CN115678976B

CN115678976B - Kit for simultaneously detecting 26 deafness susceptibility gene mutation sites based on time-of-flight mass spectrum and application thereof

Info

Publication number: CN115678976B
Application number: CN202211348151.7A
Authority: CN
Inventors: 孔琪; 董丛丛; 黄志丰; 欧晓嫦; 谢龙旭
Original assignee: Hybribio Ltd; Shenyang Kaipu Medical Laboratory Co ltd; Guangzhou Hybribio Medicine Technology Ltd
Current assignee: Hybribio Ltd; Shenyang Kaipu Medical Laboratory Co ltd; Guangzhou Hybribio Medicine Technology Ltd
Priority date: 2022-10-31
Filing date: 2022-10-31
Publication date: 2023-07-14
Anticipated expiration: 2042-10-31
Also published as: CN115678976A

Abstract

The invention discloses a kit for simultaneously detecting 26 deafness susceptibility gene mutation sites based on time-of-flight mass spectrometry and application thereof. The primer set provided by the invention can detect 26 deafness susceptibility gene mutation sites simultaneously, analyze the genotype condition of SNP sites specific to human hereditary deafness, accurately type SNP point mutation, short fragment mutation and mitochondrial genome point mutation of 4 human hereditary deafness susceptibility genes in a sample, and has high accuracy, high sensitivity and repeatability; overcomes the defect of few SNP loci in single tube reaction detection in the prior art, and avoids the related interference between a plurality of pairs of primers through the optimization of primer sequences for a plurality of times. The method has the advantages that a plurality of mutation sites can be amplified simultaneously by adopting fewer primer pairs, more mutation ranges can be covered more comprehensively, the detection time is less, the operation is simplified, the cost is reduced, the result is visual and easy to judge, and more effective hereditary hearing loss detection can be performed.

Description

Kit for simultaneously detecting 26 deafness susceptibility gene mutation sites based on time-of-flight mass spectrum and application thereof

Technical Field

The invention belongs to the technical field of biological medicine. More particularly, relates to a kit for simultaneously detecting 26 deafness susceptibility gene mutation sites based on time-of-flight mass spectrometry and application thereof.

Background

The deafness can be caused by genetic genes or acquired diseases, and most of deafness patients are caused by the genetic genes, whether the deafness mutant genes are carried or not can be found in advance through gene detection, the early intervention can be carried out, the next generation of hearing disability is avoided, or related language training is carried out, and communication disorder caused by the deafness is reduced. The current detection technology for deafness susceptibility gene mutation includes ARMS-PCR method, diversion hybridization method and reverse hybridization method, fluorescent PCR method of Taqman probe and high throughput sequencing method, but these methods have certain problems. Wherein, 1) the PCR (ARMS-PCR) flux of the amplification blocking mutation system is low, only one mutation site can be detected in each reaction, and the amplification blocking mutation system is not suitable for SNP typing detection with excessively high or excessively low GC content of the mutation site. 2) The PCR diversion hybridization method and the reverse hybridization method have low flux and complex steps, and the products need to be uncovered for hybridization and repeated washing for many times after the PCR is finished, so that the operation is relatively complex and pollution is easy to generate. 3) The fluorescent PCR method based on the Taqman probe is limited in detection channel of a fluorescent PCR instrument, few in single-hole detection mutation sites, low in flux, high in fluorescent probe cost (two probes are needed to be synthesized aiming at the same site), and low in accuracy, and the result is easily influenced by factors such as sample concentration and purity. 4) Although the high-throughput sequencing method has wide detection range and can predict unknown mutation conditions, the method needs to construct a library first and then sequence and sequence comparison, has complex operation, high later sequence processing difficulty, long time consumption, high cost and low accuracy.

The existing deafness gene detection method is characterized by complex operation, long time consumption, low flux, easy pollution of products, high cost and the like. Therefore, development of a new detection method is needed to detect the deafness susceptibility gene more simply, conveniently, rapidly, accurately, sensitively, specifically and with higher flux. Matrix assisted laser desorption ionization (matrix assisted laser desorption/ionization, MALDI) is a pulsed soft ionization technique. The ionized sample is transferred from the ion source to a mass analyzer for analysis to obtain molecular weight. Since ions generated by a MALDI ion source are often analyzed using a time of flight (TOF) mass analyzer, MALDI is often used in conjunction with TOF-MS, known as matrix assisted laser Desorption ionization time-of-flight mass spectrometry (MADLI-TOF-MS). In the prior art, MALDI-TOF Massary technology and multiplex PCR amplification technology are combined to be used, so that a plurality of mutation sites can be detected simultaneously in one reaction system, the workload is greatly reduced, the detection flux is improved, and the detection cost is reduced. For example, in the prior art CN105255999a, a method for detecting 20 mutation sites of a deafness gene is disclosed, 20 amplification and extension primers are used for carrying out on 20 hot mutation sites of deafness susceptibility genes GJB2, SLC26A4, GJB3 and 12S rRNA, but the method has the problems of complex operation, easy operation error, increased detection cost, less detection sites, easy missed detection and the like due to multi-tube operation; in another example, CN112538525 a-a detection method for detecting gene SNPs related to deafness, which is only to detect 20 polymorphic loci of genes related to deafness, and most loci peak too low, the deviation of detection results is larger, which is not beneficial to interpretation of detection results.

It is known that deafness involves a large number of pathogenic genes, and more than 100 gene regions and 46 pathogenic genes have been found so far, and that there are numerous deafness mutation sites in each gene, thus having high genetic heterogeneity of genes and sites. At most, only 20 mutation sites of susceptibility genes are covered in the prior art. The hereditary deafness gene screening specification published in 2021 proposes 4 genes, 24 pathogenic mutation sites with higher carrying rate for Chinese people, including sites such as c.109G > A, c.255C > G and c.427C > T of the newly added GJB 2. In order to cover high-frequency detection sites more comprehensively and improve the detection accuracy of mutation sites, it is necessary to research a detection method aiming at more susceptibility gene mutation sites, simplify detection steps, reduce cost, meet the requirement of large-scale screening, and provide new technical means and support for early screening of deafness susceptibility genes.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the problems, and provides a kit for simultaneously detecting 26 deafness susceptibility gene mutation sites based on time-of-flight mass spectrometry and application thereof.

The invention aims to provide a primer group for simultaneously detecting 26 deafness susceptibility gene mutation sites based on time-of-flight mass spectrometry.

Another object of the invention is to provide the use of said primer set.

It is still another object of the present invention to provide a kit product for detecting a susceptibility genotyping for deafness.

The above object of the present invention is achieved by the following technical scheme:

the invention provides a primer group for simultaneously detecting 26 deafness susceptibility gene mutation sites based on time-of-flight mass spectrometry, which consists of amplification primers and single-base extension primers; the amplification primer is shown as SEQ ID NO. 1-20, and the single-base extension primer is shown as SEQ ID NO. 21-46; the detected deafness-related susceptibility genes are GJB2, SLC26A4, GJB3 and mitochondrial 12S rRNA.

Specifically:

primer pairs shown in SEQ ID No. 1-2 amplify sites of rs80338939 (c.35 delG), rs72474224 (c.109G > A), rs80338942 (c.167delT), rs750188782 (c.176-191 del 16), rs80338943 (c.235 delC), rs1291519904 (c.257C > G), rs111033204 (c.299-300 delAT), rs80338948 (c.427C > T) H and rs773528125 (c.512 insAACG) in the GJB2 gene;

primer pairs shown in SEQ ID NO. 3-4 amplify sites of rs267606618 (m.1095T > C), rs267606619 (m.1494C > T) and rs267606617 (m.1555A > G) in mitochondrial 12S rRNA genes;

primer pairs shown in SEQ ID NO. 5-6 amplify the locus of rs1057516953 (c.281C > T) in the SLC26A4 gene;

the primer pair shown in SEQ ID NO. 7-8 amplifies the locus of rs111033380 (c.589G > A) in the SLC26A4 gene;

primer pairs shown in SEQ ID NO. 9-10 amplify the locus of rs768245266 (c.916-917 insG) and rs111033313 (c.IVS7-2A > G) in the SLC26A4 gene;

primer pairs shown in SEQ ID NO. 11-12 amplify sites of rs201562855 (c.1174A > T), rs111033305 (c.1226G > A) and rs111033220 (c.1229C > T) in SLC26A4 gene;

primer pairs shown in SEQ ID NO. 13-14 amplify the locus of rs200455203 (c.1975G > C) and rs111033318 (c.2027T > A) in the SLC26A4 gene;

primer pairs shown in SEQ ID NO. 15-16 amplify the locus of rs121908363 (c.2162C > T) and rs121908362 (c.2168A > G) in the SLC26A4 gene;

primer pairs shown in SEQ ID NO. 17-18 amplify the locus of rs192366176 (c.IVS15+5G > A) in the SLC26A4 gene;

primer pairs shown in SEQ ID NO. 19-20 amplify the locus of rs74315319 (c.538C > T) and rs74315318 (c.547G > A) in the GJB3 gene;

the primer pair shown in SEQ ID NO.21 extends the rs80338939 (c.35 delG) locus in the GJB2 gene;

the primer pair shown in SEQ ID NO.22 extends the locus of rs72474224 (c.109G > A) in the GJB2 gene;

the primer pair shown in SEQ ID NO.23 extends an rs80338942 (c.167delT) locus in the GJB2 gene;

the primer pair shown in SEQ ID NO.24 extends the locus of rs750188782 (c.176-191 del 16) in the GJB2 gene;

the primer pair shown in SEQ ID NO.25 extends an rs80338943 (c.235 delC) locus in the GJB2 gene;

the primer pair shown in SEQ ID NO.26 extends the locus of rs1291519904 (c.257C > G) in the GJB2 gene;

the primer pair shown in SEQ ID NO.27 extends the locus of rs111033204 (c.299-300 delAT) in the GJB2 gene;

the primer pair shown in SEQ ID NO.28 extends the locus of rs80338948 (c.427C > T) in the GJB2 gene;

the primer pair shown in SEQ ID NO.29 extends the rs773528125 (c.512 insAACG) locus in the GJB2 gene;

the primer pair shown in SEQ ID NO.30 extends the rs267606618 (m.1095T > C) locus in the mitochondrial 12S rRNA gene;

the primer pair shown in SEQ ID NO.31 extends the site of rs267606619 (m.1494C > T) in the mitochondrial 12S rRNA gene;

the primer pair shown in SEQ ID NO.32 extends the site of rs267606617 (m.1555A > G) in the mitochondrial 12S rRNA gene;

the primer pair shown in SEQ ID NO.33 extends the locus of rs1057516953 (c.281C > T) in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.34 extends the rs111033380 (c.589G > A) locus in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.35 extends the locus of rs768245266 (c.916-917 insG) in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.36 extends the locus of rs111033313 (c.IVS7-2A > G) in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.37 extends the locus of rs201562855 (c.1174A > T) in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.38 extends the rs111033305 (c.1226G > A) locus in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.39 extends the rs111033220 (c.1229C > T) locus in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.40 extends the locus of rs200455203 (c.1975G > C) in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.41 extends the locus of rs111033318 (c.2027T > A) in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.42 extends the rs121908363 (c.2162C > T) locus in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.43 extends the locus of rs121908362 (c.2168A > G) in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.44 extends the locus of rs192366176 (c.IVS15+5G > A) in the SLC26A4 gene;

the primer pair shown in SEQ ID NO.45 amplifies an rs74315319 (c.538C > T) locus in the GJB3 gene;

the primer pair shown in SEQ ID NO.46 amplifies the rs74315318 (c.547G > A) locus in the GJB3 gene.

The invention uses multiplex PCR amplification primer and extension primer, selects sample genome DNA as template, amplifies the segment containing specific SNP locus in human genome, uses extension program to extend single base of amplified product, and finally uses matrix-assisted laser desorption ionization time-of-flight mass spectrum technology to analyze SNP condition of specific locus of hereditary deafness gene by distinguishing the length of product flight time. The primer set provided by the invention can detect the mutation conditions of 9 sites of the GJB2 gene, 2 sites of the GJB3 gene, 3 sites of the 12S rRNA and 12 sites of the SLC26A4 gene simultaneously through one-tube reaction. Through optimizing primer sequence combination, mutation of 26 sites of 4 related genes of hereditary hearing loss can be detected simultaneously, and mutation conditions can be accurately analyzed.

The primer group provided by the invention can detect more mutant gene loci simultaneously, overcomes the defects of fewer SNP loci and complicated operation of a multi-reaction tube in the prior art, avoids the related interference between the use of more primers by adopting the optimal primer combination, can amplify a plurality of mutant loci simultaneously by adopting fewer primer groups, has wider coverage range, and also has higher accuracy, sensitivity and repeatability, and has important guidance and research values for auxiliary diagnosis and treatment of hereditary hearing loss. The primer group provided by the invention realizes that the whole amplification and the detection of polymorphic loci are completed in the same reaction system, reduces the interference of external factors on results, can improve the detection accuracy, can reduce the misdiagnosis risk caused by incomplete detection loci, and better meets the clinical diagnosis needs of deafness.

The invention provides application of the primer group in SNP point mutation, short fragment mutation and mitochondrial genome point mutation typing of hereditary deafness susceptibility genes or in preparation of products for detecting deafness susceptibility gene typing.

The invention provides a product for detecting deafness susceptibility genotyping, which contains the primer set.

Preferably, the product is a kit.

Preferably, the reagents required for PCR amplification, SAP reaction and single base extension reaction are also contained.

More preferably, the agent is Agena

Pro，PCR Reagents&

Kit。

Preferably, in the method of using the product, the PCR amplification procedure is: 95 ℃ for 2min;95℃30s,56℃30s,72℃1min,45 cycles; 72 ℃ for 5min; preserving heat at 4 ℃.

Preferably, the method of using the product is one in which the single base extension reaction is performed as detailed in Table 5 below.

Preferably, the detection sample is: EDTA anticoagulants and/or dried blood spots.

The invention has the following beneficial effects:

the primer group for detecting 26 related SNP loci of hereditary hearing loss genes provided by the invention can accurately type SNP point mutation, short fragment mutation and mitochondrial genome point mutation of 4 human hereditary hearing loss susceptibility genes in a sample.

The primer group of the genetic deafness related SNP locus provided by the invention comprises 3 general genetic deafness mutation loci such as congenital deafness, delayed deafness, drug-induced deafness and the like, can be used for more effectively detecting the genetic deafness of the newborn, and can be used for targeted treatment and medication guidance of the infant.

The invention overcomes the defects of fewer SNP loci for reaction detection and fewer single-tube detection reaction detection loci in the prior art, can specifically detect the 26 locus mutation of the deafness susceptibility gene, has high accuracy, high sensitivity and good repeatability, has less detection time consumption, has a visual and easy-to-judge result, and is suitable for large-scale screening and auxiliary diagnosis application of deafness.

The invention is suitable for newborns, patients and fertility-required people, and can help to detect the risk of detecting pathogenic sites and prompting aminoglycoside drugs of the testee with suspected family history; guiding the reproduction of the couples with congenital deafness to the children; the high-risk carrier can take targeted measures in advance, such as implantation of an artificial cochlea in advance, so as to avoid dumb caused by deafness.

Drawings

FIG. 1 is a mass spectrometry graph of the c.235 site abnormality of GJB 2in a blank control;

FIG. 2 is a mass spectrometry chart of an abnormality in m.1095 site of mitochondrial 12S rRNA;

FIG. 3 is a mass spectrometry chart of abnormalities in the m.1095 site, m.1494 site and m.1555 site of mitochondrial 12S rRNA;

FIG. 4 is a diagram of the peaks from the mass spectrometry analysis of the amplification and extension primer sets of tables 7 and 8;

FIG. 5 is a mass spectrometry graph of GJB2 heterozygous mutant patients;

FIG. 6 is a mass spectrometry graph of GJB3 heterozygous mutant patients;

FIG. 7 is a mass spectrometry plot of SLC26A4 heterozygous mutant patients;

FIG. 8 is a mass spectrometry chart of a patient with heterozygous mutation of mitochondrial 12S rRNA;

FIG. 9 is a mass spectrometry chart of abnormalities at c.167 site, m.1095 site, m.1494 site and m.1555 site of the mitochondrial 12S rRNA of the blank control GJB 2;

FIG. 10 is a mass spectrometry graph of abnormalities in c.235 site, c.299 site, c.427 site, c.512 site, m.1095 site, m.1494 site and m.1555 site of the control GJB2, and mitochondrial 12S rRNA;

FIG. 11 is a mass spectrum analysis chart of abnormalities of c.167 site, m.1095 site, m.1494 site and m.1555 site of mitochondrial 12S rRNA and c.IVS15+5 site of SLC26A4 of a blank control GJB 2;

FIG. 12 is a mass spectrometry plot of abnormalities at position c.1226 and position c.IVS15+5 of SLC26A 4;

FIG. 13 is a mass spectrum analysis chart of abnormalities of c.167 site, c.235 site, c.257 site, m.1095 site and m.1555 site of mitochondrial 12S rRNA of 5 sites GJB2 of a blank control;

FIG. 14 is a graph of C.583 site abnormality mass spectrometry of GJB 3;

FIG. 15 is c.167 site, m.1095 site and m.1494 site of mitochondrial 12S rRNA of the control GJB 2; c.1226 site of SLC26 A4; mass spectrometry map of SLC26A4 c.ivs15+5 site abnormalities;

FIG. 16 is a c.167 site of the control GJB2, c.257 site of the GJB2, m.1555 site and m.1494 site of the mitochondrial 12S rRNA; mass spectrometry map of SLC26A4 for c.1226 site abnormalities;

FIG. 17 is a mass spectrum analysis of abnormalities at position c.235 of the control GJB2, position c.538 of the control GJB3, position c.547 of the control GJB3, and 1095 and 1555 of the mitochondrial 12S rRNA.

Detailed Description

The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.

Reagents and materials used in the following examples are commercially available unless otherwise specified.

Example 1 primer design and optimization

1. Mutation site selection

The SNP loci selected in the embodiment are polymorphic in human somatic genetic materials, specifically 4 deafness susceptibility genes GJB2, GJB3, SLC26A4 and mitochondria 12S rRNA, and a great number of literature researches are combined to report that the finally selected 26 deafness susceptibility genes have high-frequency mutation loci as follows:

(1) 9 SNP loci of GJB2 gene: rs80338939 (c.35 delG), rs72474224 (c.109G > A), rs80338942 (c.167delT), rs750188782 (c.176-191 del 16), rs80338943 (c.235 delC), rs1291519904 (c.257C > G), rs111033204 (c.299-300 delAT), rs80338948 (c.427C > T), rs773528125 (c.512 insAACG);

(2) 3 SNP loci of the 12S rRNA gene: rs267606618 (m.1095t > C), rs267606619 (m.1494C > T), rs267606617 (m.1555a > G).

(3) 12 SNP loci of SLC26A4 gene: rs1057516953 (c.281C > T), rs111033380 (c.589G > A), rs768245266 (c.916-917 insG), rs201562855 (c.1174A > T), rs111033305 (c.1226G > A), rs111033220 (c.1229C > T), rs200455203 (c.1975G > C), rs111033318 (c.2027T > A), rs121908363 (c.2162C > T), rs121908362 (c.2168A > G), rs111033313 (c.IVS 7-2A > G), rs192366176 (c.IVS15+5G > A).

(4) 2 SNP loci of GJB3 gene: rs74315319 (c.538c > T), rs74315318 (c.547g > a).

2. One-to-one detection primer design

Designing and synthesizing a primer sequence of a group of amplification primers for amplifying a mutation site according to the 26 high-frequency mutation SNP sites, and synthesizing a PCR amplification primer and a single base extension primer of a deafness mutation gene specific SNPs site, wherein the specifically designed primer sequences are shown in a table 1.

TABLE 1 amplification primers and extension primer sequence listing for amplifying each site

The primers in the above table are mixed according to the ratio of the description of the kit to form corresponding amplification primer mixed solution and extension primer mixed solution. Multiplex PCR amplification was performed in one system (single well) using the amplification primer mix followed by single base extension reaction using the extension primer mix to detect 26 specific SNP sites.

The method uses the reagent: kaipu nucleic acid extraction kit magnetic bead method DR-4801-KZ and Agena

Pro PCR Reagents&

Kit, amplification primer mixture, extension primer mixture, TE solution and ultrapure water.

The experimental operation steps are as follows: whole blood samples (source: normal, non-diseased volunteers) were collected, with 5ml of blood being conventional venous blood (EDTA anticoagulation). Whole blood sample genomic DNA was extracted by the Kappy nucleic acid extraction kit magnetic bead method (DR-4801-KZ type) (refer to the procedure of the attached instructions), and the concentration of the extracted DNA was measured by an ultraviolet spectrophotometer and diluted to 5 ng/. Mu.l with TE solution. PCR amplification reaction: the sample genomic DNA was used as a template, and a reaction system was prepared according to Table 2 and placed in a PCR amplification apparatus for reaction. The reaction condition is 95 ℃ for 2min;95℃30s,56℃30s,72℃1min,45 cycles; 72 ℃ for 5min; preserving heat at 4 ℃.

TABLE 2 PCR amplification System

SAP reaction was performed, SAP reaction solution was prepared according to Table 3, 2. Mu.L of SAP mixed solution was added to each well (total volume after adding mixed solution: 7. Mu.L), and the reaction tube was placed in a PCR apparatus under the following reaction conditions: 40min at 37 ℃;85 ℃ for 5min; preserving heat at 4 ℃.

TABLE 3 SAP reaction System

Single base extension reaction: a single base reaction system was prepared as shown in Table 4. 2. Mu.L of iPLEX extension mix was added to each well and mixed (total volume 9. Mu.L after addition), the reaction plate was placed on a PCR instrument and single base reactions were performed according to the reaction procedure of Table 5.

TABLE 4 Single base extension reaction System

TABLE 5 Single base extension reaction procedure

Adding 16 mu L of ultrapure water to each reaction well so that the total volume of the reaction product of each well is 25 mu L; firstly, importing edited site Assay into Typer analysis software, then selecting the position of a reaction hole of a detection sample, importing a corresponding 384-plate sample name, and finally connecting a detection core; the 384-well plate and the detection chip were placed in the corresponding positions of the mass spectrometer, and then time-of-flight mass spectrometry detection was started.

Interpretation of the detection results: and (3) detecting the flight time of the extension product in a vacuum tube through mass spectrometry of the single-base extension product, thereby calculating the molecular mass of the extension product, and comparing the molecular weights of the extension primer and the extension product with the preset molecular weight in software through analysis software to judge whether the peak value of the extension product is wild type, heterozygous mutant type or homozygous mutant type.

After the amplification primers and the extension primers for amplifying each site in table 1 are adopted for detection analysis, the detection result is shown in fig. 1, and the extension peak appears at the GJB2 c.235delC site which is a blank control, so that the interpretation of the detection result of the site is affected, and after the amplification detection is carried out on each site, the interpretation of the detection result is not facilitated because of the mutual influence of more primer groups adopted.

3. One-to-many detection primer design

Therefore, through the optimal design of the amplification primers, a plurality of sites can be amplified correspondingly through a pair of amplification primers, the amplification primers and the extension primers obtained through the design are shown in the following table 6, a group of amplification primers correspond to a plurality of mutation sites for detection and analysis, the detection method steps are the same, and the result shows that an extension peak is formed at the m.1095 site of mitochondria in a blank control as shown in fig. 2, so that the interpretation of the sites is affected.

TABLE 6 primer sequence listing of a set of amplification primers for multiple mutation sites

Therefore, after the amplification primer and the extension primer sequence are optimized, the invention can avoid the extension peak at the c.235delC locus of the GJB2 gene, but the extension peak is shown at the m.1095 locus of the mitochondria. Meanwhile, the research shows that when the extension primer and the amplification primer combination in the table 6 are adopted for amplification detection analysis, the detection results are obviously changed after the program amplification annealing temperature and the single base extension annealing temperature are changed: when the program amplification annealing temperature was set at 58℃and the single base extension annealing temperature was set at 54℃it showed an extension peak at the m.1095 position compared with the previous extension peak at the m.1095 position, and the detection showed that extension product peaks also appear at the m.1095, m.1494 and m.1555 positions of the 12S rRNA in the blank (FIG. 3). It was shown that the peak of the extension product was increased in the blank wells by adjusting the annealing temperatures for the different amplification and extension primer combinations and that the peak of part of the sites was lower, requiring optimization from the primer combinations and reaction systems, not the reaction temperature.

Therefore, the amplification primer combination and the extension primer combination are further optimized, the amplification primers obtained by the optimized design are shown in the following table 7, and preliminary amplification verification is carried out by adopting the amplification primers in the following table, so that the bands can be successfully amplified, and the amplification primers can be used for subsequent experiments.

TABLE 7 amplification primer sequence listing

SEQ ID No.	Primer name	Sequence(s)
			1	35F	ACGTTGGATGAGAGTAGAAGATGGATTGGG
2	512R	ACGTTGGATGGTCCACAGTGTTGGGACAAG
			3	1095F	ACGTTGGATG GCTAAGACCCAAACTGGGAT
4	1555R	ACGTTGGATGCACTTTCCAGTACACTTACC
			5	281F	ACGTTGGATGTAGTGACGTCATTTCGGGAG
6	281R	ACGTTGGATGACATCTTACCTTGCAGCGTG
			7	589F	ACGTTGGATGCTTGTAAGTTCATTACCTG
8	589R	ACGTTGGATGACAGCTAGAGTCCTGATTGC
			9	917F	ACGTTGGATGAAAATCCCAGTCCCTATTCC
10	IVS7-2R	ACGTTGGATGGGCTCCATATGAAATGGCAG
			11	1174F	ACGTTGGATGTGGTGGCCACAAAACAAGAG
12	1229R	ACGTTGGATGTCTTTCCTCCAGTGCTCTCC
			13	1975F	ACGTTGGATGACGTTCCCAAAGTGCCAATC
14	2027R	ACGTTGGATGCAGAAAACCAGAACCTTACC
			15	2162F	ACGTTGGATGCGACAACATTAGAAAGGACAC
16	2168R	ACGTTGGATGCACTTGGTTCTGTAGATAGAG
			17	IVS15+5F	ACGTTGGATGTTCTATGGCAATGTCGATGG
18	IVS15+5R	ACGTTGGATGAGAAAACAAATTTCTAGGG
			19	538F	ACGTTGGATGGGTGAAGATTTTCTTCTCGG
20	547R	ACGTTGGATGATCGTGGACTGCTACATTGC

Wherein the primer of SEQ ID NO. 1-2 amplifies the sites of rs80338939 (c.35 delG), rs72474224 (c.109G > A), rs80338942 (c.167delT), rs750188782 (c.176-191 del 16), rs80338943 (c.235 delC), rs1291519904 (c.257C > G), rs111033204 (c.299-300 delAT), rs80338948 (c.427C > T) H and rs773528125 (c.512 insAACG) in the GJB2 gene; the primer of SEQ ID NO. 3-4 amplifies the sites of rs267606618 (m.1095T > C), rs267606619 (m.1494C > T) and rs267606617 (m.1555A > G) in the mitochondrial 12S rRNA gene; amplifying an rs1057516953 (c.281C > T) locus in the SLC26A4 gene by using a primer SEQ ID NO. 5-6; amplifying an rs111033380 (c.589G > A) locus in the SLC26A4 gene by using a primer of SEQ ID NO. 7-8; the primer of SEQ ID NO. 9-10 amplifies the locus of rs768245266 (c.916-917 insG) and rs111033313 (c.IVS7-2A > G) in SLC26A4 gene; the primer of SEQ ID NO. 11-12 amplifies the locus of rs201562855 (c.1174A > T), rs111033305 (c.1226G > A) and rs111033220 (c.1229C > T) in SLC26A4 gene; the primer of SEQ ID NO. 13-14 amplifies the locus of rs200455203 (c.1975G > C) and rs111033318 (c.2027T > A) in SLC26A4 gene; amplifying the locus of rs121908363 (c.2162C > T) and rs121908362 (c.2168A > G) in SLC26A4 gene by using a primer shown in SEQ ID NO. 15-16; amplifying an rs192366176 (c.IVS15+5G > A) locus in the SLC26A4 gene by using a primer shown in SEQ ID NO. 17-18; the primer of SEQ ID NO. 19-20 amplifies the locus of rs74315319 (c.538C > T) and rs74315318 (c.547G > A) in GJB3 gene.

Then optimizing and screening single base extension primers, designing multiple groups of extension primers aiming at different specific SNP loci, simultaneously adopting the amplification primers in the table 7 for detection, detecting each group of amplification primers and extension primers of different loci by the same detection analysis method, and finally screening to obtain 26 pairs of extension primers in the table 8 and 10 pairs of amplification primers in the table 7 to detect the 26 mutation loci functionally, wherein the result diagram is shown in fig. 4, no extension primer peak appears in blank control, and the correspondence table of the amplification primers and the single base extension primers is shown in the table 9. However, the presence of the extended primer peak in the blank control with the other amplification primer and extended primer combinations substantially resulted in the detection of the mutation site, affecting site interpretation, and showed that any amplification and extended primer combination not designed for the SNP site was successful in detecting the mutation site, and only some primer combinations affecting site interpretation were enumerated in the subsequent comparative examples.

In conclusion, by integrating the amplification primer combination and optimizing the extension primer sequence, the situation that the blank control hole has an extension product peak can be effectively reduced by reducing the number of the amplification primers and ensuring the efficiency of amplified fragments, thereby meeting the clinical deafness gene detection requirement.

Table 8 Single base extension primer sequence Listing

The PCR amplification primers correspond to the single base extension primers as follows:

TABLE 9 amplification primer and Single base extension primer correspondence table

Example 2 clinical sample testing

Sample 1: GJB2 gene abnormality suspected patient detection

The steps are as follows: according to the method steps in example 1, DNA of sample blood is extracted, then PCR amplification is carried out to obtain SNP locus specific to target fragment by using the primer set in table 7, dNTPs in the PCR system in the last step are digested by SAP enzyme, single base extension reaction is carried out by using the primer set in table 8, and finally the result is detected and analyzed by a time-of-flight mass spectrometer. The results of the test are shown in FIG. 5, and are shown as GJB2 (c.299delAT) heterozygous abnormalities, indicating that the patient had developed a GJB2 c.299delAT heterozygous mutation.

Sample 2: GJB3 gene abnormality suspected patient detection

The steps are as follows: according to the method steps in example 1, DNA of sample blood is extracted, then PCR amplification is carried out to obtain SNP locus specific to target fragment by using the primer set in table 7, dNTPs in the PCR system in the last step are digested by SAP enzyme, single base extension reaction is carried out by using the primer set in table 8, and finally the result is detected and analyzed by a time-of-flight mass spectrometer. The detection result is shown in fig. 6, and shows that the heterozygous abnormality of GJB3 c.547G > A indicates that the patient has heterozygous mutation of GJB3 c.547G > A.

Sample 3: SLC26A4 gene abnormality suspected patient detection

The steps are as follows: according to the method steps in example 1, DNA of sample blood is extracted, then PCR amplification is carried out to obtain SNP locus specific to target fragment by using the primer set in table 7, dNTPs in the PCR system in the last step are digested by SAP enzyme, single base extension reaction is carried out by using the primer set in table 8, and finally the result is detected and analyzed by a time-of-flight mass spectrometer. The results of the test are shown in FIG. 7 as SLC26A4 c.281C > T heterozygous abnormalities, indicating that the patient had SLC26A4 c.281C > T heterozygous mutations.

Sample 4: detection of suspected patient with abnormal mitochondrial 12S rRNA gene

The steps are as follows: according to the method steps in example 1, DNA of sample blood is extracted, then PCR amplification is carried out to obtain SNP locus specific to target fragment by using the primer set in table 7, dNTPs in the PCR system in the last step are digested by SAP enzyme, single base extension reaction is carried out by using the primer set in table 8, and finally the result is detected and analyzed by a time-of-flight mass spectrometer. The test results are shown in FIG. 8 and show that 12S rRNA c.1555A>G heterozygous mutant is abnormal, indicating 12S rRNAc.1555A>G heterozygous mutation in the patient.

Therefore, the deafness gene of the suspected patient of the clinical sample is detected by utilizing the primer combination and the reaction program of the patent, and the detection result is completely consistent with the first-generation sequencing gold standard, so that the mutation condition of the deafness susceptibility gene can be accurately detected by utilizing the primer combination and the reaction program of the patent.

Comparative example 1

A plurality of groups of different amplification primers are designed according to 26 high-frequency mutation SNP loci, wherein the amplification primers aiming at different gene loci are shown in the following table 10, the rest amplification primers are shown in the table 7, and the amplification detection method is the same as that of example 1. As shown in FIG. 9, there were 4 sites at which the extension primer peaks were present, which are the c.167 site of GJB2, the m.1095 site of mitochondrial 12S rRNA, the m.1494 site and the m.1555 site, respectively.

TABLE 10 different amplification primer sequences

Gene	SNP_ID	R-SEQ
			GJB2	235-R2	ACGTTGGATGTGACACGAAGATCAGCTGCA
SLC26A4	1975-R3	ACGTTGGATCTGAAAGATATAGCTCCACAG

Comparative example 2

A plurality of groups of different amplification primers are designed according to 26 high-frequency mutation SNP loci, wherein the amplification primers aiming at different gene loci are shown in the following table 11, the rest amplification primers are shown in the table 7, and the amplification detection method is the same as that of example 1. The results of the test are shown in FIG. 10, which shows that the blank has 7 sites with the extension primer peak at c.235 site of GJB2, c.299 site of GJB2, c.427 site of GJB2, c.512 site of GJB2, m.1095 site, m.1494 site and m.1555 site, respectively.

TABLE 11 different amplification primer sequences

Gene	SNP_ID	R-SEQ
			GJB2	235-R3	ACGTTGGATGGTGACACGAAGATCAGCTGC
SLC26A4	1975-R2	ACGTTGGATGTACAAGATATAGCTCCACAG

Comparative example 3

A plurality of groups of different amplification primers are designed according to 26 high-frequency mutation SNP loci, wherein the amplification primers aiming at different gene loci are shown in the following table 12, the rest amplification primers are shown in the table 7, and the amplification detection method is the same as that of example 1. The results of the test are shown in FIG. 11, which shows that there are still 4 sites in the blank with the extension primer peak at c.167 site of GJB2, m.1095 site of mitochondrial 12S rRNA, c.1174 site of SLC26A4 and c.1229 site, respectively.

TABLE 12 different amplification primer sequences

Gene	SNP_ID	R-SEQ
			GJB2	235-R3	ACGTTGGATGGTGACACGAAGATCAGCTGC
SLC26A4	1975-R3	ACGTTGGATCTGAAAGATATAGCTCCACAG

Comparative example 4

Different single base extension primers are designed according to 26 high frequency mutation SNP loci, wherein the extension primers aiming at different gene loci are shown in the following table 13, other extension primers are shown in table 8, the adopted amplification primers are shown in table 7, and the amplification detection method is the same as in example 1. The detection results are shown in FIG. 12, and show that the c.1226 locus and the c.IVS15+5 locus of SLC26A4 have too low extension peak to affect the interpretation of the locus results; whereas 5 sites of the blank (c.167 site, c.235 site, c.257 site, m.1095 site and m.1555 site of mitochondrial 12S rRNA) exhibited extension peaks (FIG. 13); the extended primer at c.538 of GJB3 was interfered with without an extension product peak, affecting site interpretation (fig. 14).

TABLE 13 different extension primer sequences

Gene	SNP	UEP_SEQ
			GJB2	235delC	tACATCCGGCTATGGGCC
SLC26A4	IVS15+5G>A	TCAAGTCCACAGTAA

Comparative example 5

Different single base extension primers are designed according to 26 high frequency mutation SNP loci, wherein the extension primers aiming at different gene loci are shown in the following table 14, other extension primers are shown in the following table 8, the adopted amplification primers are shown in the following table 7, and the amplification detection method is the same as in example 1. The detection results are shown in FIG. 15, and show that the blank control has 4 sites (c.167 site of GJB2, m.1095 site and m.1494 site of mitochondrial 12S rRNA) with extension primer peaks, which affect the interpretation of the above sites; the c.1226 locus of SLC26A4 is low in peak (height < 1), which is not interpretable; the c.IVS15+5 site of SLC26A4 presents a hetero-peak A, affecting the above site interpretation.

TABLE 14 different extension primer sequences

Comparative example 6

Different single base extension primers are designed according to 26 high frequency mutation SNP loci, wherein the extension primers aiming at different gene loci are shown in the following table 15, other extension primers are shown in the following table 8, the adopted amplification primers are shown in the following table 7, and the amplification detection method is the same as in example 1. The detection results are shown in FIG. 16, and show that the blank control has 4 sites (c.167 site of GJB2, c.257 site of GJB2, m.1555 site and m.1494 site of mitochondrial 12S rRNA) with extension primer peaks, which affect the interpretation of the above sites; the c.1226 site of SLC26A4 has a low peak (height < 1) and cannot be interpreted.

TABLE 15 different extension primer sequences

Gene	SNP_ID	UEP_SEQ
			SLC26A4	IVS15+5G>A	aCAAGTCCACAGTAA

Comparative example 7

Designing different amplification and single base extension primer groups according to 26 high-frequency mutation SNP loci, wherein the amplification primers aiming at different gene loci are shown in the following table 16, and the rest amplification primers are the same as in table 7; the extension primers for different gene loci are shown in Table 17 below, the remaining extension primers are as shown in Table 8, and the amplification detection method is as in example 1. The results of the detection are shown in FIG. 17, which shows that the blank has 5 sites (c.235 site of GJB2, c.538 site of GJB3, c.547 site of GJB3, 1095 site and 1555 site of mitochondrial 12S rRNA) with extension primer peaks.

TABLE 16 different amplification primer sequences

Gene	SNP_ID	R-SEQ
			GJB2	235-R2	ACGTTGGATGTGACACGAAGATCAGCTGCA
SLC26A4	1975-R2	ACGTTGGATGTACAAGATATAGCTCCACAG

TABLE 17 different extension primer sequences

In summary, the invention uses multiplex PCR amplification primers and extension primers, selects sample genome DNA as a template, simultaneously amplifies fragments containing specific SNP loci in human genome, uses extension program to extend single base of amplified products, finally uses matrix-assisted laser desorption ionization time-of-flight mass spectrometry technology to distinguish the time of flight, and distinguishes the last base type of the extended products by detecting the time of flight of the extended products in a vacuum tube of a mass spectrometer, thereby analyzing the genotype of the chromosome specific SNP loci and analyzing the genetic deafness specific SNP condition. The primer group for detecting 26 related SNP loci of hereditary hearing loss genes provided by the invention can accurately type 4 SNP locus mutations, short-fragment mutations and mitochondrial genome point mutations of human hereditary hearing loss susceptibility genes in a sample, comprises 4 general hereditary hearing loss mutation loci such as congenital hearing loss, delayed hearing loss, drug-induced hearing loss and the like, can perform more effective neonatal hereditary hearing loss detection, and can perform targeted treatment and medication guidance on the affected infants.

The primer combination provided by the invention further increases the detection sites, can more comprehensively cover more mutation ranges, has high accuracy, high sensitivity and good repeatability, is less in detection time consumption, can detect more mutation sites by using fewer primer combinations and single-tube reaction, simplifies operation, reduces cost, is visual and easy to judge results, and is more suitable for application and popularization of deafness detection.

The above examples are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and any other changes, modifications, substitutions, combinations, and simplifications that do not depart from the spirit and principle of the present invention should be made in the equivalent manner, and the embodiments are included in the protection scope of the present invention.

Claims

1. A primer group for simultaneously detecting 26 deafness susceptibility gene mutation sites based on time-of-flight mass spectrometry, which is characterized by comprising amplification primers shown in SEQ ID NO. 1-20 and single-base extension primers shown in SEQ ID NO. 21-46;

primer pairs shown in SEQ ID NO. 9-10 amplify the locus of rs768245266 (c.916-917 insG) and rs111033313 (IVS 7-2A > G) in the SLC26A4 gene;

primer pairs shown in SEQ ID NO. 17-18 amplify the locus of rs192366176 (IVS15+5G > A) in the SLC26A4 gene;

primer pairs shown in SEQ ID NO. 19-20 amplify sites of rs74315319 (c.538C > T) and rs74315318 (c.547G > A) in the GJB3 gene;

the primer shown in SEQ ID NO.21 extends an rs80338939 (c.35 delG) locus in the GJB2 gene;

the primer shown in SEQ ID NO.22 extends the locus of rs72474224 (c.109G > A) in the GJB2 gene;

the primer shown in SEQ ID NO.23 extends an rs80338942 (c.167delT) locus in the GJB2 gene;

the primer shown in SEQ ID NO.24 extends the locus of rs750188782 (c.176-191 del 16) in the GJB2 gene;

the primer shown in SEQ ID NO.25 extends an rs80338943 (c.235 delC) locus in the GJB2 gene;

the primer shown in SEQ ID NO.26 extends the locus of rs1291519904 (c.257C > G) in the GJB2 gene;

the primer shown in SEQ ID NO.27 extends an rs111033204 (c.299-300 delAT) locus in the GJB2 gene;

the primer shown in SEQ ID NO.28 extends the locus of rs80338948 (c.427C > T) in the GJB2 gene;

the primer shown in SEQ ID NO.29 extends an rs773528125 (c.512 insAACG) locus in the GJB2 gene;

the primer shown in SEQ ID NO.30 extends an rs267606618 (m.1095T > C) locus in the mitochondrial 12S rRNA gene;

the primer shown in SEQ ID NO.31 extends the site of rs267606619 (m.1494C > T) in the mitochondrial 12S rRNA gene;

the primer shown in SEQ ID NO.32 extends the site of rs267606617 (m.1555A > G) in the mitochondrial 12S rRNA gene;

the primer shown in SEQ ID NO.33 extends the locus of rs1057516953 (c.281C > T) in the SLC26A4 gene;

the primer shown in SEQ ID NO.34 extends the rs111033380 (c.589G > A) locus in the SLC26A4 gene;

the primer shown in SEQ ID NO.35 extends the rs768245266 (c.916-917 insG) locus in the SLC26A4 gene;

the primer shown in SEQ ID NO.36 extends the locus of rs111033313 (IVS 7-2A > G) in the SLC26A4 gene;

the primer shown in SEQ ID NO.37 extends the locus of rs201562855 (c.1174A > T) in the SLC26A4 gene;

the primer shown in SEQ ID NO.38 extends the rs111033305 (c.1226G > A) locus in the SLC26A4 gene;

the primer shown in SEQ ID NO.39 extends the rs111033220 (c.1229C > T) locus in the SLC26A4 gene;

the primer shown in SEQ ID NO.40 extends the locus of rs200455203 (c.1975G > C) in the SLC26A4 gene;

the primer shown in SEQ ID NO.41 extends the locus of rs111033318 (c.2027T > A) in the SLC26A4 gene;

the primer shown in SEQ ID NO.42 extends the rs121908363 (c.2162C > T) locus in the SLC26A4 gene;

the primer shown in SEQ ID NO.43 extends the locus of rs121908362 (c.2168A > G) in the SLC26A4 gene;

the primer shown in SEQ ID NO.44 extends an rs192366176 (IVS15+5G > A) locus in the SLC26A4 gene;

the primer shown in SEQ ID NO.45 extends an rs74315319 (c.538C > T) locus in the GJB3 gene;

the primer shown in SEQ ID NO.46 extends the rs74315318 (c.547G > A) locus in the GJB3 gene.

2. The application of the primer group in preparing a product for detecting deafness susceptibility genotyping according to claim 1, wherein the product for detecting deafness susceptibility genotyping refers to a genotyping product for detecting SNP point mutation, short segment mutation and mitochondrial genome point mutation of hereditary deafness susceptibility genes;

the mutation specifically comprises 9 SNP sites of GJB2 gene: rs80338939 (c.35 delg), rs72474224 (c.109G > a), rs80338942 (c.167delt), rs750188782 (c.176-191 del 16), rs80338943 (c.235 delc), rs1291519904 (c.257 c > G), rs111033204 (c.299-300 delAT), rs80338948 (c.427c > T), rs773528125 (c.512 insaacg);

2 SNP loci of GJB3 gene: rs74315319 (c.538C > T), rs74315318 (c.547G > a);

12 SNP loci of SLC26A4 gene: rs1057516953 (c.281C > T), rs111033380 (c.589G > A), rs768245266 (c.916-917 insG), rs201562855 (c.1174A > T), rs111033305 (c.1226G > A), rs111033220 (c.1229C > T), rs200455203 (c.1975G > C), rs111033318 (c.2027T > A), rs121908363 (c.2162C > T), rs121908362 (c.2168A > G), rs111033313 (IVS 7-2A > G), rs192366176 (IVS15+5G > A);

3 SNP loci of the 12S rRNA gene: rs267606618 (m.1095t > C), rs267606619 (m.1494C > T), rs267606617 (m.1555a > G).

3. A product for detecting susceptibility to genotyping for hereditary hearing loss, comprising the primer set of claim 1.

4. A product according to claim 3, wherein the product is a kit.

5. The product of claim 4, further comprising reagents required for PCR amplification, SAP reaction, and single base extension reaction.

6. The product of any one of claims 3-5, wherein the product is suitable for use as a test sample: EDTA anticoagulants and/or dried blood spots.

7. The product of any one of claims 3-5, wherein the product is used in a method comprising the steps of: 95 ℃ for 2min;95℃30s,56℃30s,72℃1min,45 cycles; 72 ℃ for 5min; preserving heat at 4 ℃.

8. The product of any one of claims 3-5, wherein the product is used in a method wherein the single base extension reaction is performed by:

。