CN115637260A - Genetic engineering vaccine for expressing African swine fever virus P54 gene recombinant pseudorabies virus and application thereof - Google Patents

Abstract

The invention provides a gene engineering vaccine for expressing African swine fever virus P54 gene recombinant pseudorabies virus and application thereof, and the research is based on a PRV JS-2012-delta gI/gE strain, and utilizes a homologous recombination method to insert a gene sequence of a main antigen protein (P54 protein) of the African swine fever virus which is popular in China at present into a vector PRV JS-2012-delta gI/gE vaccine strain to construct a recombinant pseudorabies virus gene deletion vaccine strain rPRV JS-2012-delta gE/gI + P54 containing the African swine fever virus P54 gene sequence. Through PCR and indirect immunofluorescence verification, the inserted African swine fever virus P54 gene can be stably and efficiently expressed in the vector virus PRV JS-2012-delta gI/gE. The biological properties further suggest: the recombinant virus rPRV JS-2012- Δ gE/gI + P54 is substantially similar to the parent virus PRV JS-2012- Δ gI/gE.

Description

Genetic engineering vaccine for expressing African swine fever virus P54 gene recombinant pseudorabies virus and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering vaccines, and particularly relates to a recombinant pseudorabies virus rPRV and an African swine fever vaccine prepared by using the rPRV, in particular to construction of a genetic engineering vaccine rPRV JS-2012-delta gE/gI + P54 strain for expressing the African swine fever virus P54 gene recombinant pseudorabies virus, and specific application thereof.

Background

African Swine Fever (ASF) is an acute, virulent, and contact infectious disease caused by African Swine Fever Virus (ASFV). The control of the ASF epidemic situation is the first work task of veterinarians in China, and the pig farm is used as the main battlefield of veterinary science and technology workers, so that an efficient ASF prevention and control technology and an effective ASF prevention and control measure are urgently needed.

ASFV is an enveloped, linear double-stranded DNA virus, the only member of the genus African swine fever virus of the family African swine fever Virus. The virus particle has a complex structure and is divided into five layers from inside to outside: a nucleoid (nucleoid) containing viral genome, an inner nucleocapsid (core shell), an inner membrane (inner envelope), a capsid (capsid), and an outer envelope (outer envelope). The ASFV genome has a total length of 170-194kbp, consists of a central conserved region and two end variable regions, and encodes 151-167 Open Reading Frames (ORFs). Because of the variable number of repeats that a multigene family (MGF) encoded by a viral gene can acquire or lose in ORFs and short tandem repeats (short tandems repeats) present in or between viral genes, there are differences in genome length of different viral isolates. At present, the quantity and function of the ASFV genome-encoded proteins are not completely clear.

ASFV susceptible mammals are limited to pigs, and pigs of various sizes, including domestic pigs, wild pigs, and wart pigs. In addition to pigs, ASFV can infect ticks, and ticks play an important role in the spread of ASFV. Soft ticks and wart pigs are natural storage hosts of ASFV, maintaining the virus in nature for a long time. The virus survives for years in the soft tick and can be vertically transmitted to offspring. The wart pig has certain resistance to ASFV, does not produce clinical symptoms after infection, but can produce viremia for a long time, and is an important carrier and an infection source of the virus. Warts pigs do not transmit ASFV horizontally or vertically and must be mediated by ticks. However, in the domestic and wild boar groups, ASFV presents a high degree of contact transmission, which is achieved by direct contact between pigs or contact with infected pig excreta and its contaminants, infected pig meat and blood products and residues. The susceptibility of domestic pigs and wild pigs to ASFV is similar, the infection latency is usually 4-19 days, and the infection with different virulent strains presents different clinical symptoms: the most acute and acute cases are caused by virulent strain infection, and the death rate reaches 100 percent; moderately virulent strains cause sub-acute cases with a mortality rate of 30-70%. The chronic type is caused by the infection of low virulent strains, the disease course can last for 5 to 12 months, the internal hemorrhage of the pig is not caused, the symptoms such as skin necrosis and ulcer, joint inflammation and swelling, lymph node hyperplasia and the like are mainly shown, and the growth is slow and even the emaciation is realized. The chronic type suffering pig has infectivity in the process of continuous infection, and can infect the contacted susceptible animals. Pigs with latent infection are also infectious and may be detoxified for hours before clinical symptoms appear. The rehabilitated pig may also be toxic for a long period of time and may transmit the virus. ASF has great harm to the pig industry, is listed as an animal epidemic disease reported by the world animal health Organization (OIE) in the legal way, and is listed as an animal infectious disease in China. Currently, there are no effective vaccines and drugs available for ASF for prophylaxis and therapy.

Vaccines are a common technique and efficient means of controlling viral and bacterial infectious diseases. Various human infectious diseases and animal epidemic diseases are effectively controlled or even eradicated through the use of vaccines. However, because of the complex biological characteristics of ASFV, it has not been clearly recognized in many aspects such as virus invasion and immune protection response induction, and in the course of ASF vaccine research for nearly half a century, different groups have utilized various technical approaches, but have not developed a safe and effective ASF vaccine. Although inactivated vaccines induce the production of antibodies against ASFV, immunized pigs are not resistant to challenge with virulent strains. Even if the ASF inactivated vaccine is prepared by using the modern adjuvant, the ASF inactivated vaccine still has no protective effect on the challenge of homologous virulent strains.

Through long-term research, a plurality of ASFV virulence genes, such as K196R, B119L, EP402R, DP 32148 zxft 3245L, DP R and MGF360/505, etc. are identified. With the continuous development of molecular biology, the genetic operation of viral genomes is easier, and the construction of ASFV gene deletion attenuated strains by a genetic engineering means is more and more convenient. However, the attenuated strains still have safety doubts and are mainly expressed in three aspects: one is the problem of side reactions. Some attenuated strains have damage to hosts after inoculation, and are clinically manifested as fever, arthritis and chronic damage; secondly, there is a risk of virus scattering in the inoculation of the attenuated strain. Some of the attenuated strains produce low levels of viremia after inoculation and can be excreted in vitro to infect other susceptible animals; thirdly, the virulence returns strongly. Although ASFV is a DNA virus, it has a hypervariable region in its genome and is liable to cause mutation. Meanwhile, the low virulent strain needs to be cultured by primary cells, which is not beneficial to industrialized production, so the low virulent strain is not preferable for the African swine fever vaccine at present.

DNA vaccines and virus live vector vaccines show better safety, but the immune efficiency of the vaccines still needs to be improved. Among them, subunit vaccines can produce neutralizing antibodies, but after homologous virulent challenge, they can only delay the onset of clinical symptoms, but cannot resist viral infection. DNA vaccines lack some good viral antigens. The virus live vector vaccine can induce specific antibody immunity and cell immunity reaction, but can play a role in resisting ASFV after immunizing pigs, and needs to be discussed.

With the rapid development of DNA recombination technology, reverse genetic manipulation, gene editing and other technologies, the research direction of vaccines is gradually shifting to genetic engineering vaccines, and recombinant live vector vaccines are attracting more and more attention. The vectors currently used for developing viral vaccines involved in the study of live viral vector vaccines mainly include poxviruses, herpesviruses, adenoviruses and the like. Adenovirus is replication-defective virus, while poxvirus has large genome and more genome expression products, and foreign proteins expressed by the two are difficult to stimulate the body to generate stronger immune response. The genome of the herpesvirus is large, a plurality of replication nonessential regions can be inserted with a plurality of exogenous genes, and the live vector vaccine constructed by the herpesvirus can induce specific mucosal immunity. At present, herpesviruses involved in veterinary live vector vaccine research mainly include Pseudorabies virus (PRV) and Duck plague virus (DEV). The pig is not a host of the duck plague virus, and the immunoprotection effect of the recombinant duck plague virus on ASFV infection after immunizing a pig body is uncertain.

Because the PRV genome is large, PRV has many non-essential genes and non-coding regions, and the insertion of foreign gene sequences in these regions does not affect the replication of PRV itself, which also makes PRV live vector vaccines a hot spot for virus genetic engineering vaccine research. Meanwhile, the comparison of domestic application patents shows that: the Zhejiang Hippocampus Biotechnology Limited company constructs a recombinant pseudorabies virus (PRV-BAC-P72-B602L-CD 2V-delta TK-delta gG strain) for expressing African swine fever virus P72 and B602L, CD V genes, namely, the TK gene and the gG gene of the PRV virus are deleted, the P72 and B602L genes of the African swine fever virus are inserted into the deletion position of the TK gene, and the CD2V gene of the African swine fever virus is inserted into the deletion position of the gG gene. The recombinant virus has defects, firstly, the deletion of TK gene leads the virus virulence to be greatly reduced for PRV, the virus virulence and the immunity effect are in positive correlation for vaccine, the virus virulence is too weak to enter the organism and then is replicated and limited, so that the excited immunogenicity is not strong, and the carrier vaccine mainly depends on the recombinant virus to replicate after entering the organism, so that the inserted exogenous gene is expressed along with the replication of the virus to generate the immune protection effect, if the recombinant virus does not replicate in the organism or the replication level is low, the protective effect on the exogenous gene is definitely not good. We all know that PRV virus is very lethal to mice, and only after TK gene is knocked out, mice are safe, pigs are much more tolerant to PRV, and virus safe to pigs may still have strong lethality to mice (Wu tang, guoxin Li, chao Liang, et. Al. A live, attested pseudorabies virus strain JS-2012deleted for gE/gI protects against tissue distribution and pathogenicity tests of infection of mice with strain JS-2012- Δ gI/gE, yangzhou, 2016), while virus safe to mice has almost no pathogenicity to pigs at all, although he does not have pathogenicity to mice at all in this case, since viruses safe to pigs may still have strong lethality to mice (Wu tang, guoxin Li, chao Liang, et al. A live, attempering strain, antibiotic Research 130 (2016) 110-117. Cao Yanyun, JS strain JS 2012 and strain with gene deletion JS-2012- Δ gI/gE, tissue distribution and pathogenicity tests of infected mice, yance test of infection of mice, yange, JS-2016), while viruses safe to mice have almost no pathogenicity to pigsThe recombinant virus can generate specific antibodies after being immunized into mice, but because the recombinant virus has weak toxicity to pigs, whether the pigs can generate specific antibodies aiming at foreign proteins after being immunized is still unknown. And secondly, the gE gene of the recombinant virus is not deleted, and the gE gene is not deleted for PRV, so that PRVgE antibody of a pig farm is positive, PRV purification of the pig farm cannot be carried out, and the recombinant virus is not suitable for clinical application in China. Thirdly, the PRV viral vector used by the recombinant virus is a pseudorabies virus strain (PRV HL), the strain is not yet developed for vaccine at present, and the condition for developing and using the PRV viral vector as a live vector vaccine is not provided. The Jiangxi agricultural university constructs a recombinant pseudorabies virus (PRV TK-/gI) expressing genes of African swine fever virus CD2V, P or P30 and P54 ^- /gE ^- - CD2v ⁺ /p72 ⁺ Strain or PRV TK-/gI ^- /gE ^- -P54 ⁺ /P30 ⁺ Strain), namely deleting TK gene and gI/gE gene of PRV virus, inserting CD2V or P54 gene of African swine fever virus at the TK gene deletion position, and inserting P72 or P30 gene of African swine fever virus at the gI/gE gene deletion position. Firstly, zhejiang Hailong Biotechnology limited company has weak toxicity to the constructed recombinant virus, which is not beneficial to the expression of foreign protein in the pig body, and can understand whether to provide protection effect for immune pig group. Secondly, a part of the foreign gene of the recombinant virus is inserted at the deletion of gI/gE gene, while it is known that the gI/gE gene of PRV is unstable and easily undergoes deletion mutation with passage of the virus (Chao Liang, wu Tong, hao Zheng, fei Liu, jiqiiangWu, guoxin Li, en-min Zhou, guangzhi Tong, A high-temperature passaging infected cultured microorganisms proteins vaccine genes complex obtained by embedding PRV variant. Area in the viral Science 112 (2017) 109-115.), in this case, the insertion of foreign genes at this position by researchers is apparently not a correct choice (Tong Guangzhi, zheng Hao, tong Wu, li Guoxin, zhou Yanjun, in the sea, in single-collar, in high-flying, jiang Yifeng, yu Ling Xue, recombinant Pseudorabies virus strain expressing classical swine fever virus E2 protein, preparation method and application thereof, no. 02/08 (2022), china, ZL 201810627238.5). Thirdly, also the PRV viral vector strain used by the recombinant virus is notSee information on vaccine development.

The PRV virus live vector selected in the patent is a homologous recombination technology adopted by people such as Tong Wu in 2016, and the like, and a variant strain JS-2012 is used as a framework, so that the pseudorabies double-gene deletion virus JS-2012-delta gE/gI (Tong Guangzhi, tong Wu, zheng Hao, liu Fei, liangchao, zhou Yanjun, unilapel, shanghai, jiang Yifeng, high-flying, pseudorabies virus gene deletion attenuated strain, a preparation method and application thereof are successfully established on the premise of 09/07/2018, china, zl201410002656.7.Wu tang, guoxin Li, chao Liang, fei Liu, qing tie, yanyun Cao, lin Li, xuche Zheng, hao Zheng, guangzhi tang.a live, attentuated pseudopeptides virus strain JS-2012 deletion for gE/gii detectors, original body clinical and experimental strain, animal Research 130 (2016) 110-117. 2015051, 2017069, 20190012). And in the earlier stage, the porcine pseudorabies virus double-gene deletion attenuated vaccine strain (JS-2012-delta gE/gI strain) is also used as a vector to express the recombinant virus rPRV JS-2012-delta gI/gE + E2 of the classical swine fever virus E2 protein. The recombinant virus can be used for vaccinating pigs, and does not cause any side effect or tissue damage. The immune pig can completely resist the attack of CSFV virulent virus (shimen) by a single inoculation. Even for piglets with PRV maternal antibodies, rPRV JS-2012-delta gI/gE + E2 immunization can achieve good immune protection effect, and completely protect the piglets against virulent attack (Tong Guangzhi, zheng Hao, tong Wu, li Guoxin, zhou Yanjun, shangguan, gaofeng, jiang Yifeng, yu Ling Xue, recombinant pseudorabies virus strains expressing classical swine fever virus E2 protein, preparation method and application thereof, ZL20181727238.5 Wu Tong, hao Zheng, guo-xin Li, fei Liu, qi Tiyan, nanyun Cao, lin Li, xuchen Zheng, hao Zangzhi FV, gui Zangzhi Tong, jian Tong, shen, and Shen virus strain 3432 (CSproximate drugs) and 3. Environmental test 3432. The early-stage research finds that although the immune piglet of the rPRV JS-2012-delta gI/gE + E2 can have a good immune protection effect, the E2 antibody level of CSFV is not ideal after the piglet of the rPRV JS-2012-delta gI/gE + E2 is immune, in the research, when the exogenous gene of the African swine fever virus is selected, the sequence of the exogenous gene is optimized by certain codons, and the immune piglet generates specific antibodies aiming at P54 obviously improved after the recombinant virus is immune, and the P54 antibody level after the JS-2012-delta gE/gI + P54 is obviously superior to the E2 antibody level after the JS-2012-delta gI/gE + E2 is immune from the induced antibody level.

Disclosure of Invention

In order to construct recombinant attenuated strains for the preparation of live vector vaccines for the treatment and prevention of African swine fever, we have conducted intensive studies on pseudorabies virus (PRV) as a live vector for African swine fever virus. In earlier researches, a gene-deleted attenuated vaccine strain of porcine Pseudorabies virus (PRV) is constructed as a recombinant virus rPRV JS-2012-delta gI/gE + E2 for expressing a Classical Swine Fever Virus (CSFV) E2 protein by using a vector. The recombinant virus can be used for inoculation of pigs, and does not cause any side effect or tissue damage. The immune pig can completely resist the attack of CSFV virulent virus (shimen) by a single inoculation. Even for piglets with PRV maternal antibodies, the rPRV JS-2012-delta gI/gE + E2 immunity can obtain good immune protection effect, and the piglets are completely protected against virulent attack. This is far superior to the immune effect against CSFV produced by recombinant viruses expressing E2 protein using Newcastle disease virus, adenovirus and poxvirus as vectors. These results show that the PRV gene deletion attenuated vaccine strain can effectively express and present foreign protein in the pig body, induce strong immune response and is a high-efficiency live vaccine virus vector for pigs. The early-stage research finds that although the immune piglet of the rPRV JS-2012-delta gI/gE + E2 can have a good immune protection effect, the E2 antibody level of CSFV is not ideal after the piglet of the rPRV JS-2012-delta gI/gE + E2 is immune, in the research, when the exogenous gene of the African swine fever virus is selected, the sequence of the exogenous gene is optimized by certain codons, and the immune piglet generates specific antibodies aiming at P54 obviously improved after the recombinant virus is immune, and the P54 antibody level after the JS-2012-delta gE/gI + P54 is obviously superior to the E2 antibody level after the JS-2012-delta gI/gE + E2 is immune from the induced antibody level.

On the basis, the invention provides a recombinant pseudorabies virus genetic engineering vaccine for expressing the African swine fever virus P54 gene, which is characterized in that the recombinant pseudorabies virus genetic engineering vaccine expresses the exogenous African swine fever virus P54 gene, and gI and gE genes in the pseudorabies virus are deleted;

further, the recombinant pseudorabies virus genetic engineering vaccine is JS-2012- Δ gE/gI + P54 strain;

further, in another aspect of the present invention, there is provided a method for preparing a recombinant pseudorabies virus genetic engineering vaccine, comprising the following steps:

(5) Constructing a recombinant vector, designing primers to amplify homologous recombination left and right recombinant arms, carrying out enzyme digestion on a CMV promoter-EGFP gene fragment and an SV40polyA signal sequence fragment, and sequentially assembling the left recombinant arm-CMV promoter-EGFP gene-SV 40polyA signal sequence-right recombinant arm to obtain the recombinant transfer vector.

(6) Extracting total DNA of a pseudorabies virus JS-2012-delta gI/gE strain, and cotransfecting the total DNA and the recombinant vector in the step (1) to obtain a recombinant pseudorabies virus containing an EGFP fluorescent label;

(7) Constructing a recombinant vector carrying P54, wherein the recombinant vector replaces the EGFP gene in the recombinant vector in the step (1) by utilizing a P54 protein;

(8) Extracting the total DNA of the recombinant pseudorabies virus obtained in the step (2), and cotransfecting the total DNA and the recombinant vector carrying P54 in the step (3) into cells to obtain the recombinant pseudorabies virus not containing EGFP fluorescent markers, wherein the recombinant pseudorabies virus is the recombinant pseudorabies virus gene engineering vaccine JS 2012- Δ gE/gI + P54 strain.

The virus strain is pseudorabies virus PRV JS-2012-delta gE/gI + P54 strain, is preserved in China type culture Collection (CCTCC for short) at 16 months 4 in 2022, is addressed to Wuhan university Collection No. eight 299 in Wuhan district, wuhan City, hubei province, and has the preservation number of CCTCC No. V202229.

In another aspect of the invention, there is also provided a vaccine composition comprising the recombinant pseudorabies virus genetic engineering vaccine JS-2012- Δ gE/gI + P54 strain in admixture with an adjuvant or a pharmaceutically acceptable carrier.

The vaccine composition is suitable for nasal drop and injection inoculation.

In another aspect of the invention, the invention also provides an application of the recombinant pseudorabies virus genetic engineering vaccine JS-2012- Δ gE/gI + P54 strain in preparing a vaccine for preventing or treating pseudorabies and African swine fever.

The recombinant pseudorabies virus genetic engineering vaccine JS-2012-delta gE/gI + P54 strain is inoculated to 15-day-old piglets, no clinical symptoms appear, and immune pigs can generate specific antibodies aiming at African swine fever virus P54 protein.

Drawings

The invention is described in further detail below with reference to the drawings and the detailed description.

FIG. 1 is a diagram showing the results of PCR identification of the insertion of rPRV JS-2012- Δ gE/gI + P54 virus into the P54 gene, wherein "M" refers to DNA Marker DL2000, "1" rPRV JS-2012- Δ gE/gI + P54 virus, "2" parental virus JS-2012- Δ gI/gE, "3" positive control, "4" negative control.

FIG. 2 is a diagram showing the results of PCR identification of the insertion sites of rPRV JS-2012- Δ gE/gI + P54 virus, wherein "M" means DNA Marker DL5000, "1" rPRV JS-2012- Δ gE/gI + P54 virus, "2" parental virus JS-2012- Δ gI/gE strain, "3" means positive control, and "4" means negative control.

FIG. 3 one-step growth curves of rPRV JS-2012- Δ gE/gI + P54 virus and parental virus.

FIG. 4 plaque morphology observations of rPRV JS-2012- Δ gE/gI + P54 virus and parental virus.

FIG. 5 is a diagram showing the results of PCR identification of different generations of inserted P54 gene of rPRV JS-2012- Δ gE/gI + P54 virus, wherein "M" refers to DNA Marker DL2000, "1-20" rPRV JS-2012- Δ gE/gI + P54 virus 1-20 generation passage virus, "21" positive control, and "22" negative control.

FIG. 6 is a diagram showing the results of PCR identification of different generations of passage disease insertion sites of rPRV JS-2012- Δ gE/gI + P54 virus, wherein "M" refers to DNA Marker DL5000, "1-20" rPRV JS-2012- Δ gE/gI + P54 virus 1-20 generation passage virus, "21" parent virus PRV JS-2012- Δ gI/gE strain (positive control), "22" refers to negative control, and "M" refers to DNA Marker DL2000.

FIG. 7 results of experiments with P64 mAb as IFA for rPRV JS-2012- Δ gE/gI + P54 different progeny viruses

FIG. 8 sequencing results of the P54 gene of rPRV JS-2012- Δ gE/gI + P54 different generation viruses

FIG. 9 body temperature profile of rPRV JS-2012- Δ gE/gI + P54 Virus after Vaccination of suckling piglets

FIG. 10 Ocular anatomic lesions following rPRV JS-2012- Δ gE/gI + P54 Virus inoculation on suckling piglets

FIG. 11 dynamic changes in P54 protein antibodies following rPRV JS-2012- Δ gE/gI + P54 Virus immunization of suckling piglets

Detailed Description

In the following examples, the experimental procedures without specifying specific conditions were generally carried out according to conventional conditions, for example, the procedures described in "molecular biology laboratory Manual of Fine Ed." (edited by F.M. Osbo, R.E. Kinston, J.G. Sedman et al, edited by Ma Shu, shu Yuelong, beijing: scientific Press, 2004).

Viral strains, cells and vectors

PRV JS-2012-delta gI/gE virus, BHK-21 cell and Vero cell are all preserved in pig infectious disease research laboratory of Shanghai veterinary research institute of Chinese academy of agricultural sciences. Plasmid pBIE-GFP was previously constructed by the swine infectious disease research laboratory of Shanghai veterinary institute, national academy of agricultural sciences. Plasmid and strain: pEGFP-N1, pEGFP-C3 and pBluescript SK (+) were purchased from Shanghai Basidione Biotech Ltd.

MEM and DMEN, available from Invitrogen; scaI, smaI, sacI, nheI, aseI, xbaI, ecorV, xhoI, aflII, and T4 DNA ligase, products of NEB corporation; fugene HD transfection reagent, product of promega corporation; a kit for rapid recovery of small amounts of DNA fragments, omega; 2 XGC Buffer II, dNTP Mix (2.5 mmol/L each), LA-Taq, DL-15000, DL-2000DNA Marker from Takara; other chemical reagents are imported or domestic analytical reagents; e.coli DH 5. Alpha. Competence; purchased from beijing tiangen.

Example 1 construction of recombinant Pseudorabies Virus Gene engineering vaccine JS-2012- Δ gE/gI + P54 Strain

Primer design

According to the whole genome sequence of PRV JS-2012 strain, oligo 6.0 software is used to design a plurality of primers (shown in table 1), JS + EGFP-LF/JS + EGFP-LR and JS + EGFP-RF/JS + EGFP-RR, which are used for amplifying homologous recombination left arm and right arm, sacI and AseI enzyme cutting sites are respectively added at the front end and the rear end of the left recombination arm, ecoR V and AflII enzyme cutting sites are added at the front end of the right recombination arm, and Xho I enzyme cutting sites are added at the rear end. P54 identification up/P54 identification down and JS gG identification up/JS gG identification down are used for amplifying the sizes of the foreign genes and the insertion sites, respectively.

TABLE 1 primer sequences

Construction of PRV JS-2012-delta gI/gE virus containing EGFP green fluorescent protein

Two fragments of 119652-121157 bases and 121168-122680 bases in PRV JS-2012 genome are amplified by using primers JS + EGFP-LF/JS + EGFP-LR and JS + EGFP-RF/JS + EGFP-RR through a PCR method and are used as left and right recombination arms of homologous recombination. Meanwhile, a CMV promoter-EGFP gene fragment is cut out from a pEGFP-C3 plasmid through endonuclease digestion, an SV40polyA signal sequence fragment is cut out from a pEGFP-N1 plasmid, and a left recombination arm-CMV promoter-EGFP gene-SV 40polyA signal sequence-right recombination arm are sequentially assembled in a pBluescript SK (+) vector, so that a recombinant transfer vector pBG-GFP is obtained.

Infecting BHK-21 cells with PRV JS-2012- Δ gI/gE, collecting diseased cells when 70% -80% of cells are diseased, and extracting the total DNA of PRV JS-2012- Δ gI/gE from the infected cells by a phenol-chloroform method. PRV JS-2012-delta gI/gE total DNA and pBG-GFP are co-transfected to BHK-21 cells, collected recombinant viruses are subjected to plaque purification, the obtained viruses are inoculated to vero cells after 4 rounds of plaque purification, and the generated plaques can express EGFP. The successful construction of the PRV JS-2012-delta gI/gE virus containing the EGFP green fluorescent protein is prompted, and the virus is named as rPRV JS-2012-delta gI/gE + EGFP.

Replacement of EGFP marker gene containing EGFP green fluorescent protein PRV JS-2012-delta gI/gE virus

The EGFP gene of the recombinant vector pBG-GFP plasmid is cut off by NheI and XbaI double enzyme digestion, the rest large fragment is recovered, the P54 gene and the recovered large fragment are connected into a new recombinant plasmid, and the new recombinant plasmid is named as pBG-P54.

And extracting the total DNA of the PRV JS-2012-delta gI/gE virus containing the EGFP green fluorescent protein by the method. The extracted total DNA and pBG-P54 are co-transfected into BHK-21 cells, and PRV JS-2012- Δ gI/gE recombinant viruses which do not contain EGFP green fluorescent markers and contain P54 genes are rescued. The primary construction of the recombinant virus is successfully observed by a fluorescence microscope.

Extracting DNA of PRV JS-2012-delta gI/gE virus expressing P54 gene, and performing PCR identification by using P54 identification up/P54 identification down primer. The PCR reaction system is 20 μ L:10 × LA-Taq Buffer II 2ul; dNTP Mix (2.5 mmol/L each) 2ul; p54 identifies up 0.5ul (10 pmol/ul); p54 identifies down 0.5ul (10 pmol/ul); LA-Taq 0.5ul; ddH ₂ O12.5 ul; viral DNA 2ul. The reaction conditions are all that is pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 1min, and circulation for 35 times; finally, extension was carried out at 72 ℃ for 10min. The PCR product was electrophoresed in 1% agarose and visualized in a gel imager. The PCR result shows that the sizes of the foreign gene sequences of the sizes of the fragments amplified by the P54 identification up/P54 identification down primers are consistent (figure 1).

And performing PCR identification by using JS gG identification up/JS gG identification down primers. The PCR reaction system is 20 μ L:2 XGC Buffer II 10ul; dNTP Mix (2.5 mmol/L each) 2ul; JS gG identifies up 0.5ul (10 pmol/ul); JS gG identifies down 0.5ul (10 pmol/ul); LA-Taq 0.5ul; ddH ₂ O4.5 ul; viral DNA 2ul. The reaction conditions are all that is pre-denaturation at 94 ℃ for 5min; denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 30s, extension at 72 ℃ for 2.5min, and circulation for 35 times; finally, extension was carried out at 72 ℃ for 10min. The PCR product was electrophoresed in 1% agarose and visualized in a gel imager. The PCR result shows that JS gG appraises up/JS gG appraises down primerAlthough positive, the fragment size was larger than the parent virus PRV JS-2012- Δ gI/gE, consistent with the expected results (FIG. 2). The result shows that the PRV JS-2012-delta gI/gE virus expressing the P54 gene is successfully constructed, and the virus is named as rPRV JS-2012-delta gE/gI + P54.

Example 2 identification of PRV JS-2012- Δ gI/gE Virus expressing P54 Gene and determination of Virus Titers

The PRV JS-2012-delta gI/gE virus expressing the P54 gene is inoculated to Vero cells, and when 80 percent of the cells have CPE, the virus is harvested. The titer of the virus was determined by 96-well tissue culture plate method, reference (Yan Zhen et al, animal virology, science publishers, 1997). After 10-fold serial dilution of the virus with DMEM containing 2% FBS, the diluted virus was seeded on Vero monolayers on 96-well cell culture plates. Inoculating 8 wells per dilution, setting 8 wells as control (inoculating with DMEM containing 2% FBS), culturing in 5% carbon dioxide incubator at 37 deg.C, observing daily until 4 days after inoculation, recording the number of wells with CPE, and calculating TCID according to Reed-Muench method ₅₀ . The result shows that the titer of the rPRV JS-2012-delta gE/gI + P54 virus on Vero cells is 10 ^8.75 TCID ₅₀ /ml。

Example 3 analysis of biological Properties of PRV JS-2012- Δ gI/gE Virus expressing the P54 Gene

Inoculating the PRV JS-2012-delta gI/gE virus expressing the P54 gene and the parent virus thereof with the virus amount of 1MOI to Vero cells, respectively collecting cell supernatants at different time points (4, 8, 12, 16, 20, 24, 28, 32 and 36 h) after inoculation, and respectively carrying out TCID of the virus ₅₀ And (4) measuring, and drawing a curve according to the measurement result. The results showed that the growth trends of rPRV JS-2012- Δ gE/gI + P54 toxin and parent virus JS-2012- Δ gI/gE were substantially consistent (see FIG. 3).

The PRV JS-2012-delta gI/gE virus expressing the P54 gene and the parental virus are all 10,1,0.1TCID ₅₀ Respectively infecting each well cell in a 6-well plate by using/mL virus, adsorbing the cells for 2 hours at 37 ℃ by using 5% CO2, respectively adding agarose and 2 x MEM with equal volume, and fully mixing the mixture until the temperature is proper, and adding 2mL of mixed solution into each well when the temperature is proper; placing the plate at 4 deg.C until the covering layer is completely solidified, then reversing the plate, placing at 37 deg.C, and culturing with 5% CO2 for 4d; prayer letterTypical plaque formation is seen at appropriate viral infection levels after aldehyde fixation and crystal violet staining. The plaque morphology formed by the rPRV JS-2012- Δ gE/gI + P54 virus on Vero cells was not significantly different from that of the parent virus JS-2012- Δ gI/gE (see FIG. 4).

Genetic stability verification of PRV JS-2012-delta gI/gE virus for expressing P54 gene

The PRV JS-2012-delta gI/gE virus expressing the P54 gene is blindly transmitted for 20 generations on Vero cells, and the genomes of each generation of virus are respectively extracted for exogenous gene amplification and insertion identification. F1, F5, F10, F15 and F20 generation viruses are inoculated to Vero cells to extract the genome of each generation of viruses, and primers for identifying up/P54 and down by using P54 and JS gG are used for identifying up/JS gG and down by respectively carrying out exogenous gene amplification and insertion identification. The results show that: each progeny virus amplified the foreign gene (FIG. 5) and the size of the insertion site was consistent with the expected results (FIG. 6). The IFA results show: the foreign gene P54 in the F1, F5, F10, F15 and F20 viruses is highly expressed (FIG. 7). The sequencing result shows that: no mutation was found in the P54 gene in the F1, F5, F10, F15, and F20 viruses (FIG. 8).

Safety and effectiveness analysis of PRV JS-2012-delta gI/gE virus expressing P54 gene

In order to determine the safety and effectiveness of the rPRV JS-2012-delta gE/gI + P54 on piglets, the PRV JS-2012-delta gI/gE virus expressing the P54 gene is divided into 10 ^5.0 TCID 50/head, immunizing 5 piglets of 15 days old respectively, and setting 5 piglets of the same day old as a blank control. Body temperature measurement is carried out every day within 10 days after immunization, clinical symptoms of the test pigs are observed every day, all the test pigs are killed after 35 days, and pathological changes of all tissues are observed. And simultaneously, blood is collected for 7, 14, 21, 28 and 35 days after immunization respectively to carry out detection on the African swine fever virus P54 protein antibody. The experimental results show that: after the recombinant virus rPRV JS-2012- Δ gE/gI + P54 is inoculated to the piglets, no adverse clinical reaction occurs (see table 2), the body temperature of the piglets is similar to that of a blank control group, no fever occurs (figure 9), the ocular pathological changes of all organs are similar to that of the blank control group, and no obvious ocular pathological changes occur (figure 10), so that the recombinant virus rPRV JS-2012- Δ gE/gI + P54 is very safe for suckling piglets. All in oneThe detection result of the antibody shows that: the recombinant virus rPRV JS-2012- Δ gE/gI + P54 can generate specific antibodies against the African swine fever virus P54 protein 14 days after the piglets are inoculated (figure 11), and is expected to provide immune protection for the African swine fever virus.

TABLE 2 clinical recordings at various times after rPRV JS-2012- Δ gE/gI + P54 vaccination of piglets

a is the number of days at body temperature greater than or equal to 40.5 ℃.

The above-mentioned embodiments only express the embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Shanghai veterinary research institute of Chinese academy of agricultural sciences

Gene engineering vaccine for expressing African swine fever virus P54 gene recombination pseudorabies virus and application thereof

〈160〉 1

〈170〉 PatentIn version 3.3

〈210〉 1

〈211〉 21

〈212〉 DNA

〈213〉JS+EGFP-LF

CGAGCTCGCGACCGACGCCCAGCCCGTGAACC

〈210〉 2

〈211〉 37

〈212〉 DNA

〈213〉JS+EGFP-LR

CATTAATAACTAGGACCGCTGGGCGTGGATCGCACCC

〈210〉 3

〈211〉 33

〈212〉 DNA

〈213〉JS+EGFP-RF

CAGCTTAAGGGTCGGCGCCCCAGGTTCCCATAC

〈210〉 4

〈211〉 33

〈212〉 DNA

〈213〉JS+EGFP-RR

CCGCTCGAGCAGCTCCACGCGCCCGCTGTAGTT

〈210〉 5

〈211〉 19

〈212〉 DNA

213P 54 authentication up

ATGGATTCTGAATTTTTTC

〈210〉 6

〈211〉 24

〈212〉 DNA

< 213 > P54 authentication down

TTACAAGGAGTTTTCTAGGTCTTT

〈210〉 7

〈211〉 22

〈212〉 DNA

Identification up for JS gG (213)

AGGAGGTGACCGAGGAGGAGGC

〈210〉 8

〈211〉 22

〈212〉 DNA

(213) JS gG appraisal down

CGCTGGCAGGTGAGTGTATGGG

Claims (6)

1. A recombinant pseudorabies virus genetic engineering vaccine for expressing an African swine fever virus P54 gene is characterized in that the recombinant pseudorabies virus genetic engineering vaccine expresses an exogenous African swine fever virus P54 gene and lacks gI and gE genes in pseudorabies virus.

2. The recombinant pseudorabies virus genetic engineering vaccine as claimed in claim 1, which is strain JS-2012- Δ gE/gI + P54.

3. The recombinant pseudorabies virus strain expressing the African swine fever virus P54 gene according to claim 1, wherein the virus strain (JS-2012- Δ gE/gI + P54 strain) is preserved in China Center for Type Culture Collection (CCTCC) at 16 months 4 in 2022, with the address of the eight-channel Wuhan university preservation center No. 299 in Wuchang region, hubei province, and the preservation number is CCTCC No. V202229.

4. A preparation method of a recombinant pseudorabies virus genetic engineering vaccine comprises the following steps:

(1) Constructing a recombinant vector, designing primers to amplify left and right recombinant arms of homologous recombination, carrying out enzyme digestion on a CMV promoter-EGFP gene segment and an SV40polyA signal sequence segment, and sequentially assembling the left recombinant arm-CMV promoter-EGFP gene-SV 40polyA signal sequence-right recombinant arm to obtain a recombinant transfer vector;

(2) Extracting total DNA of a pseudorabies virus JS-2012-delta gI/gE strain, cotransfecting the total DNA and the recombinant vector in the step (1) to obtain a recombinant pseudorabies virus containing EGFP fluorescent label;

(3) Constructing a recombinant vector carrying P54, wherein the recombinant vector replaces the EGFP gene in the recombinant vector in the step (1) by P54 protein;

(4) Extracting the total DNA of the recombinant pseudorabies virus obtained in the step (2), and cotransfecting the total DNA and the recombinant vector carrying P54 in the step (3) into cells to obtain the recombinant pseudorabies virus not containing EGFP fluorescent markers, wherein the recombinant pseudorabies virus is the recombinant pseudorabies virus genetic engineering vaccine JS 2012-delta gE/gI + P54 strain.

5. A vaccine composition comprising the recombinant pseudorabies virus genetically engineered vaccine JS-2012- Δ gE/gI + P54 strain in admixture with an adjuvant or a pharmaceutically acceptable carrier.

6. The use of the recombinant pseudorabies virus genetic engineering vaccine JS-2012- Δ gE/gI + P54 strain in claim 1 in the preparation of a vaccine for preventing or treating pseudorabies and swine fever.

Images