CN1156574C - Method for introducing external DNA to lettuce chloroplast and lettuce chloroplast DNA fragment for it - Google Patents

Abstract

The present invention provides a method for introducing external DNA to lettuce chloroplasts, which comprises that a recombination carrier plasmid is built by making use of a sequence shown by SEQ ID NO: 2 or a segment which is not less than 1 kb at the 3' end of the sequence, a sequence shown by SEQ ID NO: 3 or a segment which is not less than 1 kb at the 5' end of the sequence of the SEQ ID NO: 3, and an external DNA segment and a recombination carrier plasmid which is built by a carrier plasmid, and the external DNA segment which is inserted to the carrier plasmid is positioned between the two segments. Lettuce cells are converted by making use of the built recombination carrier plasmid, and the cultivated and converted cells become plants. The present invention also provides a lettuce chloroplast DNA segment used for the method.

Description

A kind of method of foreign DNA and lettuce chloroplast(id) dna fragmentation that is used for this method of in the lettuce chloroplast(id), importing

Technical field:

The present invention relates to a kind of method of foreign DNA and lettuce chloroplast(id) dna fragmentation that is used for this method of in the lettuce chloroplast(id), importing.

Background technology:

In decades, foreign gene is the main direction of studying of plant genetic engineering to the conversion of plant nucleus gene group always.Yet, big along with its drawback of going deep into of research also manifests day by day as the cell nucleus gene group, the background complexity; Import the foreign gene position at random, easily cause other character variation; Exogenous gene expression efficient is low, unstable expression in the offspring; For being modified from procaryotic gene and transformation etc., these problems are having a strong impact on the improvement of foreign gene transformation technology and application in practice thereof.And foreign gene transforms in the chloroplast gene group overcome the deficiency that transforms to a certain extent in the nuclear gene group, and has unique advantages: the copy number as chloroplast transgenic is many, can realize efficiently expressing; The gene in prokaryotic organism source need not transformation and modifies just to be used in the chloroplast(id) to efficiently express; Transformant offspring's heredity shows matrilinear inheritance; Unlike the nuclear transformant, the foreign gene of its conversion can spread with pollen, and the chloroplast transgenic plant has good security, simultaneously, foreign gene can be at chloroplast gene group site-directed integration, so chloroplast(id) conversion technology is particularly suitable for the improvement of leaf vegetables plant nutrition value and the chemurgy of medicine industry.But particularly chloroplast(id) overexpression foreign protein, so plant chloroplast might become industrial enzymes or pharmaceutical protein as etc. " bio-reactor " of product, the product of medicine industry is really become " green product ".

But carry out the chloroplast(id) genetic manipulation and must possess two conditions: the one, make up plant chloroplast fixed point conversion carrier; Another is a tissue culture transformation system of preferably setting up leaf regeneration.And the former is even more important sport technique segment.Make up suitable chloroplast site-specific conversion carrier, at first must choose the location fragment, the fragment of reorganization takes place promptly and between the homologous fragment of chloroplast gene group, thereby determine the insertion site of foreign gene.As the location fragment, general requirement possesses following two conditions: the one, enough DNA length be arranged, and be generally 1-2kb, to guarantee (Carrer etc., Mol Gen Gene, 1993, the 241:49-56 of effectively integrating of foreign DNA; Svab etc., Proc NatlAcad Sci USA, 1993,90:913-917; Zoubenko etc., Nucl Acid Res, 1994,22:3819-3824; McBride etc., BioTechnol, 1995,13:362-365); The 2nd, design suitable insertion site.The insertion of foreign gene can not cause losing of the important sequence of original chloroplast gene group, is unlikely to disturb the normal function that closes on gene again.For this reason, people select the transcribed spacer of gene as inserting the site, because the transcribed spacer of gene is generally nonfunctional area usually.Chloroplast(id) tobacco transforms the insertion site of normal employing in the research at the rbcL/accD of big single copy area (Carrer etc., Mol Gen Gene, 1993,241:49-56; Svab etc., Proc Natl AcadSci USA, 1993,90:913-917; Kota etc., Proc Natl Acad Sci USA, 1999,96:1840-1845), PsbA/trnK (Zou Linrong etc. 1998, and Zhang Zhonglin etc. 2000) and be positioned at 16S trnV/rps12 (Zoubenko etc., the Nucl Acid Res in inverted repeats district, 1994,22:3819-3824).After making exogenous origin gene integrator advance the chloroplast gene group, can efficiently express, when making up conversion carrier, generally need select the strong promoter and the terminator in chloroplast(id) source for use.The most frequently used promotor is the promotor of photosystem II action protein gene psbA and the promotor of ribosomal RNA gene rrn, and terminator commonly used is the terminator of psbA gene, thereby guarantees the normal expression of foreign gene in recipient plant DNA.In addition, conversion carrier also need comprise suitable antibiotic resistance gene, so that transformant is effectively screened.

Because the establishment of location fragment is to understand chloroplast gene group sequence in the chloroplast site-specific conversion carrier.And the chloroplast(id) sequence of minority higher plant is only arranged by all or part of mensuration at present, therefore the chloroplast(id) of higher plant only transforms and carries out in these minority leaf, as tobacco (McBride, 1995), Arabidopis thaliana (Sikdar, 1998), paddy rice (Khan, 1999) and potato (Sidorov, 1999), this is many with the research in the tobacco especially wherein, and work expands to and utilizes chloroplast(id) conversion system to obtain pest-resistant, drought resisting, antiweed plant, production biodegradable plastic and even aspects such as industrial enzymes or pharmaceutical protein from transforming simple reporter gene.But owing to being unsuitable for the mankind, above-mentioned plant eats raw, and contain hazardous substance (as the nicotine of tobacco, the solanine of potato etc.), so can not use, limit range of application with direct edible way. more

Representative as leaf vegetables, leaf should be the good receptor material that transforms as chloroplast(id) with lettuce, and the ratio that its leaf partly accounts for complete stool is big, and can eat raw, and be referred to as romaine lettuce therefrom, romaine lettuce contains the multiple nutrients material in addition, and blade is thin and crisp, and quality is fresh and tender, the tasty and refreshing clear aquatic foods of taste, eat something rare, stir-fry and eat and all be subjected to liking of people, still western-style food is not cooked the main vegetables of salad, is the good merchantable brand of Chinese meal home cooking at present yet.So pharmaceutical protein or vaccine that the acceptor that utilizes this kind of plant to transform as chloroplast gene is produced, fully directly edible way utilization, this is the not available advantage of chloroplast gene transformation system in the past.

The nuclear gene of the lettuce of now having reported transforms engineering mainly abroad, but be not the report that object carries out genetic transformation also so far with the lettuce chloroplast(id), the little much relations of known array of this and lettuce chloroplast(id), up to the present the report of relevant lettuce chloroplast(id) genome sequence has only three, accession number is respectively AF162208 (527bp), AF162202 (350bp) and AF162201 (532bp), not only curtailment is being used to make up the homologous fragment that corresponding chloroplast(id) transforms carrier for these sequences, and the site also is not suitable for.

Summary of the invention:

For setting up lettuce chloroplast(id) genome transformation system, the present invention utilizes molecular biology method to obtain to be enough to make up chloroplast(id) carrier necessary lettuce chloroplast(id) dna fragmentation and isolates from these fragments sequence information and is used to make up the required lettuce chloroplast(id) homologous recombination dna fragmentation of lettuce chloroplast(id) location conversion carrier.

An object of the present invention is to provide a kind of method that in the lettuce chloroplast(id), imports foreign DNA.

Another object of the present invention provides a kind of lettuce chloroplast(id) dna fragmentation that is used for method of the present invention.

The invention provides a kind of method that in the lettuce chloroplast(id), imports foreign DNA, comprise: utilize sequence shown in the SEQ ID NO:2 or comprise sequence shown in the fragment that is not less than 1kb, SEQ ID NO:3 of sequence shown in the SEQ ID NO:2 3 ' end or comprise that the fragment that is not less than 1kb, exogenous dna fragment and a kind of vector plasmid of the 5 ' end of sequence shown in the SEQ ID NO:3 can be used for the vector plasmid that lettuce chloroplast gene group fixed point transforms, and is characterized in that exogenous dna fragment is between described two fragments; Utilize constructed recombinant vectors to transform the lettuce cell; Cultivate cell transformed and become plant.

The present invention also provides a kind of dna fragmentation of lettuce chloroplast(id), and it contains the dna fragmentation of all or part of sequence shown in the SEQ ID NO:2.Described segmental length preferably is not less than 1kb.The present invention also provides the dna fragmentation of all or part of sequence shown in a kind of SEQ of containing ID NO:3.This segmental length preferably is not less than 1kb.

Lettuce chloroplast(id) dna fragmentation of the present invention mainly is meant psbA gene and near section of DNA sequence thereof, the i.e. fragment of sequence shown in the SEQ ID NO:1.Because do not have can be for reference lettuce chloroplast(id) genome sequence, and the chloroplast gene group sequence of the feverfew at lettuce place also rarely has report, institute thinks the above-mentioned fragment of acquisition, according to the chloroplast gene group sequences Design primer of tobacco and the Arabidopis thaliana genomic DNA of lettuce chloroplast(id) that increases, through the pcr amplification of a plurality of combination of primers, find successfully to amplify lettuce chloroplast(id) dna fragmentation according to two pairs of primers of tobacco sequences Design.Comprised one section successive lettuce chloroplast(id) genomic dna sequence after these two sections amplified fragments splicings, promptly comprised the complete sequence of trnH and psbA gene, also comprised the partial sequence of gene trnK, rpl2 and MatK, its total length is the 3839bp sequence.

Homologous recombination fragment described in the invention obtains according to the redesign of sequence shown in SEQ ID NO:1 primer amplification.Be suitable for doing position that the exogenous dna fragment fixed point inserts in this sequence and be reaching between trnK and the psbA between the trnH and psbA gene in the lettuce chloroplast(id) genome.Because might existing jointly, psbA and trnk gene transcribe, so emphasis of the present invention is elected between trnH and psbA gene as exogenous dna fragment fixed point on position.Provide corresponding location fragment in the present invention according to this site:

Homologous recombination fragment 1: comprise lettuce chloroplast gene psbA, trnK and MatK part fragment, sequence numbering is SEQ ID NO:2; Can be according to circumstances under its 3 ' end situation of reservation during application, excision 5 ' end parts fragment is so that reduce the operation easier of molecular cloning, but for guaranteeing the effect of homologous recombination, this fragment should be as far as possible greater than 1000 base pairs when utilizing.

Homologous recombination fragment 2:trnH and rpl2 part dna fragmentation, sequence numbering is SEQ IDNO:3; This fragment has also comprised the terminator sequence of psbA gene, but does not comprise translation stop codon.This fragment should be connected on when utilizing needs expressed exogenous gene 3 ' end, so that terminator sequence is provided.The same convenience for clone and vector construction, can be according to circumstances under 5 ' the end situation that keeps sequence fragment shown in its SEQ ID NO:3, terminator one end that promptly keeps psbA on the fragment, excision 3 ' end parts fragment, but for guaranteeing the effect of homologous recombination, this fragment should be as far as possible greater than 1000 base pairs when utilizing.

It is to make up on common cloned plasmids basis that lettuce chloroplast(id) genome fixed point of the present invention transforms expression vector; for conveniently carrying out the structure work of carrier; preferably select for use less cloned plasmids to carry out vector construction; as pUC18/19 (Promega; USA), pUC118/119 (Promega; USA) or SK series plasmid (Promega, USA).The feature that lettuce chloroplast(id) genome fixed point of the present invention transforms expression vector is to contain lettuce chloroplast(id) dna fragmentation provided by the invention, has sequence shown in the SEQ ID NO:2 as utilization, the fragment that is not less than 1kb that perhaps comprises the 3 ' end of sequence shown in the SEQ ID NO:2, utilization has the fragment of sequence shown in the SEQ ID NO:3, perhaps comprises the fragment that is not less than 1kb of the 5 ' end of sequence shown in the SEQ ID NO:2.These fragments are inserted into the multiple clone site of cloning vector by the DNA recombinant technology, for reaching homologous recombination, 3 ' end of sequence shown in 5 ' of sequence end, the SEQ ID NO:3 should link to each other with vector plasmid shown in the SEQ IDNO:2, the exogenous dna fragment that is used to transform then is inserted between this two fragment by the DNA recombination form, and promptly the exogenous dna fragment two ends link to each other with 3 ' end of sequence shown in the SEQ ID NO:2 and 5 ' end of sequence shown in the SEQ ID NO:3 respectively.

Can comprise one or several genes or gene fragment on the exogenous dna fragment, for in chloroplast(id), expressing, they answer tool to have promotor and terminator that chloroplast(id) starts function, it is to be noted that 5 ' end of sequence fragment shown in the SEQ ID NO:3 is the terminator of lettuce chloroplast gene psbA, so 3 ' end near the foreign gene of sequence fragment shown in the SEQ ID NO:3 can directly link to each other with fragment 2, provide corresponding terminator sequence by the psbA terminator of 5 ends of sequence fragment shown in the SEQ ID NO:3.

Lettuce chloroplast(id) transformed plant of the present invention is meant and utilizes particle bombardment or other direct introduction method, to contain the segmental carrier of lettuce chloroplast(id) homologous recombination of the present invention imports in the lettuce chloroplast(id), pass through homologous recombination, the exogenous dna fragment fixed point that will have foreign gene is inserted in the lettuce chloroplast(id) genome, particularly between the trnH of gene psbA, though this carrier utilization is the homologous fragment of lettuce chloroplast DNA, but still can be used for nearer other the feverfew of sibship.

On the exogenous dna fragment that imports, can comprise any goal gene, be especially industrial and pharmaceutical protein gene, as gene fragment of enzyme, pharmaceutical protein and vaccine etc., lettuce can be produced above-mentioned substance as a novel bio-reactor like this, because lettuce can be eaten raw, so the lettuce of expressing the said gene product is had huge advantage on using.

Brief Description Of Drawings

Fig. 1 (A) and (B) expression contain the segmental lettuce chloroplast(id) of homologous recombination of the present invention dna fragmentation (SEQ ID NO:1).Wherein, sequence 1-692 is a lettuce chloroplast(id) MatK gene coding region (letter capitalization);

Sequence 809-843 is a lettuce chloroplast(id) trnK gene coding region (letter capitalization); Sequence 1069-2130 is a lettuce chloroplast(id) psbA gene coding region (letter capitalization); Sequence 2521-2595 is a lettuce chloroplast(id) trnH gene coding region (letter capitalization); Sequence 2714-3158 is lettuce chloroplast(id) rpl2 gene extron coding region (letter capitalization); Sequence 3825-3839 is lettuce chloroplast(id) rpl2 Gene Partial exons coding district (letter capitalization); The zone of alphabetical small letter is the outer sequence of gene coding region in the above sequence.

Fig. 2 represents the sequence (SEQ ID NO:2) of homologous recombination fragment 1 of the present invention.

Fig. 3 represents the sequence (SEQ ID NO:3) of homologous recombination fragment 2 of the present invention.

Fig. 4 represents that lettuce chloroplast(id) genome fixed point transforms expression vector plasmid figure.Wherein, the fragment of band shade is the homologous recombination fragment of the lettuce chloroplast DNA mentioned among the present invention.

Embodiment:

Hereinafter will the present invention will be further described by embodiment

Embodiment 1

Lettuce chloroplast(id) psbA and near segmental acquisition thereof

1) adopt high ionic strength, low pH method to extract the rape chloroplast DNA.

Get the young leaflet tablet of 5g lettuce, and the Buffer A of adding 40ml 4C precooling (25mM EDTA, 1.25M NaCl, the 0.25M xitix, pH3.6), the high-speed homogenization several is to becoming pasty state.Slurries are filtered in 4 50ml centrifuge tubes with 4 layers of hospital gauze.4 ℃ of centrifugal 8min of 800g abandon supernatant, add Buffer B (50mM Tris.HCl, 25mM EDTA, 1.25M NaCl, 10mM beta-mercaptoethanol, pH8.0) the resuspended chloroplast(id) of (below be the amount that every pipe adds) 30ml precooling.4 ℃ of centrifugal 8min of 800g reclaim the chloroplast(id) particle, abandon supernatant, add BufferC (150mM NaCl, 100mM EDTA, pH8.0) the resuspended precipitation of 30ml precooling.4 ℃ of centrifugal 8min of 1000g reclaim chloroplast(id), abandon supernatant, add 2ml Buffer D (50mM Tris.Cl, 25mM EDTA, pH8.0) resuspended precipitation, add 0.5ml 10%Sarcosyl (Buffer preparation) and 20 μ lProteinase K (10mg/ml), in 45 ℃ of jog 4-6h.With the saturated phenol extracting of equal-volume Tris for several times, use phenol again: chloroform: primary isoamyl alcohol (25: 24: 1) extracting 1-2 time, clean to the interface.Add 1/10 volume 3mmol/L NaAc (pH5.2) and 2 times of volume dehydrated alcohols in the supernatant ,-20 ℃ are spent the night.4 ℃ of centrifugal 15min of 12000g reclaim DNA, are dissolved among the 500 μ l TE (pH8.0), add the RNase A of 5 μ l10mg/ml, 37 ℃ of insulation 1h.Clean with phenol, phenol/chloroform extracting to the interface, add the 3mol/L NaAc (pH5.2) of 1/10 volume and the dehydrated alcohol of 2 times of volumes in the supernatant, more than-20 ℃ of placement 2h.4 ℃ of centrifugal 20min of 15000g reclaim DNA.70% washing with alcohol DNA, vacuum is drained, and being dissolved in 50 μ l TE (pH8.0), to be positioned over-20 ℃ of preservations stand-by.

2) pcr amplification of lettuce chloroplast DNA and clone

Design two pairs of primer sequences with reference to the tobacco chloroplast gene order:

P11(118)：ATGCCCTACCTTTGAGTGC

P12(119)：TCCATACCAAGGTTAGCAC

P22(120)：ACTGCTTTAGGTATCAGC

P21(121)：GGGCTATCTTTCAAGTGT

With the lettuce chloroplast DNA is template, utilizes above-mentioned two pairs of primers to increase respectively, and reaction system is 50 μ l: dNTPs 100 μ M wherein, each 60ng of primer, chloroplast DNA are 50-100ng, high-fidelity DNA polymerase 1.25U

The pcr amplification program is: 95 ℃ of pre-sex change 5min → 95 ℃ of sex change 30s, and 55 ℃ of annealing 1min, 72 ℃ are extended 2.5min, and totally 30 circulations are extended 10min for → 72 ℃.

3) clone of amplified fragments and order-checking row

Amplified production is determined through agarose gel electrophoresis, utilize the product size of primer 118 and 119 amplifications to be about 1.9kb, utilize the product size of primer 120 and 121 amplifications to be about 2.1kb, utilize glass milk purification kit that the electrophoresis band of amplified production is reclaimed, owing to be the product of high-fidelity pfu enzymatic amplification, can be directly connected in the cloned plasmids pBluescriptSK (Promega that the EcoRV enzyme enzyme that can produce flush end is cut, USA) on, after maybe will reclaiming product utilization Taq enzyme and dATP and adding the A tail, be connected in (Promega on the T carrier, USA presses the T carrier specification sheets of Promega), connect product transformed competence colibacillus bacillus coli DH 5 alpha.To the bacterium colony that grows on LB (Amp 100mg/L) flat board, extraction transformant plasmid carries out electrophoresis and determines.To checking order of the lettuce chloroplast(id) dna fragmentation that obtains.Each clonal analysis has carried out twice independently order-checking at least.Sequence results is carried out homology relatively by NCBI BLAST and known other plant chloroplast dna sequence dna, and the gene order situation on definite fragment.

Embodiment 2

Lettuce chloroplast(id) dna homology fragment is separated and the clone

The method that provides in the present embodiment is that the segmental method of two homologous recombination that provides in the invention is provided, and does not utilize other dna fragmentation that can be used for recombinating on the sequence separation sequence provided by the invention but do not influence.

1) extraction and purification of chloroplast DNA: the same

2) pcr amplification of chloroplast(id) homologous fragment:

According to two primers of sequences Design of SEQ ID NO:1,

P11(118)：ATGCCCTACCTTTGAGTGC

P12(PVI)：GGAGTCGACTTTGGTCTTATTGTAATTGTATAGG

P21(121)：GGGCTATCTTTCAAGTGT

P22(VII)：GTGGATCCTTGGGAAAAGAATATATAAACCTC

With the lettuce chloroplast DNA is template, with the fragment of sequence shown in the SEQ ID NO:3 among primer P11 and primer P12 amplification the present invention, promptly comprise the rpl2 of lettuce chloroplast gene, the fragment of trnH gene, with the fragment of sequence shown in primer P21 and the primer P22 amplification SEQ ID NO:2, promptly comprise the fragment of lettuce chloroplast gene psbA, rnK and MutK gene.All use high frequency high fidelity Pfu archaeal dna polymerase in the amplification procedure.

With the lettuce chloroplast DNA is template, utilizes above-mentioned two pairs of primers to increase respectively, and reaction system is 50 μ l: dNTPs 100 μ M wherein, each 60ng of primer, chloroplast DNA are 50-100ng, high-fidelity DNA polymerase 1.25U

The pcr amplification program is: 95 ℃ of pre-sex change 5min → 95 ℃ of sex change 30s, and 55 ℃ of annealing 1min, 72 ℃ are extended 2.5min, and totally 30 circulations are extended 10min for → 72 ℃.

The fragment of sequence shown in the SEQ ID NO:2 utilizes PstI and BamHI enzyme to cut, enzyme is cut product through agarose electrophoresis, downcut about 1kb fragment (being actually 1030bp), utilize glass milk DNA to reclaim test kit and reclaim fragment, the recovery product is connected in sample enzyme enzyme cuts SK plasmid (Promega, USA) on, the plasmid that obtains is pCTHF1;

The dna fragmentation of sequence is cut through HindIII and SalI enzyme shown in the SEQ ID NO:3 that amplification obtains, enzyme is cut product through agarose electrophoresis, downcut about 1kb fragment (being actually 1087bp), utilize glass milk DNA to reclaim test kit and reclaim fragment, reclaim product and be connected in the pUC18 (Promega that cuts processing with sample enzyme enzyme, USA) on the plasmid, promptly obtain containing the middle interstitial granules pCTHF2 of homologous fragment 2;

Embodiment 3

Utilize lettuce chloroplast(id) dna sequence dna provided by the invention to make up the structure that the lettuce chloroplast site-specific transforms the lettuce chloroplast site-specific conversion expression vector of expression vector-green fluorescent protein (GFP) gene.

Present embodiment is that (Promega USA) carries out on the basis, and the reason of selecting it is that this plasmid is less, easy handling, but this does not influence and utilizes other vector plasmid such as pBluescriptSK plasmid at common cloning vector pUC-18.

1) at first homologous recombination fragment 1 is sure to down with EcoRI and BamHI enzyme from plasmid pCTHF-1, enzyme is cut product through agarose electrophoresis, downcuts about 1kb fragment, utilizes glass milk DNA to reclaim test kit and reclaims fragment, reclaim product and be connected on the pCTHF-2 that cuts with sample enzyme enzyme, obtain plasmid pLCTH-A.

2) with BamHI and SalI with lettuce chloroplast gene psbA promotor and GFP gene from pSR21 (Promega, USA) go up cutting-out, enzyme is cut product through agarose electrophoresis, downcut about 0.9kb fragment, utilize glass milk DNA to reclaim test kit and reclaim fragment, reclaim product and be connected on the pLCTH-A that cuts with sample enzyme enzyme, promptly obtain having the chloroplast(id) conversion expression vector plasmid pLCTHA-G of marker gene GFP.Utilize fluorescent microscope to excite down and observe, find that the transformant thalline sends green fluorescence, and the DH5 α thalline that does not import the DH5 α thalline that contains plasmid pLCTH-A of GFP gene and plasmid-free excites at blue streak and do not have green fluorescence to send at blue streak.

3) with BamHI cutting plasmid pSZB8 (Promega, USA), obtain the expression cassette (Prrn-aadA-psbA3 ') of selection markers gene aadA, this expression cassette fragment is through agarose electrophoresis, downcut the 1.3kb fragment, utilize glass milk DNA to reclaim test kit and reclaim fragment, the recovery product is connected in the connection of sample enzyme and is inserted on the pLCTHA-G that same enzyme is cut, transform DH5 α competence bacterium, the bacterium source of getting the conversion of 100 microlitres is coated with on the LB substratum that contains spectinomycin (100 mg/litre), 37 ℃ after 16 hours, grow the transformant bacterium colony, picking colony contains spectinomycin (100 mg/litre) LB liquid nutrient medium in 3 milliliters and cultivates, extract plasmid, plasmid is cut with the BamHI enzyme, the transformant of confirming gained through electrophoresis has inserted the chloroplast expression box fragment of selection markers gene, thereby obtains final vector plasmid pLCTA (aadA/GFP).

Because mark GFP gene and selection markers gene aadA on this carrier are between two lettuce chloroplast(id) homologous recombination dna fragmentations, so after importing it in lettuce chloroplast(id) by means such as particle guns, can be by respective segments generation homologous recombination mode on lettuce chloroplast(id) homologous fragment and the chloroplast(id), it is intersegmental that GFP and aadA gene are inserted on the chloroplast gene group these two sheets, promptly import between chloroplast gene group gene trnH and the gene psbA, but also do not destroy the function of original chloroplast gene.

Embodiment 4

Utilize in the importing lettuce chloroplast(id) genome of fixed point conversion carrier provided by the invention with green fluorescent protein (GFP) gene

1) carrier: the lettuce chloroplast site-specific that contains the GFP gene transforms expression vector pLCTA (aadA/GFP)

2) transformation receptor material: cream romaine lettuce blade.Chlorine bleach liquor with 5% soaked 10 minutes, gave a baby a bath on the third day after its birth time with sterilized water again, was torn into the blade of 1 centimeter square size with tweezers, was put on the MS substratum in order to next step use.

3) gene transformation: the blade that adopts the method conversion lettuce of particle gun.The high-quality plasmid DNA of at first a large amount of preparations, the preparation method is ordinary method (seeing " molecular cloning "), plasmid DNA is diluted to 1 μ g/ μ l, in order to the usefulness of conversion.Prepare the particulate bullet then according to a conventional method, height is oozed the lettuce blade bombardment of handling 4 hours with the Bio-RadPDS-1000/He particle gun, high again oozing handled 16 hours, changed division culture medium afterwards over to and cultivated 2 days, changed over to break up on the screening and culturing that contains spectinomycin and screen again.Leaf tissue piece on screening culture medium is through about one month cultivation, and most of blades turn white and die; Extremely minority can differentiate green bud point.Continue to cultivate and the induced bud elongation.Bud is transformed root media, take root, obtain complete transformed plant.

4) transformant is identified:

GFP fluorescence is identified: shine resulting green seedling with long-wave ultra violet lamp, see through the green glow spectral filter observe can send green fluorescence be the transgenosis individuality.

Pcr amplification is identified: utilizing on outer aligning primer of chloroplast gene group homologous recombination fragment on the conversion carrier and the conversion carrier foreign gene is that GFP goes up primer and carries out pcr amplification, if amplification obtains fragment, prove being inserted into really in the chloroplast gene group of foreign gene GFP.Here the primer sequence of Ying Yonging is: ATGCCCTACCTTTGAGTGC (the P11 primer in the literary composition that sees before) and AGTAAAGGAGAAGAACTTTTC (5 ' end of GFP gene).Utilize this that primer is carried out pcr amplification to the DNA of transformed plant,, show that promptly the GFP gene has transformed and has been inserted between chloroplast gene group psbA and the trnH if amplification obtains the fragment of about 2.4kb size.

5) homogeneity:

The blade of getting the transfer-gen plant of molecular biology method confirmation carries out the homozygote that differentiation method obtains homogeneity again, containing screening and culturing and induced bud generation on the screening and culturing of spectinomycin, obtain the green seedling of regenerated, the blade of then getting the transfer-gen plant (T1 generation) of programmed screening acquisition again carries out leaf regeneration, screening is about 3 months on screening culture medium, obtains the green seedling of regenerated.Screened for four generations altogether.Severally all be inserted with foreign gene on the genome of all chloroplast(id)s of transformed plant after taking turns screening through this, promptly reach homogeneity.Homogeneity is identified can pass through PCR method, adopts the sequences Design primer according to chloroplast DNA beyond the conversion carrier homologous fragment to increase, and inserts foreign gene if insert the site in the chloroplast gene group, by the fragment that amplifies increase.Here the primer sequence of Ying Yonging is: TAAAGCCTTCAATGGTACGCAGTC and CGACGAAACCTAGAAATCGATCACTG (coming from 24-48,3748-3772 base sequence on the SEQ ID NO:1 sequence respectively), amplification system adopt and are suitable for long segment amplification PCR system.Because chloroplast(id) has a large amount of unconverted dna moleculars in the transformed plant that several leading regeneration obtains, so utilize the detection of above-mentioned primer amplification can find the fragment of the 3.7kb size that becomes clear, promptly between the psbA of transformant chloroplast(id) and trnH, do not have the insertion of exogenous dna fragment.Also amplification is obtained the fragment of a more weak about 6kb size in addition, this is owing to the insertion that the exogenous dna fragment of an about 2.4kb is arranged between psbA and trnH gene in the chloroplast gene group that transforms, though this situation shows foreign gene and has been inserted in the chloroplast gene group, but still have the DNA of a large amount of chloroplast(id)s not transformed, promptly do not reach homogeneity yet.If only detecting the fragment of about 6.1kb size, amplification can show that just the DNA of all chloroplast(id)s has inserted exogenous genetic fragment.

Claims (5)

1. method that imports foreign DNA in the lettuce chloroplast(id) comprises:

Utilize sequence shown in the SEQ ID NO:2 or comprise the fragment that is not less than 1kb that sequence shown in the SEQ ID NO:2 3 ' is held, sequence shown in the SEQ ID NO:3 or comprise the fragment that is not less than 1kb of sequence shown in the SEQ ID NO:3 5 ' end, exogenous dna fragment and a kind of vector construction recombinant vectors, make exogenous dna fragment be positioned at sequence shown in the described SEQ ID NO:2 or comprise the fragment that is not less than 1kb of sequence shown in the SEQ ID NO:2 3 ' end and SEQ ID NO:3 shown in sequence or comprise between the fragment that is not less than 1kb of the 5 ' end of sequence shown in the SEQ ID NO:3;

Utilize constructed recombinant vectors to transform the lettuce cell;

Cultivate cell transformed and become plant.

2. in accordance with the method for claim 1, wherein said cloning vector is pUC18/19, pUC118/119 or SK series plasmid.

3. one kind has sequence shown in the SEQ ID NO:2 or comprises its 3 ' segmental dna fragmentation of holding that is not less than 1kb.

4. one kind has sequence shown in the SEQ ID NO:3 or comprises its 5 ' segmental dna fragmentation of holding that is not less than 1kb.

5. the transfer vector plasmid that contains claim 3 and 4 described dna fragmentations.

Images