CN115678966A - Multi-sample type universal metagenome rapid detection method - Google Patents

Abstract

The application relates to the field of in-vitro diagnosis, in particular to a multi-sample type universal metagenome rapid detection method utilizing third-generation sequencing, which has the technical advantages of compatibility with various types of infection samples, rapidness, high efficiency and the like.

Description

Multi-sample type universal metagenome rapid detection method

Technical Field

The application belongs to the field of in-vitro diagnosis, and particularly relates to a multi-sample type universal metagenome rapid detection method based on nanopore sequencing.

Technical Field

Traditional clinical sample infection determination is based on culture identification, and culture methods often have the problems of long culture time, low culture positive rate (false negative) and the like. With the development of the sequencing industry, the metagenome detection method based on the high-throughput sequencing platform is gradually applied to clinical pathogen detection. The method has the advantages of short identification period and more comprehensive and accurate identification of the infection pathogen. The currently mainstream high-throughput metagenomic sequencing protocols include second generation sequencing methods and third generation sequencing methods. The second-generation high-throughput metagenome sequencing scheme mostly adopts a scheme without host removal, and has the problems of high host data proportion, low pathogen data proportion and large data waste; however, the known third-generation high-throughput macro genome sequencing patent schemes mostly adopt schemes of incomplete host removal, and although the pathogenic data ratio of the third-generation high-throughput macro genome sequencing patent schemes is improved to a certain extent compared with the pathogenic data ratio of the second-generation sequencing schemes, a large amount of host data is wasted.

In view of this, the present application is presented.

Disclosure of Invention

In order to solve the technical problem, the following technical scheme is provided:

the application firstly provides a universal sample processing method suitable for rapid detection of an infected metagenome sample, and the method comprises the following steps:

1) And (3) sample thickening: adding a thickening-releasing agent into the viscous sample, and incubating at constant temperature;

2) Sample pretreatment: taking a non-viscous sample and/or the sample after the de-thickening in the step 1), and centrifuging and collecting precipitates; adding a prepared saponin and HL-SAN enzyme mixed solution into the precipitate, and incubating at constant temperature;

3) Cell wall breaking: taking a pretreated sample, centrifuging, collecting precipitate, adding a lysate for heavy suspension, transferring into a wall breaking tube for wall breaking, and collecting a supernatant after a centrifuge;

4) And (4) extracting nucleic acid.

Further, the de-thickening agent in the step 1) is a self-prepared agent and comprises 0.7-0.8g/100ml NaCl,0.02-0.1g/100ml KCl,0.1-0.2g/100ml Na ₂ HPO ₄ ，0.02-0.1g/ml KH ₂ PO ₄ And 0.5-1M DTT;

preferably, the incubation conditions in step 1) are: incubating at 40-42 deg.C and 300-500rpm for 5-10min.

More preferably, the step 1) is specifically: adding 0.8-1.2ml of de-thickening agent into 150-250ul of viscous sample, mixing well, placing in constant temperature shaking metal bath, incubating at 35-45 deg.C and 300-500rpm for 5-10min.

Further, the enzyme mixed liquor in the step 2) contains saponin with the final concentration of 0.05-0.1% and HL-SAN enzyme with the final concentration of 20-22U/ml; the Buffer of the enzyme mixed solution is a self-prepared reagent and contains 2-2.5g/100ml MgCl ₂ And 29-30g/100ml NaCl;

preferably, the incubation conditions in step 2) are: incubating at 35-40 deg.C and 800-1000rpm for 5-10min.

More preferably, the step 2) is specifically: taking 0.8-1.2ml of non-viscous sample and/or the sample after the de-thickening in the step 1) to be placed in a high-speed centrifuge, centrifuging for 3-5min at 12000-14000g, and collecting the precipitate; adding 150-250ul PBS to the precipitate to resuspend the precipitate, adding mixed solution of saponin and HL-SAN enzyme, immediately mixing, incubating at 35-40 deg.C and 800-1000rpm for 5-10min.

Further, the Lysis Solution in the step 3) is a Lysis Solution of ZYMO; the wall-breaking pipe is a lysine Matrix E wall-breaking pipe; preferably, the wall breaking conditions are as follows: 15-20m/s, and breaking cell wall for 30-120s.

Preferably, the step 3) and the step 4) are specifically: adding 0.8-1ml of PBS into the sample pretreated in the step 2), fully and uniformly mixing, placing in a high-speed centrifuge, 8000-12000g, and centrifuging for 3-5min; collecting the precipitate; adding 550-650ul of lysate into the precipitate for resuspension, transferring into a cracking Matrix E wall tube for wall breaking, placing in a high-speed centrifuge, and centrifuging at 15000-17000g for 1-5min; the supernatant was collected.

Further, the step 4) specifically comprises: adding 350-450ul of buffer solution GB and 20-25ul of protease K into the supernatant collected in the step 3), and incubating for 10-15min at 56-70 ℃; adding 350-450ul of absolute ethyl alcohol, and standing for 5-10min at room temperature; transferring the reaction product into an adsorption column for 2 times, centrifuging at 8000-12000rpm, and discarding the filtrate; adding buffer GD, centrifuging at 8000-12000rpm, and discarding the filtrate; adding rinsing liquid PW for two times, centrifuging at 8000-12000rpm, and discarding filtrate; suspending the solution on a column membrane with nuclease-free water, and centrifuging at 10000-12000rpm for 1-2min to obtain nucleic acid.

Further, the infection metagenome sample includes but is not limited to: sputum, alveolar lavage fluid, peritoneal fluid, empyema drainage fluid, bronchofiberscope flushing fluid and pericardial effusion;

further, the detection is based on a third generation sequencing technology, and the detection of nanopore sequencing is preferred.

Further, the method further comprises the following steps:

5) Evaluation of specific detection of Coccidioides Yersinia: taking a non-viscous and/or non-viscous sample, and performing specific detection on the yersinia sporogenes under the condition of not removing a host;

preferably, the sequences of the primers and probes for specific detection are as follows:

forward primer sequence: CTTAAAATAAATAATCAGACTATGCGATAAG;

reverse primer sequence: GGAGCTTTAATTACTGTTCTGGGC;

the probe sequence is as follows: 6-FAM-AGATAGTCGAAAGGGAAC-BHQ1.

The application also provides a multi-sample type universal metagenome library construction method based on nanopore sequencing, which comprises any one of the steps of the method and further comprises the following steps:

6) Taking extracted nucleic acid, supplementing water, adding an interruption reagent FRM, uniformly mixing, and performing fragmentation treatment;

preferably, the FRM is a Rapid PCR Barcoding Kit component;

7) Adding barcode primer, STAR GXL Buffer, dNTP mix, primeSTAR GXL DNA Polymerase and nucleic-free water to the reaction product of step 6); after mixing, the mixture is placed on a PCR instrument for library amplification.

Preferably, the barcode primer is a Rapid PCR Barcoding Kit component; the other amplification reagent is

GXL DNA Polymerase kit component.

The beneficial technical effects of the application at least include as follows:

1. efficient atomization de-thickening of viscous samples

This application adopts independently designed to separate thick reagent, can realize that thick class sample (like the sputum) realizes atomizing in10 min and separates thick.

2. Efficient one-step pretreatment scheme

The pretreatment scheme of the application realizes the high-efficiency removal of host cells based on the principle of differential lysis; compared with the literature or the prior invention, the method optimizes the reaction system, simplifies the reaction steps, prepares the saponin solution, the HL-SAN Buffer and the HL-SAN enzyme together with the sample into the reaction system, realizes the high-efficiency one-step removal of the host cells, and can realize the removal of more than 99 percent of the host cells within 10min.

3. The pretreatment scheme has high universality

The method optimizes the reaction system without host, realizes universality of multiple sample types (including sputum, alveolar lavage fluid, peritoneal fluid, abscess drainage fluid, bronchofiberscope flushing fluid and the like), and does not need to adjust the concentration and usage amount of saponin, HL-SAN Buffer and HL-SAN enzyme in the reaction system aiming at different sample types.

4. Sequencing data volume requirement reduction

According to the method, the host cells are efficiently removed by more than 99%, the data percentage of pathogenic bacteria is obviously improved, the requirement amount of sequencing data is obviously reduced, and the data cost of sequencing is greatly reduced.

5. High detection timeliness

The method and the device have the advantages that the flow is simple, the full-period detection time (from the sample to the laboratory to the detection report) only needs 6 hours, the detection period of the clinical sample is greatly shortened, the detection result of the sample in the same day is realized, and the method and the device are favorable for the clinician to carry out targeted and accurate treatment on the patient.

6. Specific detection of yersinia pneumocystis

Aiming at the influence of the host removal process on the detection of the yersinia pneumocystis, the specific QPCR verification of the yersinia pneumocystis is carried out in a targeted manner, so that the condition that the detection omission of the yersinia pneumocystis caused by host removal is effectively avoided.

Drawings

FIG. 1 shows the results of capillary electrophoresis of nucleic acids under different wall-breaking conditions.

Figure 2 effect of self-prepared de-thickening agent compared to finished de-thickening agent.

FIG. 3 shows QPCR effect of Yersinia primer probe method.

FIG. 4 QPCR Effect graph of Yersinia primer dye method.

Detailed Description

Embodiments of the present application will be described in detail below with reference to examples, but those skilled in the art will appreciate that the following examples are only illustrative of the present application and should not be construed as limiting the scope of the present application. The examples, in which specific conditions are not specified, were carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are conventional products which are not indicated by manufacturers and can be obtained by market purchase.

Definitions of some terms, unless defined otherwise below, all technical and scientific terms used in the detailed description of the present application are intended to have the same meaning as commonly understood by one of ordinary skill in the art. While the following terms are believed to be well understood by those skilled in the art, the following definitions are set forth to better explain the present application.

The term "about" in the present application denotes an interval of accuracy that can be understood by a person skilled in the art, which still guarantees the technical effect of the feature in question. The term generally denotes a deviation of ± 10%, preferably ± 5%, from the indicated value.

As used in this application, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude additional unrecited elements or method steps. The term "consisting of 8230A" is considered to be a preferred embodiment of the term "comprising". If in the following a certain group is defined to comprise at least a certain number of embodiments, this should also be understood as disclosing a group which preferably only consists of these embodiments.

Furthermore, the terms first, second, third, (a), (b), (c) and the like in the description and in the claims are

Are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments described herein are capable of operation in other sequences than described or illustrated herein.

The universal sample processing method suitable for the rapid detection of the infection metagenome sample generally comprises the following steps:

1) And (3) sample thickening: adding a thickening-releasing agent into the viscous sample, and incubating at constant temperature;

2) Sample pretreatment: taking a non-viscous sample and/or the sample after the de-thickening in the step 1), and centrifuging and collecting precipitates; adding a prepared saponin and HL-SAN enzyme mixed solution into the precipitate, and incubating at constant temperature;

3) Cell wall breaking: taking a pretreated sample, centrifuging, collecting precipitate, adding a lysate for heavy suspension, transferring into a wall breaking tube for wall breaking, and collecting a supernatant after a centrifuge;

4) Nucleic acid extraction, and the like.

The de-thickening agent in the step 1) of the method is independently designed and optimized through experiments, and as shown in an embodiment of fig. 2, the de-thickening agent is self-prepared, so that a sample can be completely de-thickened within 5min, while a commercial de-thickening agent still has partial floccules within 5minThe viscosity-releasing effect equivalent to that of the self-prepared reagent is achieved in a state of 10min. The self-prepared thickening-releasing reagent can realize that a viscous sample (such as sputum) can be fully atomized and thickened within 5-10min, and is obviously superior to a commercial thickening-releasing agent in the aspects of timeliness and atomization effect. Specifically, the components comprise 0.7-0.8g/100ml NaCl,0.02-0.1g/100ml KCl,0.1-0.2g/100ml Na ₂ HPO ₄ ，0.02-0.1g/ml KH ₂ PO ₄ And 0.5-1M DTT.

In some embodiments, the incubation conditions in step 1) are: incubating at 40-42 deg.C and 300-500rpm for 5-10min.

In some more specific embodiments, the step 1) is specifically: adding 0.8-1.2ml of de-thickening agent into 150-250ul of viscous samples, mixing well, placing in a constant temperature shaking metal bath, incubating at 35-45 deg.C and 300-500rpm for 5-10min.

In order to effectively save the time of the whole process, the method removes the host through a mixing one-step method, can realize the high-efficiency removal of more than 99 percent of host cells within 5-10min, and has obviously better effect than the traditional method without removing the host. Moreover, the method has the effect similar to the effect of sequentially adding saponin and adding HL-SAN step methods in the earlier commonly used host removing process, so that the one-step method can be applied to the metagenome rapid detection of the application, and the operation time is effectively saved.

In addition, in order to meet the requirements of general treatment and sequencing detection of various infection samples, the application also optimizes and explores the concentrations of saponin, HL-SAN and the like.

In some embodiments, the enzyme mixture in step 2) comprises saponin with a final concentration of 0.05-0.1% and HL-SAN enzyme with a final concentration of 20-22U/ml; the Buffer of the enzyme mixed solution is a self-prepared reagent and contains 2-2.5g/100ml MgCl ₂ And 29-30g/100ml NaCl;

in some embodiments, the incubation conditions in step 2) are: incubating at 35-40 deg.C and 800-1000rpm for 5-10min.

In some embodiments, said step 2) is specifically: taking 0.8-1.2ml of non-viscous sample and/or the sample after being de-thickened in the step 1), placing the sample in a high-speed centrifuge, centrifuging for 3-5min at 12000-14000g, and collecting precipitate; adding 150-250ul PBS to the precipitate to resuspend the precipitate, adding mixed solution of saponin and HL-SAN enzyme, immediately mixing, incubating at 35-40 deg.C and 800-1000rpm for 5-10min.

In the process of extracting DNA nucleic acid, the cracking Solution, the wall breaking tube and the operation conditions are optimally selected, and in some embodiments, the cracking Solution in the step 3) is a lysine Solution cracking Solution of ZYMO; the wall-breaking pipe is a lysine Matrix E wall-breaking pipe; preferably, the wall breaking conditions are as follows: 15-20m/s, and breaking cell wall for 30-120s.

In some embodiments, the step 3) and the step 4) are specifically: adding 0.8-1ml of PBS into the sample pretreated in the step 2), fully and uniformly mixing, placing in a high-speed centrifuge, 8000-12000g, and centrifuging for 3-5min; collecting the precipitate; adding 550-650ul of lysis solution into the precipitate, resuspending, transferring into a lysine Matrix E wall-breaking tube for wall breaking, and centrifuging at 15000-17000g for 1-5min in a high-speed centrifuge; the supernatant was collected.

In some embodiments, the step 4) is specifically: adding 350-450ul of buffer solution GB and 20-25ul of protease K into the supernatant collected in the step 3), and incubating for 10-15min at 56-70 ℃; adding 350-450ul of absolute ethyl alcohol, and standing for 5-10min at room temperature; transferring the reaction product into an adsorption column for 2 times, centrifuging at 8000-12000rpm, and discarding the filtrate; adding buffer GD, centrifuging at 8000-12000rpm, and discarding the filtrate; adding rinsing liquid PW for two times, centrifuging at 8000-12000rpm, and discarding filtrate; suspending the solution on a column membrane with nuclease-free water, and centrifuging at 10000-12000rpm for 1-2min to obtain nucleic acid.

The embodiments of the present application have confirmed the treatment effects of various samples including a focal lavage fluid, a pericardial effusion, an alveolar lavage fluid, a sputum, a bronchofiberscope rinse fluid, etc., and thus the infection metagenome samples treated by the method of the present application include, but are not limited to: sputum, alveolar lavage fluid, peritoneal fluid, empyema drainage fluid, bronchofiberscope flushing fluid, pericardial effusion and the like;

the detection of the application is based on the third generation sequencing technology, and preferably is based on nanopore sequencing.

In order to solve the problem of false positive caused by the loss of individual pathogenic microorganisms in the sample treatment process, the application confirms the loss of the pneumocystis yezoensis after repeated analysis. Therefore, aiming at the problem of false negative detection of the yersinia sporogenes introduced by the host removing process, the application develops a supplementary detection process aiming at the yersinia sporogenes.

Thus, in some embodiments, the above method further comprises the steps of:

5) Evaluation of specific detection of Coccidioides Yersinia: taking a non-viscous and/or non-viscous sample, and performing specific detection on the yersinia sporogenes under the condition of not removing a host;

preferably, the sequences of the primers and probes for specific detection are as follows:

forward primer sequence: CTTAAAATAAATAATCAGACTATGCGATAAG;

reverse primer sequence: GGAGCTTTAATTACTGTTCTGGGC;

the probe sequence is as follows: 6-FAM-AGATAGTCGAAAGGGAAC-BHQ1.

On the basis of the sample processing method, the application also provides a multi-sample type universal metagenome library construction method based on nanopore sequencing, which comprises the following steps besides any one of the steps of the method:

6) Taking extracted nucleic acid, supplementing water, adding an interruption reagent FRM, uniformly mixing, and performing fragmentation treatment;

in some embodiments, the FRM disrupting agent is a Rapid PCR Barcoding Kit component;

7) Adding barcode primer, STAR GXL Buffer, dNTP Mixture, primeSTAR GXL DNA Polymerase and nucleic-free water to the reaction product of step 6); after mixing, the mixture is placed on a PCR instrument for library amplification.

In some embodiments, the barcode primer is a Rapid PCR Barcoding Kit component; the other amplification reagent is

GXL DNA Polymerase kit component.

The application is illustrated below with reference to specific examples.

EXAMPLE 1 exploration and optimization of the methods of the present application

The application aims to obtain a sample pretreatment system and method which are general in infection sample types, meet sequencing detection requirements and can be fast and efficient. In order to achieve the purpose, the present application tries to search and optimize from various aspects such as sample thickening, pretreatment, nucleic acid extraction, and the like, and specifically, the following experimental examples are given.

Optimization example 1 optimization of pretreatment concept

For fully compressing the pretreatment time, the method tries to compress various steps together in the idea of going to the host through exploration, solution systems such as saponin and DNA digestive enzyme are added and mixed to prepare a mixed system, and in the actual pretreatment process, the one-step treatment is tried to be realized by directly adding the mixed system.

1.1 Experimental methods

1.1.1 clinical viscous samples and non-viscous samples are respectively selected as test objects, and 2 equal parts of each sample are taken and placed in a new centrifuge tube after each sample is homogenized. Wherein 150-250ul of the viscous sample is sampled and used for subsequent extraction after being de-thickened, and 0.8-1.2ml of the non-viscous sample is used for subsequent treatment.

1.1.2 centrifuging the sample at 12000-14000g for 3-5min, and removing supernatant to enrich precipitate;

1.1.3 adding saponin solution, HL-SAN buffer and HL-SAN enzyme into 1 sample in the parallel test at one time; taking the other parallel sample precipitate as a control group, and directly carrying out the step 1.1.5 without adding a host removing reagent;

1.1.4 reaction system is incubated for 5-10min at 37 ℃ and 300-500rpm, 0.8-1.2ml PBS is added to be mixed fully and evenly, the mixture is placed in a high-speed centrifuge and centrifuged for 3-5min at 12000-14000g, and the supernatant is discarded.

1.1.5 adding PBS into the precipitate for resuspension, breaking the wall of the wall by a wall breaking instrument, centrifuging, and extracting supernatant with the same volume.

1.1.6 extraction of nucleic acid was performed according to the instructions of the kit for extracting genomic DNA from the microtest root samples.

1.1.7 extracted nucleic acids were subjected to QPCR assays for human and 16S.

1.1.8 wherein the human QPCR reaction Froward Primer is TGAAGCCGTGGAAGG.

Wherein the Reverse Primer for the human QPCR reaction is ACAGAGAGAGCCAAGTGTCG.

Wherein the Probe Primer for the human QPCR reaction is TACCACGTCTCCTTTGATGGCTCCTAT.

Wherein the 16S QPCR reaction Froward Primer is TCGTCGGCAGCGTCAGAGTGTATAAGAGACAGCCTACGGGGNGGCWGCAG.

Wherein the 16S QPCR reaction Reverse Primer is GTCTCGTGGGCTCGGAGATGTATAAGAGACAGGACTACGGGGTATCTAATCC.

1.2 conclusion of the experiment is shown in Table 1

TABLE 1 one-step host background removal Effect

Therefore, the mixed one-step method can remove the host, can realize the high-efficiency removal of more than 99 percent of host cells within 5-10min, and has obviously better effect than the traditional method without removing the host. In addition, the method has similar effect to the step-by-step method of sequentially adding saponin and adding HL-SAN in the previous commonly used host removing process, so that the one-step method can be applied to the metagenome rapid detection of the application, and the operation time is effectively saved.

Optimization example 2, optimization of saponin concentration in pretreatment process

Based on the above one-step treatment concept, the present example continues to optimize the saponin addition concentration in the system.

2.1 Experimental methods

2.1.1 clinical viscous samples (such as sputum) and non-viscous samples (such as alveolar lavage fluid, peritoneal fluid and the like) are respectively selected as test objects, and after each sample is homogenized, 4 equal parts of the samples are taken and placed in a new centrifuge tube. Wherein 200ul of the viscous sample is sampled and used for subsequent extraction after being de-thickened, and 1ml of the non-viscous sample is taken for subsequent treatment.

2.1.2 adding saponin solution with final concentration of 0.05%,0.1%, 1.0% and 2.2% into 4 centrifuge tubes of the same sample, and keeping the usage amount of HL-SAN buffer and HL-SAN enzyme consistent.

2.1.3 the reaction system is incubated for 5-10min at 37 ℃ and 300-500rpm, 0.8-1.2ml of PBS is added to be fully and evenly mixed, the mixture is placed in a high-speed centrifuge, 12000-14000g of the mixture is centrifuged for 3-5min, and the supernatant is discarded.

2.1.4 adding 150-250ul PBS into the host removing sediment for resuspension, centrifuging after wall breaking by a wall breaking instrument, and extracting supernatant with the same volume.

2.1.5 extraction of nucleic acid was performed according to the instructions of the kit for extracting genomic DNA from the microtest root samples.

2.1.5 concentration determination of the extracted nucleic acid of Qubit4.0 was performed by taking 1ul of the nucleic acid.

2.1.6 extracted nucleic acids were subjected to QPCR assays for human and 16S.

Wherein the human QPCR reaction Froward Primer is TGAAGCCGTGGAAGG.

Wherein the Reverse Primer for the human QPCR reaction is ACAGAGAGAGCCAAGTGTCG.

Wherein the Probe Primer for the human QPCR reaction is TACCACGTCCTTTGATGGCTCCTAT.

Wherein the 16S QPCR reaction Froward Primer is TCGTCGGCAGCGTCAGAGTGTATAAGAGACAGCCTACGGGGNGGCWGCAG.

Wherein the 16S QPCR reaction Reverse Primer is GTCTCGTGGGCTCGGAGATGTATAAGAGACAGGACTACGGGGTATCTAATCC.

2.2 results of the experiment

The test statistics are shown in table 1 below:

TABLE 1 removal of extraction hosts at different saponin addition concentrations

It can be seen that there are significant differences in the concentration of extracted nucleic acid at different saponin concentrations, where the concentration of extracted nucleic acid at 0.05% and 0.1% final concentrations of saponin addition is significantly lower than 1.00% and 2.2% concentration at which extraction can be read; the human QPCR results show that the human background removal effect at the concentration of 0.05% and 0.1% is better than that at the concentration of 1.00% and 2.2%; the 16S QPCR results showed no significant difference in the content of microbial nucleic acids in the extracted sample nucleic acids at different saponin concentrations. Considering that a set of sample type universal pretreatment system is to be established in the application, the addition of the low-concentration saponin is finally selected to be 0.05-0.1% in the flow of the invention.

Optimization example 3 optimization of the cleavage solution in the DNA nucleic acid extraction Process

In the process of extracting nucleic acid, the efficient lysate can effectively crack cells to release the nucleic acid in the package, and can also effectively inhibit the damage of the nuclease in the package to the nucleic acid, thereby ensuring the integrity of the nucleic acid. In practice, due to the efficient one-step method for host removal, the extraction concentration of a sample after host removal is low, and even the concentration cannot be measured. The invention carries out corresponding tests aiming at the extraction effects of different lysates.

3.1 Experimental methods

3.1.1 clinical viscous and non-viscous samples were selected as test subjects, and 3 aliquots of each sample were taken after homogenization in a new centrifuge tube. Wherein 150-250ul of the viscous sample is sampled and used for subsequent extraction after being de-thickened, and 0.8-1.2ml of the non-viscous sample is used for subsequent extraction.

3.1.2 the sample is placed in a high-speed centrifuge, centrifuged for 3-5min at 12000-14000g, and the supernatant is discarded.

3.1.3 adding 550-650ul PBS, buffer GB and lysine solution (ZYMO, D4300-1-40/D4300-1-150) to 3 deposits of the same sample, re-suspending, breaking the wall of the wall breaking instrument, centrifuging, and extracting the supernatant with the same volume.

3.1.4 extraction of nucleic acid was performed according to the instructions of the kit for extracting genomic DNA from the microtest root samples.

3.1.5 the extracted nucleic acids were subjected to concentration determination of Qubit4.0.

3.2 results of the experiment

The test statistics are shown in table 3 below.

TABLE 3 extraction Effect of different lysates

Therefore, after the host is removed from the sample, different lysates are added, and the concentration of the extracted nucleic acid is obviously different. Wherein the Lysis solution (ZYMO) was used, and the concentration of the extracted nucleic acid was the highest. According to the comprehensive test result, the Lysis solution (ZYMO) is finally selected as the lysate to carry out the heavy suspension of the host removal product in the process.

Optimization example 4 wall breaking conditions optimization in DNA nucleic acid extraction Process

In practice, the nanopore sequencing platform provided by the invention has the advantage of long length, and has a high requirement on the integrity of the initial nucleic acid for library construction. The wall breaking instrument can physically shear the released nucleic acid while breaking the cell wall, thereby affecting the integrity of the nucleic acid. This example tested and optimized the extraction effect under the different broken wall conditions in the pretreatment process.

4.1 Experimental methods

4.1.1 clinical samples were selected as test subjects, and 6 aliquots of each sample were collected after homogenization and placed in new centrifuge tubes. Wherein the sample is a viscous sample, 150-250ul of the sample is sampled, and the sample is used for subsequent extraction after being de-viscous.

4.1.2 the sample is placed in a high speed centrifuge, centrifuged for 3-5min at 12000-14000g, and the supernatant is discarded.

4.1.3 resuspension was performed by adding 550-650ul Lysis solution (ZYMO) to each of 6 pellets of the same sample.

4.1.4 the wall-breaking tubes are respectively placed on a wall-breaking instrument, and wall-breaking reactions are respectively carried out for 30S, 1min, 2min, 3min, 4min and 5min at 15-20 m/S.

4.1.5 after the wall breaking, high speed centrifugation is carried out, and the supernatant with the same volume is extracted.

4.1.6 nucleic acid extraction was performed according to the instructions of the Tiangen micro-sample genomic DNA extraction kit.

4.1.7 concentration determination of the extracted nucleic acids by Qubit4.0.

4.1.8 extracted nucleic acids were subjected to QPCR assay of human origin and 16S.

4.1.9 the extracted nucleic acid was subjected to Agilent Fragment Analyzer 5200 full-automatic capillary electrophoresis detection.

4.2 results of the experiment

The test statistics are shown in table 4 below.

Table 4 extraction results under different wall-breaking conditions

Therefore, the concentration of the nucleic acid extracted from the test sample under different wall-breaking conditions has no obvious difference. The results of the 16S QPCR test showed no significant difference in the microbial content of the nucleic acids extracted under the different wall-breaking conditions (Table 4). The results of capillary electrophoresis (FIG. 1) show that the integrity of nucleic acid has no obvious change under the wall breaking conditions of 15-20m/s and 30-120s. According to the comprehensive test result, 15-20m/s and 30-120s are finally selected as the cell wall breaking conditions in the extraction process.

Optimization example 5 search optimization of thickener

The application also explores through experiments, and a thickening-removing agent for viscous samples such as sputum and the like is autonomously prepared, wherein the working solution of the thickening-removing agent contains 0.7-0.8g/100ml NaCl,0.02-0.1g/100ml KCl,0.1-0.2g/100ml Na ₂ HPO _4， 0.02-0.1g/100ml KH ₂ PO ₄ And 0.5-1M/L DTT.

5.1 Experimental methods

5.1.1 selecting clinical sputum sample as test object, homogenizing sample, taking 2 equal parts and placing in new centrifuge tube.

5.1.2 self-formulated de-densifier (experimental group) and commercial de-densifier a (control group) were added to step 5.1.1 tubes, respectively.

Fully and uniformly mixing;

5.1.3 the sample is placed on a constant temperature shaking metal bath for the de-thickening reaction.

Wherein the de-thickening conditions are 40-42 ℃ and incubation for 5-10min at 300-500 rpm.

5.1.4 record the de-thickening state of the control sample every 2-3 min.

5.2 results of the experiment

The de-thickening comparison result is shown in figure 2, through a parallel comparison test, the self-prepared de-thickening reagent can fully de-thicken a sample within 5min, and the commercial de-thickening agent still has partial floccules within 5min, and the de-thickening effect equivalent to that of the self-prepared reagent is achieved only in a 10min state. Therefore, the self-prepared viscosity-releasing reagent can realize that a viscous sample (such as sputum) is fully atomized and viscosity-released within 5-10min, and is obviously superior to a commercial viscosity-releasing reagent in the aspects of timeliness and atomization effect.

Example 2 establishment of the method System of the present application

Through the exploration and optimization of the experimental examples 1-5, the application finally determines a nanopore sequencing-based multi-sample type universal metagenome rapid detection method, which comprises the following specific steps:

the specific method of the multi-sample type universal metagenome rapid detection method based on nanopore sequencing comprises the following steps:

1 De-thickening of viscous samples

1.1 preparation of reagents

1.1.1 and mixing according to the proportion that 5-7 mu L of DTT is added into each 0.8-1mL of the mother solution of the de-thickening agent to prepare de-thickening working solution.

Wherein the de-thickening agent comprises 0.7-0.8g/100ml NaCl,0.02-0.1g/100ml KCl,0.1-0.2g/100ml Na ₂ HPO ₄ ，0.02-0.1g/100ml KH ₂ PO ₄ 。

1.1.2 weighing appropriate amount of saponin powder, diluting with clean-free water, dissolving into 1-2% working solution, filtering with 0.22 μm filter membrane, and storing in shade.

1.2 De-thickening operation

1.2.1 take 150-250ul of viscous sample and transfer to a 2.0mL centrifuge tube, and add 1-1.2mL of prepared de-thickening working solution.

1.2.2, mixing, placing in a constant temperature shaking metal bath, incubating at 40-42 deg.C and 300-500rpm for 5-10min;

1.2.3 after the de-thickening reaction is completed, the sample is taken down for the next host operation.

2 pretreatment of samples

2.1 sample De-hosting

2.1.1 taking a non-sticky sample and/or a sticky sample with good de-sticky property for 0.8-1.2mL, and placing the samples in a 2.0mL centrifuge tube; meanwhile, 0.8-1.2mL of negative quality control material is placed in a prepared 2.0mL centrifuge tube and marked as NC.

2.1.2 placing the sample tube in a high-speed centrifuge, and centrifuging for 3-5min at 12000-14000 g.

2.1.3 discard the supernatant without touching the pellet.

2.1.4 Add 150-250. Mu.L of PBS to resuspend the pellet.

2.1.5 adding 35-45 μ L of prepared 1-2% saponin solution, 150-250 μ L of HL-SAN Buffer, and 8-10 μ L of HL-SAN enzyme. Wherein the final concentration of saponin is 0.05% -0.1%, and the final concentration of HL-SAN enzyme is 20U-22.2U/ml. Wherein said HL-SAN Buffer comprises 2-2.5g/100ml MgCl ₂ And 29-30g/100ml NaCl.

2.1.6, fully and uniformly mixing, and placing on a constant-temperature oscillation metal bath for reaction. Wherein the reaction condition is incubation for 5-10min at 35-40 ℃ and 300-500 rpm.

2.1.7 adding 0.8-1mL of PBS solution into the sample after the reaction is finished, fully and uniformly mixing, placing in a high-speed centrifuge, centrifuging for 3-5min at 12000-14000g, removing the supernatant, and precipitating to be subjected to the next extraction work.

2.1.8 removing the host, and simultaneously taking 0.8-1.2mL of sample stock solution to be placed in a 2.0mL centrifuge tube; centrifuging at 12000-14000g for 3-5min, enriching and precipitating, and directly extracting DNA nucleic acid as the parallel without host removal.

2.2 DNA nucleic acid extraction

2.2.1 resuspend the pellet by adding 550-650. Mu.L of lysate to the host or stock solution. Wherein the lysate is lysine Solution (ZYMO).

2.2.2 the resuspended samples were all transferred to a Lysing Matrix E casing tube.

2.2.3 wall breaking was performed using JXFSTPRP-4D. Wherein the wall breaking condition is 15-20m/S, and the operation is carried out once in 30-120S.

2.2.4 after the wall breaking, placing in a high-speed centrifuge, and centrifuging for 1min at 15000-17000 g.

2.2.5 sucking 350-450. Mu.L of supernatant and transferring into a new 2.0ml centrifuge tube, and finishing the extraction of DNA nucleic acid according to the flow instruction of the micro-sample genome DNA extraction kit (Tiangen).

2.2.6 extraction complete DNA nucleic acids were quantified using Qubit4.0.

3 metagenomic library construction

The application uses Rapid PCR Barcoding Kit (ONT) and

GXL DNA Polymerase (TAKARA) realizes the construction of a metagenomic library; the method comprises the following steps:

3.1 fragmentation of DNA

3.1.1 prepare a new 0.2mL PCR tube, add DNA sample and FRM sequentially, and nucleic free water to supplement the reaction volume to 8 μ. Wherein the total amount of nucleic acid in the sample is not more than 10ng, and the volume of nucleic acid is not more than 6ul. Wherein the dosage of the FRM is 2ul.

3.1.2 flick and mix evenly, centrifuge instantaneously, and react on the PCR instrument. Wherein the reaction conditions are 1min at 30 ℃ and 1min at 80 ℃.

3.2 PCR amplification

3.2.1 to the product of the fragmentation product reaction, different barcode primers were added sequentially.

Wherein the amount of barcode primer added is 2ul.

3.2.2 Add 20ul 5 XPrimeSTAR GXL Buffer,8ul dNTP mix and 4ul PrimeSTAR GXL DNA Polymerase in this order. Nuclean free water was added to supplement the reaction volume to 100. Mu.L.

3.2.3 flick and mix evenly, centrifuge instantaneously, and carry out amplification reaction on a PCR instrument.

Wherein the amplification reaction conditions are pre-denaturation at 98 ℃ for 2min, circulation at 98 ℃ for 15s, circulation at 56 ℃ for 15s, circulation at 68 ℃ for 45s, and compensation at 68 ℃ for 4min.

3.2.4 the amplified library was quantified using Qubit4.0.

4 library pooling purification

4.1 amplifying qualified library, and performing pooling of the library according to the equal mass mixing principle. Wherein the library is 100-200ng.

4.2Pooling well-mixed libraries were subjected to DNA Clean Beads purification. Wherein the dosage of the DNA Clean Beads is 1/2 volume of the Pooling solution.

4.3Pooling purified product was finally eluted using 12-15ul of elution reagent. Wherein, the elution reagent component is 10M Tris-HCL &50mM NaCl.

4.4 elution libraries were quantified using Qubit.

5 machine sequencing

The on-machine sequencing reaction of the library is completed on a testing instrument by adopting Flow Cell Priming Kit (EXP-FLP 002) and Flow Cell (FLO-MIN 106D) reagents and chips recommended by ONT officials. Wherein the sequencing instrument comprises GridION MK1 and MINION.

6 data analysis and report interpretation

And performing comparison analysis on the off-line data by using a related database, and reading the pathogen detection condition according to the analysis result to finally form a detection report.

Example 3 QPCR specific detection of Pyellospora Yersiniae

The present inventors have found that, in the treatment of samples using the above-described decolonization technique, it seems that there is a loss of individual pathogenic microorganisms, and that, after repeated analyses, there is a loss of pneumocystis yersinica. Therefore, aiming at the problem of false negative detection of the yersinia sporogenes introduced by the host removing process, the application develops a supplementary detection process aiming at the yersinia sporogenes, optimally designs a group of specific primers and probes through the analysis of biological data, and performs QPCR verification on the possibly existing yersinia sporogenes.

The verification method comprises the following steps:

1) Probe-procedure QPCR validation of jejunum: 2ul of nucleic acid extracted from the host was taken and added to 0.4ul Primer Forward, 0.4ul Primer Reverse, 0.4ul Primer Probe and 10ul 2 XSGACEL GoldStar TaqMan mix, respectively, and nucleic-Free water was supplemented to 20ul final volume.

2) Dye-method jerry QPCR validation: 2ul of nucleic acid extracted from the host was taken and added to 0.4ul Primer Forward, 0.4ul Primer Reverse and 10ul 2 × AceQ Universal SYBR qPCR Master Mix, respectively, and nucleic-Free water was supplemented to a final volume of 20ul.

Wherein the 2 × SGexcel GoldStar TaqMan mix is a finished kit from Takara; 2 × AceQ Universal SYBR qPCR Master Mix from Vazyme company finished product kit.

Wherein, the verification samples are subjected to 2-3 repeated-hole repeated detection.

Wherein, the reaction takes the DNA nucleic acid of the yersinia pneumocystis as a positive reference substance and takes the nucleic-Free water as a negative reference substance.

Wherein the primer Forward primer sequence is CTTAAAATAAATAATCAGACTATGCGATAAG.

Wherein the primer Reverse primer sequence is GGAGCTTTAATTACTGTTCTGGGC.

Wherein the primer Probe primer sequence is AGATAGTCGAAAGGGAAC.

Wherein the primer Probe primer sequence is modified to be 5'6-FAM,3' BHQ1.

3) The reaction system is placed on a QPCR instrument for reaction. Wherein the reaction conditions are pre-denaturation at 95 ℃ for 3min, cycle at 95 ℃ for 15s,55 ℃ for 20s and cycle number at 72 ℃ for 25s of 40-45cycles.

Wherein fluorescence is collected at said 72 ℃ for 25 s.

4) And determining the peak type change and the fluorescent signal collection condition of the sample to be detected by taking the positive reference substance as reference, and judging whether the sample to be detected contains the infection of the yersinia sporophyte.

As shown in FIGS. 3 and 4, the primer probe system has very high specificity and sensitivity. Whether probe (amplification curve) or dye (lysis curve) can be used to effectively identify a positive for the yerba; meanwhile, the method has high tolerance (no miscellaneous peak, negative and no amplification) on the interference of miscellaneous bacteria nucleic acid.

Example 4 clinical sample testing

The clinical experimental detection aims at an EICU 68-year-old male patient who complains of dry cough, is lack of strength for 10 days with fever and is asthmatic and suffocated for 3 days; the traditional culture results were negative.

This example collected a sample of alveolar lavage fluid from the lower respiratory tract of this patient, transported to the laboratory at 4 ℃ and tested by the procedure of examples 2-3.

Quantitative detection and report interpretation are carried out by adopting the process of the application, and the detection results are shown in the following table. The result shows that by adopting the process, the effective removal of the host background of the clinical sample can be realized, and the detection and report of the positive pathogen infection can be realized within 1h of sequencing.

Finally, it should be noted that: the above embodiments are only used for illustrating the technical solutions of the present application, and not for limiting the same; although the present application has been described in detail with reference to the foregoing embodiments, it should be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and these modifications or substitutions do not depart from the scope of the technical solutions of the embodiments of the present application.

Claims (10)

1. A universal sample processing method suitable for rapid detection of an infected metagenome sample is characterized by comprising the following steps:

1) Sample de-thickening: adding a thickening-releasing agent into the viscous sample, and incubating at constant temperature;

2) Sample pretreatment: taking a non-viscous sample and/or the sample after the de-thickening in the step 1), and centrifuging and collecting precipitates; adding a prepared saponin and HL-SAN enzyme mixed solution into the precipitate, and incubating at constant temperature;

3) Breaking cell walls: centrifuging the pretreated sample, collecting precipitate, adding a lysis solution for resuspension, transferring into a wall-breaking tube for wall breaking, centrifuging, and collecting the supernatant;

4) And (4) extracting nucleic acid.

2. The sample processing method of claim 1,

the de-thickening agent in the step 1) is a self-prepared reagent and comprises 0.7-0.8g/100ml NaCl,0.02-0.1g/100ml KCl,0.1-0.2g/100ml Na ₂ HPO ₄ ，0.02-0.1g/ml KH ₂ PO ₄ And 0.5-1M DTT;

preferably, the incubation conditions in step 1) are: incubating at 40-42 deg.C and 300-500rpm for 5-10min.

3. The method according to any one of claims 1 to 2,

the enzyme mixed solution in the step 2) contains saponin with the final concentration of 0.05-0.1% and HL-SAN enzyme with the final concentration of 20-22U/ml; the Buffer of the enzyme mixed solution is a self-prepared reagent and contains 2-2.5g/100ml MgCl ₂ And 29-30g/100ml NaCl;

preferably, the incubation conditions in step 2) are: incubating at 35-40 deg.C and 800-1000rpm for 5-10min.

4. The method according to any one of claims 1 to 3,

the lysate in the step 3) is ZYMO lysine Solution lysate;

the wall-breaking pipe is a lysine Matrix E wall-breaking pipe;

preferably, the wall breaking conditions are as follows: 15-20m/s, and breaking cell wall for 30-120s.

5. The method of any one of claims 1-4, wherein the infection metagenomic sample includes, but is not limited to: sputum, alveolar lavage fluid, peritoneal dialysis fluid, empyema drainage fluid, bronchofiberscope flushing fluid and pericardial effusion.

6. The method of any one of claims 1-4, wherein the detection is based on a third generation sequencing technique; preferably, the third generation sequencing technology is a nanopore sequencing technology.

7. The method according to any one of claims 1 to 6,

the step 1) is specifically as follows: adding 0.8-1.2ml of de-thickening agent into 150-250ul of viscous samples, mixing well, placing in a constant temperature shaking metal bath, incubating at 35-45 deg.C and 300-500rpm for 5-10min.

The step 2) is specifically as follows: taking 0.8-1.2ml of non-viscous sample and/or the sample after the de-thickening in the step 1) to be placed in a high-speed centrifuge, centrifuging for 3-5min at 12000-14000g, and collecting the precipitate; adding 150-250ul PBS into the precipitate, resuspending the precipitate, adding mixed solution of saponin and HL-SAN enzyme, immediately mixing, incubating at 35-40 deg.C and 800-1000rpm for 5-10min.

8. The method according to any one of claims 1 to 7,

the step 3) is specifically as follows: adding 0.8-1ml of PBS into the sample pretreated in the step 2), fully and uniformly mixing, placing in a high-speed centrifuge, 8000-12000g, and centrifuging for 3-5min; collecting the precipitate; adding 550-650ul of lysate into the precipitate for resuspension, transferring into a cracking Matrix E wall tube for wall breaking, placing in a high-speed centrifuge, and centrifuging at 15000-17000g for 1-5min; the supernatant was collected.

The step 4) is specifically as follows: adding 350-450ul of buffer solution GB and 20-25ul of protease K into the supernatant collected in the step 3), and incubating for 10-15min at 56-70 ℃; adding 350-450ul of anhydrous ethanol, and standing at room temperature for 5-10min; transferring the reaction product into an adsorption column for 2 times, centrifuging at 8000-12000rpm, and removing the filtrate; adding a buffer solution GD, centrifuging at 8000-12000rpm, and discarding filtrate; adding rinsing liquid PW for two times, centrifuging at 8000-12000rpm, and discarding filtrate; suspending and dropping the solution on a column membrane by using nuclease-free water, and centrifuging at 10000-12000rpm for 1-2min to obtain the nucleic acid.

9. The method of any one of claims 1-8, further comprising:

5) Specific evaluation of pneumocystis yedoensis: taking a non-viscous and/or non-viscous sample, and performing specific detection on the yersinia sporogenes under the condition of not removing a host;

preferably, the specific detection primers and probe sequences are as follows:

forward primer sequence: CTTAAAATAAATAATCAGACTATGCGATAAG;

reverse primer sequence: GGAGCTTTAATTACTGTTCTGGGC;

the probe sequence is as follows: 6-FAM-AGATAGTCGAAAGGGAAC-BHQ1.

10. A method for constructing a metagenomic library for multi-sample type universal use based on nanopore sequencing, comprising the method of claim 9, and further comprising the steps of:

6) Taking extracted nucleic acid, supplementing water, adding an interruption reagent FRM, uniformly mixing, and then carrying out fragmentation treatment;

preferably, the FRM is a Rapid PCR Barcoding Kit component;

7) Adding barcode primer, STAR GXL Buffer, dNTP mix, primeSTAR GXL DNA Polymerase and nucleic-free water to the reaction product of step 6); after mixing uniformly, the mixture is placed on a PCR instrument for library amplification.

Preferably, the barcode primer is a Rapid PCR Barcoding Kit component; the other amplification reagent is

GXL DNA Polymerase kit component.

Images