infantis), the social behavior index of the mice was significantly improved compared to the normal saline group, as shown in FIG. 1. The spatial memory of aging mice was significantly improved by the enterobacter and enterobacter or the combination bacteria (p < 0.05;. P < 0.01;. P, p < 0.001;. P, p <0.0001, all indicated statistically significant differences, as shown in fig. 2. In addition, the survival conditions of the mice are observed, and compared with a normal saline group, the intestinal bacteria formula bacteria or the combined bacteria can obviously improve the survival rate of aged mice and delay the aging of the mice, as shown in figure 3. In addition, the enterobacteria formulation or combination provides better control of the above symptoms than a single enterobacteria. These results indicate that the enterobacteria, the intestinal formula bacteria or the combined bacteria can significantly improve the mouse limb mobility, cognitive memory status, and alleviate inflammation or aging caused by inflammation-related diseases, including but not limited to neurodegenerative diseases or disorders such as alzheimer's disease and autism.

The function of intestinal bacteria or combined bacteria in the aspects of diseases such as neurodegenerative diseases or turbulent diseases is explored, and the Alzheimer disease is taken as an example. The accumulation of beta amyloid is the major cause of amyloid plaque formation in the brain of patients with senile dementia. Therefore, quantitative determination of the amount of amyloid plaques in the brains of two groups of senile dementia mice shows that the combination of (GB ID NO:1 Bifidobacterium adolescentis) and intestinal bacteria (GB ID NO:2 Bifidobacterium adolescentis/paragonium gomermanii/Bifidobacterium infantis/Acidomanium; GB ID NO:3 Bifidobacterium adolescentis/Paragonium gomermanii; GB ID NO:4 Bifidobacterium adolescentis/Bifidobacterium infantis; GB ID NO:5 Bifidobacterium adolescentis/Acidomanium; GB ID NO:6 Bifidobacterium adolescentis/Bifidobacterium gomermanii/Bifidobacterium infantis; GB ID NO:7 Bifidobacterium adolescentis/Bifidobacterium gomermanii/Acidomanii; GB ID NO:8 Bifidobacterium adolescentis/Bifidobacterium infantis/Acidomanii) can significantly reduce the amount of amyloid plaques in the brains of the mice, and the effect of the intestinal formulation or the combination bacteria is more significant than that of the single intestinal bacteria, as shown in FIG. 4. In addition, it is found that the intestinal bacteria and the intestinal bacteria combination can significantly reduce the expression of IFN-gamma in CD4+ T cells and CD8+ T cells so as to reduce the inflammatory response of the brain of the senile dementia mouse, for example, the GB ID NO:1 bifidobacterium adolescentis is shown in fig. 5. These results indicate that the composition of enteric bacteria can reduce the inflammatory reaction of brain of senile dementia mice, further reduce the deposition of beta-amyloid in brain of mice, and finally relieve the symptoms of diseases. This indicates that the above enterobacteria and enterobacteria combination can regulate the immune response of the brain. As shown in fig. 6, the composition of enterobacteria can also increase the retention index of mice in the central platform in the open field anxiety test in the autism mouse model, which indicates that the enterobacteria or the composition thereof provided by the present invention is helpful for alleviating anxiety states caused by autism, etc. As described above, the enteric bacteria or the combination thereof can prevent or control neurodegenerative diseases or disorders including, but not limited to, alzheimer's disease, parkinson's disease, epilepsy, and autism.

As shown in FIG. 7, after the ulcerative colitis model mouse is administered with a combination of the intestinal bacteria of the ilex structure (GB ID NO:1 Bifidobacterium adolescentis) and the intestinal bacteria (GB ID NO:2 Bifidobacterium adolescentis/Bifidobacterium gordonii/Bifidobacterium infantis/Bifidobacterium agkismanii; GB ID NO:3 Bifidobacterium adolescentis/Bifidobacterium gordonii; GB ID NO:4 Bifidobacterium adolescentis/Bifidobacterium infantis; GB ID NO:5 Bifidobacterium adolescentis/Bifidobacterium axmanium; GB ID NO:6 Bifidobacterium adolescentis/Bifidobacterium gordonii/Bifidobacterium infantis; GB ID NO:7 Bifidobacterium adolescentis/Bifidobacterium gordonii/Bifidobacterium infantis; GB ID NO:8 Bifidobacterium adolescentis/Bifidobacterium infantis), the inflammatory symptoms of the colon region are significantly reduced compared with the physiological saline group, indicating that both the intestinal bacteria and the intestinal bacteria formula or combination can exert the anti-inflammatory or immune homeostasis tuning function.

According to the fact that the intestinal bacteria can regulate the expression of the microRNA, the method explores how the intestinal bacteria influence the expression of the microRNA. Taking GB ID NO 2 Bifidobacterium adolescentis/Parabacteroides gordonii/Bifidobacterium infantis/Ackermanus as an example, as shown in FIG. 8, it was found that enterobacteria can down-regulate the expression of Dicer enzyme which plays a key role in the process of microRNA maturation. In an inflammatory disease infection model, compared with a normal saline treatment group, the enterobacteria composition can remarkably reduce the expression of miRNA-31 (the nucleic acid sequence is shown as SEQ ID NO. 1), as shown in figure 9. These results suggest that enterobacteria regulate microRNA expression by regulating the quantitative and efficient changes of enzymes during microRNA processing, splicing and maturation.

And then exploring which components of the enterobacteria play a role in regulating the expression of the non-coding RNA. Taking GB ID NO:2 Bifidobacterium adolescentis/Bifidobacterium gordonii/Bifidobacterium infantis/Achromobacter as an example, as shown in FIG. 10, it was found that the plasma palmitoleic acid content of mice in the group of the shrub strain mixture was much higher than that of control mice. Next, palmitoleic acid was found to down-regulate the expression of miRNA-31, as shown in fig. 11. To investigate by what mechanism miRNA-31 is affected, it was predicted by the Targetscan system that miRNA-31 can bind to the Untranslated Regions (UTRs) of Foxp3, i.e., degrade Foxp3 expression, and miRNA-31 was also shown to down-regulate Foxp3 expression in inflammatory disease models, as shown in fig. 12.

In addition, palmitoleic acid metabolized by intestinal bacteria was found to down-regulate the expression of ISG15 and IFN- β in intestinal tissues to suppress type I IFN signaling, as shown in fig. 13 and 14.

Further research shows that palmitoleic acid can repair the injury of intestinal inflammation parts and intestinal functions. As shown in fig. 15, palmitoleic acid was found to significantly up-regulate the expression of intestinal tight junction protein (ZO-1) compared to the enteritis control group, indicating that palmitoleic acid can repair damaged intestinal mucosal tissue, repair intestinal barrier, and restore intestinal function. In addition, it was found that palmitoleic acid, a. Muciniphila, intestinal bacteria (GB ID NO:1 bifidobacterium adolescentis) and intestinal bacteria combination (GB ID NO:2 bifidobacterium adolescentis/parabacteroides gordonii/bifidobacterium infantis/bifidobacterium inckii; GB ID NO:3 bifidobacterium adolescentis/bifidobacterium gordonii; GB ID NO:4 bifidobacterium adolescentis/bifidobacterium infantis; GB ID NO:5 bifidobacterium adolescentis/bifidobacterium inckii; GB ID NO:6 bifidobacterium adolescentis/bifidobacterium gordonii/bifidobacterium infantis; GB ID NO:7 bifidobacterium adolescentis/bifidobacterium gordonii/bacterium axungensis; and GB ID NO:8 bifidobacterium infantis/bifidobacterium inckii) can repair intestinal mucosa and intestinal functions as shown in fig. 16 and 17. In addition, the combination of the A.muciniphila, the intestinal bacteria and the intestinal bacteria is found to be capable of synergically or promoting palmitoleic acid to improve the expression of ZO-1, which shows that the combination of the A.muciniphila, the intestinal bacteria and/or the intestinal bacteria is synergic or promotes palmitoleic acid to better repair intestinal mucosa and protect intestinal barrier and intestinal function.

Next, the role of palmitoleic acid in inflammatory diseases, in particular in repairing the inflammation-induced impairment of intestinal function, was further explored. As shown in fig. 18, the mice in the palmitoleic acid group had reduced inflammation, intact intestinal epithelial tissues, and significantly increased numbers of pangolin cells and goblet cells, compared to the control group.

In addition, as shown in fig. 19, the length of the rectum to the cecum of the DSS-induced ulcerative colitis model mice was significantly shortened compared to normal mice to destroy intestinal function, and administration of palmitoleic acid could significantly repair the decrease in intestinal length caused by DSS, in particular, the intestinal length reduction by a. Muciniphila, enterobacteria (GB ID NO:1 bifidobacterium adolescentis), and intestinal bacteria combination or formulation (GB ID NO:2 bifidobacterium adolescentis/bifidobacterium infantis/icosaxifragm species; GB ID NO:3 bifidobacterium adolescentis/parabacteroides gomerdae; GB ID NO:4 bifidobacterium adolescentis/bifidobacterium infantis; GB ID NO:5 bifidobacterium adolescentis/bifidobacterium infantis; GB ID NO:6 bifidobacterium adolescentis/bifidobacterium agouti/bifidobacterium infantis; GB ID NO:7 bifidobacterium adolescentis/bifidobacterium gaviersonii/bifidobacterium infantis/GB/icosaxiella) could maintain intestinal development or intestinal function better than that was coordinated with palmitoleic.

Further analysis shows that, as shown in fig. 20, palmitoleic acid can significantly reduce the pathological damage of ulcerative colitis, while palmitoleic acid, a. Muciniphila, enterobacteria (GB ID NO:1 bifidobacterium adolescentis) and enterobacteria combination (GB ID NO:2 bifidobacterium adolescentis/parabacteroides gomerdae/bifidobacterium infantis/icommans genus, GB ID NO:3 bifidobacterium adolescentis/parabacteroides gomerdae; GB ID NO:4 bifidobacterium adolescentis/bifidobacterium infantis; GB ID NO:5 bifidobacterium adolescentis/icommans genus, GB ID NO:6 bifidobacterium adolescentis/parabacteroides gomerdae/bifidobacterium infantis; GB ID NO:7 bifidobacterium adolescentis/bifidobacterium aggermass; and GB ID NO:8 bifidobacterium infantis/bifidobacterium infantis) can synergistically or promote better repair the pathological damage caused by DSS, and exert an anti-inflammatory function. In addition, it is particularly noted that, as shown in fig. 21, no intestinal tumors were found in the group that drunk water, but mice that drunk DSS (dextran sulfate sodium salt) solution and Azoxymethane (AOM) group developed a large number of intestinal tumors, but the number of intestinal tumors that developed or occurred concomitantly with ulcerative colitis was significantly reduced after the group that drunk palmitoleic acid. The strategy for controlling inflammation of the invention can well prevent or control the generation or development of tumors caused by inflammation.

The above results collectively illustrate that:

1. the intestinal bacteria (GB ID NO:1 bifidobacterium adolescentis) and the intestinal bacteria combination (GB ID NO:2 bifidobacterium adolescentis/paragonium gordonii/bifidobacterium infantis/icosanum; GB ID NO:4 bifidobacterium adolescentis/bifidobacterium infantis; GB ID NO:5 bifidobacterium adolescentis/bifidobacterium infantis; GB ID NO:6 bifidobacterium adolescentis/paragonium gordonii/bifidobacterium infantis; GB ID NO:7 bifidobacterium adolescentis/paragonium gordonii/bifidobacterium infantis; GB ID NO:8 bifidobacterium adolescentis/bifidobacterium infantis) can improve the social behaviors, the spatial memory, prolong the life to delay aging, and prevent and treat/prevent the occurrence and development of nervous degeneration or disorder diseases such as Alzheimer's disease, parkinson's disease, epilepsy, autism and the like by regulating or improving the intestinal functions.

2. On one hand, the metabolite palmitoleic acid derived from the enterobacteria or the formulars can increase the expression of Foxp3 by down-regulating the expression of miRNA-31, and finally control the occurrence and development of disease inflammation. Given that FoxP3 is a key transcription factor of regulatory T cells (tregs), increasing expression of FoxP3 tends to increase the number and function of tregs, which are an important T cell subset for controlling inflammation. For example, it has been documented that increasing the number of tregs by other means can enhance protection against inflammatory damage caused by bacterial infection in the lung. Therefore, the present invention can efficiently enhance the function of tregs and inhibit tumors, aging, metabolic disorders, neurodegenerative or turbulent diseases caused by the destruction and/or bleeding of parenteral tissues such as intestine, liver, brain, kidney, lung and brain, infiltration of inflammatory cells such as neutrophils and inflammation, inflammation caused by infection of pathogens or microorganisms such as bacteria, fungi, parasites and viruses, and inflammation-related diseases. On the other hand, palmitoleic acid derived from the strain mixture can increase the proliferation of Pangolian cells and improve the expression of tight junction protein by systemically tuning intestinal immune homeostasis so as to repair intestinal barriers and finally restore the integrity and function of intestinal epithelial tissues. Besides, the A.muriciplila, the intestinal bacteria and the intestinal bacteria formula or the combination have the function of regulating the expression of the connexin tightly so as to exert the anti-inflammatory function, and can also cooperate or promote palmitoleic acid to better exert the functions of repairing the intestinal barrier and the intestinal tract, control inflammation, and avoid the development of enteritis or related intestinal cancers and the like. These results indicate that the strain composition and metabolites can improve social memory, regulate immune balance to relieve inflammation, and control the occurrence and development of neurodegenerative or turbulent diseases including but not limited to Alzheimer's disease, parkinson's disease, epilepsy, autism, etc. And regulation of strain compositions and metabolites also include, but are not limited to, enzymes mature by cleavage of non-coding RNAs to regulate expression of non-coding RNAs by degradation of mRNA levels including, but not limited to, foxp3, and gut bacteria compositions and metabolites by regulation, including, but not limited to, systemic tuning of immune homeostasis to regulate expression of including, but not limited to, tight junction proteins to regulate proliferation of cells including, but not limited to, panne cells, and ultimately, immune balance to prevent development of inflammation-related disorders.

Sequence listing

<110> Rui Mi (Shenzhen) Biotech Limited

<120> use of Bifidobacterium adolescentis for the preparation of a medicament for the treatment of inflammation-related disorders

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aggcaagaug cuggcauagc u 21

Claims

1. Use of Bifidobacterium adolescentis for the manufacture of a medicament for the treatment of inflammation-related disorders.

2. Use of a combination of enterobacteria for the manufacture of a medicament for the treatment of a disease associated with inflammation, characterized in that the combination of enterobacteria comprises at least Bifidobacterium adolescentis (Bifidobacterium adolescentis) and one or more different enterobacteria.

3. Use according to claim 2, wherein the different gut bacteria are selected from one or more of the following: parabacteroides gordonii (Parabacteroides goldsteinii), bifidobacterium infantis (Bifidobacterium infantis), exendiculum (Akkermansia spp.).

4. Use of Bifidobacterium adolescentis for the manufacture of a medicament for modulating the expression of claudin.

5. Use of a combination of enterobacteria in the manufacture of a medicament for modulating expression of claudin, wherein said combination of enterobacteria comprises at least Bifidobacterium adolescentis (Bifidobacterium adolescentis) and one or more different enterobacteria.

6. Use according to claim 2, wherein the different enterobacteria are selected from one or more of the following: parabacteroides gordonii (Parabacteroides goldsteinii), bifidobacterium infantis (Bifidobacterium infantis), exendiculum (Akkermansia spp.).

7. Use of Bifidobacterium adolescentis (Bifidobacterium adolescentis) in the manufacture of a medicament for modulating the expression of a non-coding RNA.

8. The use of claim 4, wherein the non-coding RNA comprises a sequence defined by the sequence set forth in SEQ ID NO:1 or a nucleotide sequence having at least 95% homology thereto.

9. Use of a combination of enterobacteria in the manufacture of a medicament for modulating the expression of non-coding RNA, wherein the combination of enterobacteria comprises at least Bifidobacterium adolescentis (Bifidobacterium adolescentis) and one or more different enterobacteria.

10. The use according to claim 9, wherein the different enterobacteria are selected from one or more of the following: parabacteroides gordonii (Parabacteroides goldsteinii), bifidobacterium infantis (Bifidobacterium infantis), exendiculum (Akkermansia spp.).

11. The use of claim 9 or 10, wherein the non-coding RNA comprises a sequence defined by SEQ ID NO:1 or a nucleotide sequence having at least 95% homology thereto.

12. Use of a metabolite of bifidobacterium adolescentis for the manufacture of a medicament for the treatment of a disease associated with inflammation.

13. Use according to claim 12, wherein the metabolite is palmitoleic acid or a derivative, modification, isomer thereof.

14. Use of a metabolite of a combination of intestinal bacteria for the manufacture of a medicament for the treatment and/or prevention of inflammation related diseases and/or tumors of the digestive tract, wherein said combination of intestinal bacteria comprises at least Bifidobacterium adolescentis (Bifidobacterium adolescentis) and one or more different intestinal bacteria.

15. Use according to claim 14, wherein the metabolite is palmitoleic acid or derivatives, modifications, isomers and the like thereof.