CN115595374A - LAMP (loop-mediated isothermal amplification) detection kit and primer composition for mycobacterium tuberculosis - Google Patents
LAMP (loop-mediated isothermal amplification) detection kit and primer composition for mycobacterium tuberculosis Download PDFInfo
- Publication number
- CN115595374A CN115595374A CN202110779455.8A CN202110779455A CN115595374A CN 115595374 A CN115595374 A CN 115595374A CN 202110779455 A CN202110779455 A CN 202110779455A CN 115595374 A CN115595374 A CN 115595374A
- Authority
- CN
- China
- Prior art keywords
- primer
- seq
- detection kit
- nucleotide sequence
- sequence shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention discloses an LAMP detection kit and a primer composition for mycobacterium tuberculosis. The LAMP detection kit comprises an amplification reaction solution, wherein the amplification reaction solution comprises primers F3, B3, FIP and BIP; the primer F3 comprises a nucleotide sequence shown as SEQ ID NO. 1; the primer B3 comprises a nucleotide sequence shown as SEQ ID NO. 2; the primer FIP comprises a nucleotide sequence shown as SEQ ID NO. 3; the primer BIP comprises a nucleotide sequence shown as SEQ ID NO. 4. The kit can quickly and accurately detect the mycobacterium tuberculosis, and has stronger specificity and higher sensitivity.
Description
Technical Field
The invention belongs to the field of biological kits, and relates to a detection kit and a primer composition for mycobacterium tuberculosis, in particular to an LAMP detection kit and a primer composition for mycobacterium tuberculosis.
Background
Tuberculosis is a chronic infectious disease caused by infection of tubercle bacillus, may invade various tracheas, is mainly introduced into organs, namely lungs, and is also called as pulmonary tuberculosis. The mycobacterium tuberculosis is a pathogen of tuberculosis, and early diagnosis and timely treatment are the keys for effectively controlling the spread of tuberculosis and recovering the health of tuberculosis patients.
At present, tuberculosis is mainly detected by means of lung tablets, sputum culture and the like, and the Polymerase Chain Reaction (PCR) technology for detecting mycobacterium tuberculosis has the characteristics of high sensitivity and strong specificity, but the technology also has the problems of easy cross contamination, long time consumption and the like in the clinical application process, has higher requirements on the laboratory environment, and expensive instruments and equipment are not beneficial to popularization and application of basic medical institution units. The loop-mediated isothermal amplification (LAMP) is a novel in-vitro nucleic acid amplification technology, the technology has low requirement on temperature, does not need expensive and precise temperature circulating devices, can be completed only under constant temperature, is favorable for reducing cost, has faster reaction time than the traditional qPCR method, can detect the result in 15min at the fastest speed, is easy to interpret, and can be interpreted by naked eyes without depending on a specific machine.
Disclosure of Invention
In view of the above technical problems, the present invention aims to provide an LAMP detection kit and a primer composition for Mycobacterium tuberculosis, which can rapidly and accurately detect Mycobacterium tuberculosis and have strong specificity and high sensitivity.
According to a first aspect of the invention, a LAMP detection kit for Mycobacterium tuberculosis is provided, which comprises an amplification reaction solution, wherein the amplification reaction solution comprises primers F3, B3, FIP and BIP;
the primer F3 comprises a nucleotide sequence shown as SEQ ID NO. 1;
the primer B3 comprises a nucleotide sequence shown as SEQ ID NO. 2;
the primer FIP comprises a nucleotide sequence shown as SEQ ID NO. 3;
the primer BIP comprises a nucleotide sequence shown as SEQ ID NO. 4.
According to a particular aspect of the invention, specific information on the primers is found in table 1.
TABLE 1
| Name of primer | Serial number | Sequence information (5 '-3') |
| F3 | SEQ ID NO.1 | cgtccattcattccctcctt |
| B3 | SEQ ID NO.2 | aagccattgcctgaccg |
| FIP | SEQ ID NO.3 | acgcctccgaaccgctaccggggaagcagtccctga |
| BIP | SEQ ID NO.4 | cagggtgtccagcaaaaatgggcttcgctgatcgtccgc |
The primers F3, B3, FIP and BIP are 4 amplification primers designed according to a specific conserved target sequence esxA of the mycobacterium tuberculosis and are used for qualitatively detecting the mycobacterium tuberculosis in a sample to be detected. The nucleotide sequence of esxA gene is as follows:
cgggtatcga ggccgcggca agcgcaatcc agggaaatgt cacgtccatt cattccctcc
ttgacgaggg gaagcagtcc ctgaccaagc tcgcagcggc ctggggcggt agcggttcgg
aggcgtacca gggtgtccag caaaaatggg acgccacggc taccgagctg aacaacgcgc
tgcagaacct ggcgcggacg atcagcgaag ccggtcaggc aatggcttcg accga
namely the sequence SEQ ID NO.5 in the sequence table.
In some preferred embodiments, the ratio of the primers F3, B3, FIP and BIP is (1-4): 10-20.
In some more preferred embodiments, the amplification reaction solution comprises 0.1 to 0.4. Mu.M of primer F3, 0.1 to 0.4. Mu.M of primer B3, 1 to 2. Mu.M of primer FIP, and 1 to 2. Mu.M of primer BIP.
Further, the amplification reaction solution further contains 1.0 to 2.0mM each of dATP, dTTP, dCTP and dGTP, and MgCl 2 6 to 10mM, 1.0 to 1.2M, tris-HCl 9.0 to 40mM, KCl 10 to 20mM, mgSO4 1 to 4mM, tritonX-100.05 to 1.0 percent, EVA green dye 1X and Bst DNA polymerase 8 to 20U.
In some preferred embodiments, the amplification reaction is placed in a test tube.
In some more preferred embodiments, a nucleic acid dye and a stabilizing solution are also disposed in the test tube.
Preferably, the nucleic acid dye is pre-applied to the cap of the test tube in a lyophilized form. Optionally, the nucleic acid dye is calcein.
Optionally, the stabilizing liquid is a paraffinic oil.
In some preferred embodiments, the LAMP detection kit further comprises a positive control and/or a negative control. More preferably, the positive control comprises a positive control tube and a positive solution for infectious DNA fragments having a mycobacterium tuberculosis gene placed in the positive control tube. More preferably, the negative control comprises a negative control tube and a negative solution for infectious DNA fragments without mycobacterium tuberculosis gene placed in the negative control tube.
In some preferred embodiments, the LAMP detection kit further comprises an elution tube containing an elution solution.
In some preferred embodiments, the LAMP detection kit further comprises a lysis tube containing a lysis solution.
In some preferred embodiments, the amplification reaction program of the LAMP detection kit is 55-65 ℃ for 18-42 min.
According to a second aspect of the invention, an LAMP primer composition for detecting mycobacterium tuberculosis comprises primers F3, B3, FIP and BIP;
the primer F3 comprises a nucleotide sequence shown as SEQ ID NO. 1;
the primer B3 comprises a nucleotide sequence shown as SEQ ID NO. 2;
the primer FIP comprises a nucleotide sequence shown as SEQ ID NO. 3;
the primer BIP comprises a nucleotide sequence shown as SEQ ID NO. 4.
In some preferred embodiments, the specific information for primers F3, B3, FIP and BIP is found in table 1 above. The primers F3, B3, FIP and BIP are 4 amplification primers designed according to a specific conserved target sequence esxA of the mycobacterium tuberculosis, and are used for qualitatively detecting the mycobacterium tuberculosis in a sample to be detected. The nucleotide sequence of esxA gene is shown in sequence SEQ ID NO.5 in the sequence table.
In some preferred embodiments, the ratio of the primers F3, B3, FIP and BIP is (1-4): 10-20.
In some more preferred embodiments, the concentration of primer F3 is 0.1 to 0.4. Mu.M, the concentration of primer B3 is 0.1 to 0.4. Mu.M, the concentration of primer FIP is 1 to 2. Mu.M, and the concentration of primer BIP is 1 to 2. Mu.M.
Compared with the prior art, the invention has the following advantages by adopting the scheme:
according to the LAMP detection kit and the primer composition, the specific amplification primer is designed for the mycobacterium tuberculosis, the LAMP method is adopted to detect the mycobacterium tuberculosis, the detection time is shortened, the production cost and the detection cost are saved, the detection efficiency is improved, the detection sensitivity is good, the specificity is strong, and a sensitive, accurate, rapid and low-cost detection scheme is provided.
Drawings
In order to more clearly illustrate the technical solution of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.
FIG. 1 is a graph showing the results of detection in example 2;
FIG. 2 is a graph showing the results of measurement of a comparative example;
FIG. 3 is a graph showing the results of detection in example 3.
Detailed Description
Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings so that the advantages and features of the invention may be more readily understood by those skilled in the art. It should be noted that the description of the embodiments is provided to help understanding of the present invention, but the present invention is not limited thereto.
As used in this specification and the appended claims, the terms "comprises" and "comprising" are intended to only encompass the explicitly identified steps and elements, which do not constitute an exclusive list, and that a method or apparatus may include other steps or elements.
It is further understood that the use of "a plurality" in the present specification and claims refers to two or more than two, and other words are analogous. "and/or" describes the association relationship of the associated objects, meaning that there may be three relationships, e.g., a and/or B, which may mean: a exists alone, A and B exist simultaneously, and B exists alone. The character "/" generally indicates that the former and latter associated objects are in an "or" relationship. The singular forms "a", "an", and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.
Reagents and materials:
betaine (betaine), dNTP, KCl, mgSO4, mgCl2, tris-HCl, tritonX-100: purchased from national drug group chemical agents, ltd;
EVA green dye: purchased from Biotum corporation;
BstDNA polymerase for isothermal amplification: purchased from NEB company.
Examples 1 to 3: screening of primer compositions
Three groups of amplification primers are designed and screened according to a specific conserved target sequence esxA of the mycobacterium tuberculosis, and the details are shown in table 2. The sequence of gene esxA is as follows:
cgggtatcga ggccgcggca agcgcaatcc agggaaatgt cacgtccatt cattccctcc
ttgacgaggg gaagcagtcc ctgaccaagc tcgcagcggc ctggggcggt agcggttcgg
aggcgtacca gggtgtccag caaaaatggg acgccacggc taccgagctg aacaacgcgc
tgcagaacct ggcgcggacg atcagcgaag ccggtcaggc aatggcttcg accga
namely the nucleotide sequence shown in SEQ ID NO.5 in the sequence table.
TABLE 2
The three groups of primers are adopted to carry out LAMP amplification reaction on the sample nucleic acid DNA, and fluorescence is collected, and the result shows that the primer group in the embodiment 1 has good specificity and sensitivity; examples 2 and 3 both had varying degrees of non-specific amplification, were poor and were not used for elimination.
Example 4: mycobacterium tuberculosis LAMP detection kit
The LAMP detection kit comprises the following parts:
(1) 1 elution tube filled with eluent;
(2) 1 cracking tube, which is filled with cracking liquid and tiny glass beads;
(3) The test tube is filled with amplification reaction liquid, nucleic acid dye and stabilizing liquid, and every 8 tubes of the test tube are sealed in an aluminum foil bag;
(4) 1 negative tubes for containing negative solution of non-infectious DNA fragments of tuberculoless mycobacteria gene;
(5) And 1 positive tube for containing positive solution of non-infectious DNA fragment of Mycobacterium tuberculosis gene.
In the test tube, the amplification reaction solution consists of the following components: 0.25. Mu.M each of the outer primers F3 and B3 of the amplification reaction, 2.0. Mu.M each of the inner primers FIP and BIP of the amplification reaction, 2.5mM each of dATP, dTTP, dCTP and dGTP, mgCl2:8mM, betaine:1.1M, tris-HCl:25mM, KCl:15mM, mgSO4:2.5mM, tritonX-100:0.52%, EVA green:1X, bst DNA polymerase: 10U.
The stabilizing liquid is paraffin oil.
Wherein, the primer composition adopts 4 amplification primers screened in example 1, namely, the outer primers comprise:
f3:5'-CGTCCATTCATTCCCTCCTT-3', which is the nucleotide sequence shown in SEQ ID NO.1 of the sequence table;
b3:5'-AAGCCATTGCCTGACCG-3', which is the nucleotide sequence shown in SEQ ID NO.2 of the sequence list.
The inner primer comprises:
FIP:5'-ACGCCTCCGAACCGCTACCGGGGAAGCAGTCCCTGA-3', which is the nucleotide sequence shown by SEQ ID NO.3 in the sequence table;
and (3) BIP:5'-CAGGGTGTCCAGCAAAAATGGGCTTCGCTGATCGTCCGC-3', which is the nucleotide sequence shown in SEQ ID NO.4 of the sequence Listing.
The detection steps of the LAMP detection kit are as follows:
(1) Sample elution: taking 1.5ml of liquefied sputum sample, transferring the sample into a centrifuge tube, centrifuging for 5min at 12000r/min, removing supernatant, collecting precipitate, eluting the precipitate for 1 time by using sample eluent, and centrifuging for 5min at 12000r/min, collecting precipitate;
(2) Nucleic acid extraction: resuspending the precipitate with 150 μ l sample lysate, incubating at 95 deg.C for 10min, placing on ice for 2min, and centrifuging at 12000r/min for 3min to obtain supernatant as sample nucleic acid DNA;
(3) Taking out the negative control tube, the test tube and the positive control tube, sequentially and respectively adding 2 mu l of the negative solution, the supernatant and the positive solution in the step (2), incubating for 40 minutes in a fluorescent quantitative PCR instrument at 63 ℃, and collecting fluorescence once every minute;
(4) And judging the result, if the obvious S-shaped curve exists, the test result of the sample is positive, and if the obvious S-shaped curve does not exist, the sample is negative.
Example 5: sensitivity of LAMP detection kit
The LAMP detection kit of the embodiment 4 is used for detecting the mycobacterium tuberculosis with different concentrations, and the detection method specifically comprises the following steps:
(1) Sample treatment: sequentially diluting the separated and purified mycobacterium tuberculosis into the following concentration gradients: 1.0X 10 3 、1.0×10 2 、1.0×10 1 bacteria/mL, 2 replicates per concentration;
(2) Sample elution: respectively taking 1.5ml of the mycobacterium tuberculosis bacterial liquid with different concentration gradients after separation, purification and dilution, transferring the mycobacterium tuberculosis bacterial liquid into 6 centrifuge tubes, centrifuging for 5min at 12000r/min, removing supernatant, collecting precipitate, eluting and precipitating for 1 time by using sample eluent, and centrifuging for 5min at 12000r/min, and collecting precipitate;
(3) Nucleic acid extraction: resuspending the precipitate with 150 μ l sample lysate, incubating at 95 deg.C for 10min, placing on ice for 2min, and centrifuging at 12000r/min for 3min to obtain supernatant as sample nucleic acid DNA;
(4) Sample adding and reacting: taking out the test tube, respectively marking the negative control tube, the detection tube and the positive control tube, sequentially and respectively adding the negative solution, the supernatant in the step (3) and the positive control tube, incubating for 40 minutes at 63 ℃ in a fluorescent quantitative PCR instrument, and collecting fluorescence;
(5) The fluorescence profile is shown in FIG. 1; and (4) interpretation of results: a significant sigmoid curve indicates that the test result of the sample is positive, and a non-sigmoid curve indicates that the sample is negative.
Comparative example
The detection of different concentrations of mycobacterium tuberculosis by using a mycobacterium tuberculosis nucleic acid detection kit (PCR-fluorescent probe method) purchased from Santa Clarita Biotechnology Ltd in Hunan is specifically carried out according to the following steps:
(1) Sample treatment, sample elution, nucleic acid extraction consistent with the procedure in example 5;
(2) The operation was performed completely according to the procedure of Mycobacterium tuberculosis nucleic acid detection kit (PCR-fluorescent probe method) of Santa Claus Biotech Co., ltd, hunan. The fluorescence profile is shown in FIG. 2.
As can be seen from the combination of FIGS. 1 and 2, the sensitivity of the LAMP nucleic acid rapid detection kit of example 4 can reach 1.0X 10 1 bacteria/mL, and the knot of Hunan Shengxiang Biotechnology LtdThe results of the nucleic acid detection kit (PCR-fluorescent probe method) for the mycobacterium tuberculosis are consistent, which indicates that the sensitivity is consistent. By contrast, the LAMP nucleic acid rapid detection kit of the embodiment has the advantages of obviously shorter reaction time than that of a kit of a PCR-fluorescence probe method, convenient operation, simple program and easy interpretation of results.
Example 6: specificity of LAMP detection kit
According to the method of example 4, the LAMP detection kit of example 4 was used to identify separately purified Mycobacterium tuberculosis, mycobacterium avium, mycobacterium kansasii, shigella, salmonella, staphylococcus aureus, streptococcus pneumoniae, haemophilus influenzae, pseudomonas aeruginosa, mycoplasma pneumoniae, chlamydia pneumoniae, influenza A virus, and influenza B virus, respectively.
The detection result shows that the amplification reaction of the detection tubes of the mycobacterium avium, the mycobacterium kansasii, the shigella, the salmonella, the staphylococcus aureus, the streptococcus pneumoniae, the haemophilus influenzae, the pseudomonas aeruginosa, the mycoplasma pneumoniae, the chlamydia pneumoniae, the influenza A virus and the influenza B virus does not see an S-shaped curve, namely the result is judged to be negative; the amplification reaction of the detection tube of the mycobacterium tuberculosis is in an S-shaped curve, and the result is judged to be positive. Good specificity was shown, in particular in FIG. 3.
In summary, the LAMP detection kit of the present invention has the following advantages:
(1) High specificity, the identification of the specific regions of the target sequence esxA by the 4 primers F3, B3, FIP and BIP ensures the high specificity of LAMP amplification;
(2) High sensitivity
Has lower detection limit which can reach 1.0 multiplied by 10 1 The bacteria/mL can reach the level equivalent to that of a kit of a PCR-fluorescence probe method;
(3) Convenient operation
The required reaction temperature is mild and does not exceed 65 ℃, and high temperature is not required; the reaction time is short and is within 42 min; a common fluorescent quantitative PCR instrument does not need a complex instrument;
the above embodiments are merely illustrative of the technical ideas and features of the present invention, and are preferred embodiments, which are intended to enable those skilled in the art to understand the contents of the present invention and implement the present invention, and not to limit the scope of the present invention. All equivalent changes and modifications made according to the principles of the present invention should be covered within the scope of the present invention.
Sequence listing
<110> Jiangsu Hui Xian Yi Xue Zhi technology Co Ltd
<120> Jiangsu Hui Xiui first medicine technology Co., ltd
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgtccattca ttccctcctt 20
<210> 2
<211> 17
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aagccattgc ctgaccg 17
<210> 3
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
acgcctccga accgctaccg gggaagcagt ccctga 36
<210> 4
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cagggtgtcc agcaaaaatg ggcttcgctg atcgtccgc 39
<210> 5
<211> 235
<212> DNA
<213> Mycobacterium tuberculosis (Mycobacterium tuberculosis)
<400> 5
cgggtatcga ggccgcggca agcgcaatcc agggaaatgt cacgtccatt cattccctcc 60
ttgacgaggg gaagcagtcc ctgaccaagc tcgcagcggc ctggggcggt agcggttcgg 120
aggcgtacca gggtgtccag caaaaatggg acgccacggc taccgagctg aacaacgcgc 180
tgcagaacct ggcgcggacg atcagcgaag ccggtcaggc aatggcttcg accga 235
Claims (10)
1. An LAMP detection kit for mycobacterium tuberculosis comprises amplification reaction liquid, wherein the amplification reaction liquid comprises primers F3, B3, FIP and BIP; it is characterized in that the preparation method is characterized in that,
the primer F3 comprises a nucleotide sequence shown as SEQ ID NO. 1;
the primer B3 comprises a nucleotide sequence shown as SEQ ID NO. 2;
the primer FIP comprises a nucleotide sequence shown as SEQ ID NO. 3;
the primer BIP comprises a nucleotide sequence shown as SEQ ID NO. 4.
2. The LAMP detection kit according to claim 1, wherein the ratio of the primers F3, B3, FIP and BIP is (1-4): 10-20.
3. The LAMP detection kit according to claim 2, wherein the amplification reaction solution comprises 0.1-0.4. Mu.M of primer F3, 0.1-0.4. Mu.M of primer B3, 1-2. Mu.M of primer FIP and 1-2. Mu.M of primer BIP.
4. The LAMP detection kit according to claim 3, wherein the amplification reaction solution further comprises 1.0 to 2.0mM each of dATP, dTTP, dCTP and dGTP, and MgCl 2 6 to 10mM, 1.0 to 1.2 mM of betaine, 5363 to M, tris-HCl 9.0 to 40mM, KCl 10 to 20mM, mgSO4 1 to 4mM, tritonX-100.05 to 1.0 percent, EVA green dye 1X and Bst DNA polymerase 8 to 20U.
5. The LAMP detection kit according to claim 1, wherein the amplification reaction solution is placed in a test tube, and a nucleic acid dye and a stabilizing solution are further placed in the test tube.
6. The LAMP detection kit according to claim 1, characterized in that it further comprises a negative control and/or a positive control.
7. The LAMP detection kit according to claim 1, characterized in that it further comprises an elution tube with an eluent.
8. The LAMP detection kit according to claim 1, characterized in that it further comprises a lysis tube containing a lysis buffer.
9. An LAMP primer composition for detecting mycobacterium tuberculosis comprises primers F3, B3, FIP and BIP; it is characterized in that the preparation method is characterized in that,
the primer F3 comprises a nucleotide sequence shown as SEQ ID NO. 1;
the primer B3 comprises a nucleotide sequence shown as SEQ ID NO. 2;
the primer FIP comprises a nucleotide sequence shown as SEQ ID NO. 3;
the primer BIP comprises a nucleotide sequence shown as SEQ ID NO. 4.
10. The LAMP primer composition as claimed in claim 9, wherein the ratio of the primers F3, B3, FIP and BIP is (1-4): 10-20.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110779455.8A CN115595374A (en) | 2021-07-09 | 2021-07-09 | LAMP (loop-mediated isothermal amplification) detection kit and primer composition for mycobacterium tuberculosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110779455.8A CN115595374A (en) | 2021-07-09 | 2021-07-09 | LAMP (loop-mediated isothermal amplification) detection kit and primer composition for mycobacterium tuberculosis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115595374A true CN115595374A (en) | 2023-01-13 |
Family
ID=84841325
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110779455.8A Pending CN115595374A (en) | 2021-07-09 | 2021-07-09 | LAMP (loop-mediated isothermal amplification) detection kit and primer composition for mycobacterium tuberculosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115595374A (en) |
-
2021
- 2021-07-09 CN CN202110779455.8A patent/CN115595374A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110541022B (en) | Mycobacterium tuberculosis complex detection kit based on CRISPR-Cas12a system | |
| Park et al. | Comparison of phenotypic and genotypic methods for the species identification of coagulase-negative staphylococcal isolates from bovine intramammary infections | |
| CN107937613B (en) | Real-time fluorescent multiplex PCR primer probe and kit for seven influenza virus pathogens common to respiratory system | |
| CN111041130B (en) | Compositions, kits and methods for detecting pathogens | |
| CN112458212A (en) | Kit for simultaneously detecting influenza A virus, influenza B virus and respiratory syncytial virus | |
| CN107988405B (en) | PCR detection kit for Salmonella indiana and non-diagnostic detection method thereof | |
| CN112592992A (en) | Primer probe set and kit for combined detection of mycoplasma pneumoniae and chlamydia pneumoniae based on fluorescent RMA method | |
| CN112501324A (en) | Primer and kit for detecting mycobacterium tuberculosis complex and nontuberculous mycobacterium complex based on loop-mediated isothermal amplification | |
| WO1992004458A1 (en) | Drug resistance screening method | |
| CN110863061A (en) | Specific LAMP primer, kit and method for detecting staphylococcus aureus | |
| CN110656037A (en) | Micro-fluidic chip for pathogen nucleic acid detection and detection method | |
| CN115595374A (en) | LAMP (loop-mediated isothermal amplification) detection kit and primer composition for mycobacterium tuberculosis | |
| KR100984785B1 (en) | Primer set and probe for detecting Salmonella typhimurium | |
| CN116103437A (en) | Kit and primer combination and method for LAMP detection of influenza A virus, influenza B virus and respiratory syncytial virus | |
| CN110029179B (en) | Nucleotide molecules and application thereof in identification of corynebacterium striatum | |
| CN115323074A (en) | Primer pair and kit for detecting respiratory tract pathogenic microorganisms and application of primer pair and kit | |
| CN116103438A (en) | Kit for LAMP detection of respiratory viruses and primer composition | |
| CN113564271A (en) | Primer probe set for pathogenic bacterium typing quantitative detection, kit and sample purification method | |
| CN112899385A (en) | Primer group and probe for identifying Brucella S2 vaccine strain and wild strain and application of primer group and probe | |
| Nagdev et al. | Comparison of real-time PCR and conventional PCR assay using IS6110 region of Mycobacterium tuberculosis for efficient diagnosis of tuberculous meningitis and pulmonary tuberculosis | |
| CN110129459B (en) | LAMP primer combination for detecting 5 gram-positive bacteria in intraocular fluid and application | |
| CN110512013B (en) | Method for identifying three corynebacteria by using high-resolution melting curve method | |
| CN108531622B (en) | Hybrid membrane strip and detection kit for mycobacterium tuberculosis complex and avian-intracellular mycobacterium tuberculosis complex | |
| RU2455364C2 (en) | Method of identifying mycobacteria by polymerase chain reaction | |
| CN111334592A (en) | Nucleic acid composition for detecting helicobacter pylori drug-resistant gene and kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |