CN115595357A - Primer group and method for detecting transgenic corn MON810 based on RPA-lateral flow chromatography technology - Google Patents

Abstract

The invention relates to the field of gene detection, in particular to a primer group and a method for detecting transgenic corn MON810 based on an RPA-lateral flow chromatography technology. The primer group provided by the invention has good specificity, and can well realize the amplification of the target gene through the RPA reaction even under the condition that the yield and the purity of the genome are lost, thereby being beneficial to reducing the extraction process and the extraction time in the actual detection and improving the detection efficiency of the transgenic corn MON 810. The method greatly shortens the time required for detecting the transgenic corn MON810, does not need large-scale instruments and equipment, is simple and convenient to operate, and is favorable for popularization and application in actual detection. Meanwhile, the method has higher sensitivity, can detect the transgenic corn with the MON810 content of more than 0.1wt percent, and meets the requirements of national standards.

Description

Primer group and method for detecting transgenic corn MON810 based on RPA-lateral flow chromatography technology

Technical Field

The invention relates to the field of gene detection, in particular to a primer group and a method for detecting transgenic corn MON810 based on an RPA-lateral flow chromatography technology.

Background

The MON810 line transgenic corn can be used as a processing raw material of feed and food, the exogenous gene of the transgenic corn is derived from Cry1Ab gene of Bacillus thuringiensis subsp.Kurstaki HD-1, the transgenic corn is grafted into a plasmid vector PV-ZMBK07 after being subjected to gene modification, and genetic transformation is realized by a particle gun method. The insertion of the MON810 transformation event comprises the CaMV 35S promoter (299 bp), the modified insect-resistant gene Cry1Ab partial coding region (2448 bp), and the intron of the maize heat shock protein gene hsp70 (804 bp). The insecticidal protein expressed by MON810 is insecticidal crystal protein Cry1Ab of Bacillus thuringiensis (Bt), is one of all insect-resistant proteins which is most widely applied, has good resistance to lepidoptera pests such as European corn borer, southwestern corn borer and Asian corn borer, and has no influence on human, mammals and other beneficial insects. The insecticidal mechanism of the Cry1Ab protein is: after being taken by insects, the protein is activated in alkaline intestinal tracts, is specifically combined with midgut epithelial cell receptors to form ion channels or holes, causes osmotic pressure imbalance and leads to insect death. The MON810 line has better effect on preventing and controlling corn borers, and the planting range of the MON810 line is wider and wider from commercialization to the present, but the problems of edible safety and environmental safety are more and more emphasized, so that the analysis and the detection of the transgenic MON810 line are very important.

At present, the national standard for detecting the MON810 strain is a qualitative PCR method, and the entry-exit detection quarantine industry standard adopts an LAMP method for detection. These methods require a long time from genome extraction to subsequent amplification detection, and require specialized equipment.

Meanwhile, the conventional method for extracting maize genome is CTAB method, which takes about 3h. At present, various kits on the market are used for extracting corn DNA for about 1-2h, and the time consumed in the corn genome extraction stage is also long.

Recombinase Polymerase Amplification (RPA) is an isothermal in vitro amplification technique performed in a multi-enzyme system. The RPA reaction can be completed in about 20min generally, the sensitivity is high, the specificity is strong, the required instruments and equipment are simple and portable, and particularly, a RPA commercial kit is published in 2014, so that the RPA operation is simpler and more convenient, and the requirements of field detection can be met. However, due to the complex components of the RPA reaction system, certain influence on the gel imaging result can be caused.

Disclosure of Invention

Technical problem to be solved

In order to develop a rapid, portable, sensitive and highly specific method for detecting transgenic corn MON810, the invention provides a primer group and a method for detecting transgenic corn MON810 based on an RPA-lateral flow chromatography technology.

(II) technical scheme

The invention firstly provides a primer group for detecting transgenic corn MON810 based on an RPA-lateral flow chromatography technology, which comprises one or more groups of the following primer groups:

primer set I:

the forward primer sequence was: 5 'TACAACGCCAAGCCAAGCACGAGAC-3' (SEQ ID No. 9);

the reverse primer sequence is as follows: 5 '(ATCTGCCTGCAGGTGGTCTTAC) -3' (SEQ ID No. 10);

and (3) primer group II:

the forward primer sequence was: 5 'GCTCAAGGCTTACACTCGCT-doped 3' (SEQ ID No. 5);

the reverse primer sequence is as follows: 5 'AAAGGACCTGACTGCTCGC-3' (SEQ ID No. 6);

primer set III:

the forward primer sequence is: 5-;

the reverse primer sequence is as follows: 5 'TGACTGCTCGCAAGCAAATTC-3' (SEQ ID No. 8).

After a large amount of optimization and screening, the primer disclosed by the invention can well realize amplification of a target gene through an RPA reaction even under the condition that the yield and the purity of the extracted genome are lost, so that the extraction process and the extraction time in actual detection are reduced, and the detection efficiency of the transgenic corn MON810 is improved.

Preferably, when the 5' end of the forward primer is modified with iSP18, the other end of the iSP18 is connected with a nucleic acid molecule with the sequence of TTTTTTTTTTTTT (SEQ ID No. 13); when FITC is modified at the 5' end of the reverse primer, the detection effect in the subsequent lateral flow chromatography technology is more favorable.

Specifically, taking the primer group I as an example, the sequence of the modified forward primer is as follows:

5’-TTTTTTTTTTTTTTT/iSp18/TACAACGCCAAGCACGAGAC-3’；

the sequence of the modified reverse primer is as follows:

5’-/FITC/-ATCTGCTGCAGGTGGTCTTAC-3’。

further, the invention also provides a kit for detecting the transgenic corn MON810 based on the RPA-lateral flow chromatography technology, which comprises the primer group.

Furthermore, the invention also provides application of the primer group or the kit in detection of the transgenic corn MON 810.

Further, the invention provides a method for detecting transgenic corn MON810 based on an RPA-lateral flow chromatography technology, which comprises the following steps:

1) Extracting DNA of corn to be detected;

2) Using the DNA as a template, and using the primer group to perform RPA amplification;

3) The RPA amplification product is detected by lateral flow chromatography techniques.

Preferably, in step 1), the extraction of the DNA of the corn to be tested using the reagent in the Wizard magnetic DNA purification system for food kit specifically comprises:

taking 100mg of corn powder to be detected as a calculation reference (the corn powder can be amplified or reduced in equal proportion in actual operation), mixing the corn powder with 490-510 mu L lysine buffer A and 4-6 mu LRNaseA, and shaking vigorously for 8-15s; adding 240-260 mu L of lysine buffer B, shaking vigorously for 8-15s, standing at room temperature for 0.8-1.2min, adding 740-760 mu L of Precipitation solution, shaking vigorously for 8-15s, and filtering to remove impurities;

in addition toAdding 45-55 μ L of the mixed liquid

PMP, shaking vigorously for 4-6s, adding 790-810 mu L of isopropanol, inverting the sample for 10-15 times, aggregating magnetic beads with a magnet, discarding the supernatant, adding 240-260 mu L of lysine buffer B into the magnetic beads, inverting for 2-3 times, aggregating the magnetic beads with a magnet, discarding the supernatant, and cleaning the magnetic beads with an ethanol solution;

and adding 90-110 mu L of nuclease-free water into the washed magnetic beads, inverting for 4-6 times, incubating at 37-42 ℃ for 0.8-1.2min, gathering the magnetic beads by using a magnet, and collecting supernatant, namely the DNA of the corn to be detected.

By the mode, the extraction of the DNA of the corn to be detected can be completed within 5min, the subsequent RPA amplification is not influenced by the yield and the purity of the extracted genome, and the process does not need large-scale instruments and equipment and is simple and convenient to operate.

Furthermore, other factors influencing the detection effect of the transgenic corn MON810 are researched and optimized by the invention, and the following preferred scheme is obtained.

Preferably, in said RPA amplification of step 2), the reaction temperature is 37-42 ℃.

Preferably, the reaction time is 15 to 30min.

As an embodiment of the present invention, an RPA amplification system comprises: freeze-dried enzyme powder, primer free rehydration buffer, forward Primer, reverse Primer, template DNA, magnesium acetate and H ₂ And O. The amplification system is shown below:

preferably, in the lateral flow chromatography technique of step 3), the LFB buffer solution on the sample pad contains:

4 × SSC, 2% BSA, 0.05% Tween20, 0.002% Triton x-100, 10mM Tris-HAc and 5mM KAc.

Preferably, in the lateral flow chromatography technology of the step 3), the addition amount of the AuNPs-anti-FITC solution on the conjugate pad is 2.5-3.5 μ L;

preferably, in the lateral flow chromatography technique of step 3), the amount of RPA product added to the sample pad is 4 to 6 μ L;

preferably, in the lateral flow chromatography technique of step 3), the LFB buffer solution is added to the sample pad in an amount of 150 to 200. Mu.L.

After the LFB (lateral flow chromatography sensor) system in the lateral flow chromatography technology is optimized, the result is not interfered by an RPA complex system, the result is visual, the analysis time is shorter, and the method can be completed in less than 3 min.

As an embodiment of the present invention, the LFB system includes: auNPs-anti-FITC solution on the combination pad, RPA product and LFB buffer solution on the sample pad, a detection line (T line) with the components of streptavidin-biotin-PolyA, and a quality control line (C line) with the components of goat anti-mouse antibody, an absorption pad and a PVC backboard.

The skilled person will be able to combine the above protocols according to his general knowledge and set other operations and parameters in the RPA-lateral flow chromatography technique to obtain a preferred embodiment of the detection method of the invention.

Further, the present invention provides an apparatus for implementing the method, which includes:

(1) A water tank with a clamping groove;

(2) A sample tube with a piston;

the clamping groove is used for fixing the sample tube, the water tank is used for providing water bath, and the piston can divide the sample tube into an upper space and a lower space and is used for controlling the separation and the communication of the upper space and the lower space.

In one embodiment, when the above apparatus is used, the RPA reaction solution may be added to the sample tube of the apparatus and then placed in a 37-42 ℃ water bath for reaction for 15-30min. After the reaction is finished, adding LFB buffer solution, then opening a piston of the device to enable the test strip to fall off, finishing the color development of the test strip after 2-4min, and reading the detection result.

(III) advantageous effects

(1) The primer group provided by the invention has good specificity, and can well realize the amplification of the target gene through the RPA reaction even under the condition that the yield and the purity of the genome are lost, thereby being beneficial to reducing the extraction process and the extraction time in the actual detection and improving the detection efficiency of the transgenic corn MON 810.

(2) The method greatly shortens the time required for detecting the transgenic corn MON810, wherein the extraction time of the genome DNA is only about 5min, the whole detection process can be completed in less than 25min, the method is very quick, does not need large-scale instruments and equipment, is simple and convenient to operate, and is favorable for popularization and application in actual detection.

(3) The method has high sensitivity, can detect the transgenic corn with the MON810 content of more than 0.1wt percent, and meets the requirements of national standards.

(4) The invention provides a 3D integrated device for RPA and LFB reaction, which realizes the rapid, simple and anti-pollution field detection of MON810 strain.

Drawings

FIG. 1 is a schematic diagram of an embodiment of the present invention; wherein, the A diagram is a schematic diagram of the whole detection process, and the B diagram and the C diagram represent the working principles of the RPA and the LFB respectively.

FIG. 2 is a comparison of the rapid extraction of DNA of the present invention with a prior art extraction method; wherein, A is the operation and time difference of the four methods, B, C, D and E are the difference between the genomic DNA, PCR result, RPA result and LFB result extracted by the four genome extraction methods, respectively.

FIG. 3 shows the difference between the yield (A) and purity (B) of the rapid extraction method of DNA of the present invention and the prior art extraction method.

FIG. 4 shows the difference in amplification results between different RPA systems; wherein, the A picture, the B picture and the C picture are respectively the amplification result difference of different primers, different reaction time and different reaction temperature.

FIG. 5 shows the difference in detection effect between different LFB systems; wherein, the graph A, the graph B, the graph C and the graph D are respectively the addition amount of different AuNPs-anti-FITC solutions, the addition amount of different RPA products, the addition amount of different LFB buffers and the detection effect difference of different LFB buffers; in each figure, the top is an LFB image, and the bottom is the image J quantification result.

FIG. 6 shows the results of the sensitivity test of the present invention, in which the top is the LFB image and the bottom is the image J quantification result.

FIG. 7 shows the results of the specificity test of the present invention.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or instruments used are conventional products available from regular distributors, not indicated by the manufacturer.

Example 1

1. Experimental Material

Wizard magnetic DNA purification system for food kit was purchased from Promega, USA, tiangen plant genome extraction kit was purchased from Tiangen Biochemical technology, inc., twistDx Twistamp Basic kit was purchased from TwistDx, UK, CTAB, isopropanol, potassium acetate, ethanol, phenol, chloroform, 10 XPCR buffer, dNTP (2.5 mM), rTaq enzyme (5U/mL), HAuCl4, trisodium citrate, BSA, tween20, triton x-100, and other reagents were purchased from Sigma, streptavidin, anti-FITC, goat anti-mouse antibodies, and the like, from Abcam. Absorbent pads (CFSP 001700, glass fiber sample pad (CFSP 001700), nitrocellulose membrane (135 s), conjugate pad (GFCP 000800), backsheet (HF 000MC 100) were purchased from Millipore corporation.

The primer names and sequences are as follows:

RPA-F：

5’-TTTTTTTTTTTTTTT/iSp18/TACAACGCCAAGCACGAGAC-3’；

RPA-R：

5’-/FITC/-ATCTGCTGCAGGTGGTCTTAC-3’。

2. extraction of transgenic maize MON810 genome

The reagents of Wizard magnetic DNA purification system for food kit were used. 100mg of ground transgenic corn MON810 powder (100%) was weighed into a 2mL centrifuge tube. Add 500. Mu.L lysine buffer A and 5. Mu.L RNaseA, shake vigorously with hand for 10s, mix well. mu.L of lysine buffer B was added, and the mixture was shaken vigorously by hand for 10s to complete mixing and left at room temperature for 1min. Add 750. Mu.L of the receiption solution and shake vigorously for 10s. A new 2mL centrifuge tube was prepared, a gauze having a pore size of about 1mm was placed on the end of the centrifuge tube, and the solution was transferred to the centrifuge tube through the gauze. Intensive mixing

PMP 5s, 50. Mu.L of resuspended

PMP was added to the above solution and shaken vigorously for 5s. Add 800. Mu.L of isopropanol, invert the sample 10-15 times and mix, then place the tube on a magnet, the beads will rapidly aggregate, and discard the supernatant. Add 250. Mu.L lysine buffer B to the beads, invert for 2-3 times and mix, place on magnet for rapid separation, discard the supernatant. The beads were washed three times with 1mL of 70% ethanol. Adding 100 μ L of nuclease-free water, inverting for 5 times, mixing, incubating in 37 deg.C water bath (subsequent RPA temperature) for 1min, placing on magnet, rapidly separating, and transferring supernatant into new centrifuge tube to obtain the DNA.

RPA reaction

Amplification of RPA Using TwistDx twist Amp Basic kit, RPA reaction System including 29.5. Mu.L Primer Free Rehydration buffer, 12.2. Mu.L ddH ₂ O, 2.4. Mu.L of Leach primers (10. Mu.M), 1. Mu.L of template DNA, and the mixture was added to a reaction tube containing 0.2mL of the lyophilized enzyme powder, and 2.5. Mu.L of a 280mM magnesium acetate solution was added to the reaction tube, immediately mixed and incubated at 37 ℃ for 15min. It is noted here that the RPA reaction proceeds immediately upon addition of magnesium acetate, so it is preferred to add magnesium acetate to the tube wall to ensure that the reaction occurs simultaneously after vortexing.

Synthesis of AuNPs and AuNPs-anti-FITC

Firstly, synthesizing AuNPs, soaking a round-bottom flask in acid liquor overnight, cleaning with tap water and ultrapure water, filling ultrapure water to the bottleneck position of the round-bottom flask, and boiling. 190mL of ultrapure water was added first, and 2mL of HAuCl was added ₄ (1 wt%) solution, boiling, adding 8mL trisodium citrate solution (1 wt%), stopping heating after 10-15 min, cooling to room temperature, turning the solution into dark brown, turning into wine red, and packaging.

1mL of the prepared AuNPs was added with 1. Mu.g of anti-FITC and shaken on a rotary shaker for 30-60min. A further 20. Mu.L of BSA (10 wt%) was added and shaking was continued for 5min. Add 100. Mu.L NaCl (10 wt.%) and shake for 2h. And finally, centrifuging at 11000g for 20min, and removing the supernatant to obtain a precipitate, namely AuNPs-anti-FITC.

5. Preparation of lateral flow chromatographic sensor

The lateral flow sensor consists of five parts: a sample pad, a conjugate pad, a nitrocellulose membrane, an absorbent pad and a PVC backsheet. The glass fiber film was cut into a size of 17mm x 30cm as a sample pad, the glass fiber film was cut into a size of 8mm x 30cm as a conjugate pad, and the absorbent paper was cut into a size of 17mm x 30cm as an absorbent pad. Then, the sample pad and the conjugate pad were immersed in a pad treatment solution (containing 0.23% Triton X-100,0.05M Tris-HCl and 0.15MNaCl, pH 8.0) for 30min, followed by drying in an oven at 37 ℃ for 2h and then stored in a dry environment. mu.L of streptavidin (1 mg/mL) and 10. Mu.L of biotin-modified poly A were mixed and incubated for 1h, which was then sprayed on a nitrocellulose membrane (25mm. Times.30cm) with a dipstick streaker at a rate of 1. Mu.L/cm to form test lines. Then, goat anti-mouse antibody (1 mg/mL) was also sprayed on the corresponding position on the nitrocellulose membrane using a dipstick streaker to form a control line. And drying the cellulose nitrate membrane after the detection line and the quality control line are sprayed in an oven at 37 ℃ for 1h, and then storing the cellulose nitrate membrane in a refrigerator at 4 ℃. Finally, the sample pad, the conjugate pad, the nitrocellulose membrane and the absorbent pad are assembled on a PVC (polyvinyl chloride) backboard (60mm x 30cm) according to a certain stacking sequence, and the overlapping width of 2mm is reserved between each part to ensure that the solution can smoothly flow on the chromatography test paper. Finally, the assembled lateral flow chromatography sensor was cut into 3mm wide finished products with a programmable slitting machine.

Design of 3D Integrated devices

The RPA system and the LFB system are implemented in a simple 3D integrated device designed by the present invention. The 3D integrated device includes: (1) A water tank with a clamping groove, and (2) a sample tube with a piston. The clamping groove is used for fixing the sample tube, the water tank is used for 37 ℃ water bath, and the piston is used for controlling LFB. The RPA reaction solution was added to the PCR sample tube of the apparatus, and then placed in a 37 ℃ water bath for reaction for 15min. After the reaction is finished, adding LFB reaction buffer solution, then opening a piston of the device to enable the test strip to fall off, finishing the color development of the test strip after 3min, and reading the detection result.

7. Detection of transgenic maize MON810

Drop-wise on the conjugate pad of LFB 2.5 μ L of AuNPs-anti-FITC. 4 μ L of Levent-specific RPA product was mixed with 150 μ L of LFB buffer (4 x SSC +2% BSA +0.05% Wreen20 +0.002% Triton x-100+10mM Tris-HAc +5mM KAc), the mixture was dropped-wise on the sample pad of LFB and migrated upward by capillary force. After 3min red bands of T and C lines were observed. Image J software can be used to quantify the shade of the T-line. 3 replicates were made for each sample and the average of 3 measurements was calculated.

The principle of the above embodiment is shown in fig. 1, the whole detection process of the present invention is divided into three parts (fig. 1, a), firstly, the extraction of the genomic DNA, and the accelerated extraction method provided by the present invention can be completed in 5min, and does not need large-scale instruments and equipment, and the operation is very simple. The extracted DNA was used for amplification of RPA, both RPA and LFB fractions were performed in a simple 3D integrated device designed according to the present invention. The RPA reaction solution was added to the PCR tube of the apparatus, and then placed in a 37 ℃ water bath for reaction for 15min. After the reaction is finished, adding LFB buffer solution, then opening a piston of the device to enable the test strip to fall off, finishing the color development of the test strip after 3min, and reading the detection result. The whole detection process only needs less than 25min.

Fig. 1, panels B and C, represent the operating principles of RPA and LFB, respectively. Because the forward primer of the RPA contains polyT tail and the reverse primer is modified by FITC, when a target exists, one end of the amplified RPA product contains polyT tail, and the other end is labeled with FITC. The RPA product can interact with AuNPs-anti-FITC on a conjugate pad to form an RPA product-AuNPs-anti-FITC complex. The complex was paired with polyA on the detection line by watson-crick complementation, so that the T line showed the red color of AuNPs. Meanwhile, auNPs-anti-FITC in the system can be combined with the goat anti-mouse antibody on the quality control line, so that the C line also shows red. The red line on line C indicates that the sensor is working properly. When no target is present, the RPA reaction cannot proceed, and no product will cause the T-line to appear colored, and only the C-line to appear red.

Test examples

1. Verification of rapid extraction method of genome DNA

The invention simultaneously compares the traditional CTAB method, the explanation method of a commercially available plant genome DNA extraction kit of Tiangen Biochemical Limited, the explanation method of a commercially available Wizard magnetic DNA purification system for food kit, and the rapid extraction method provided by the invention, and the operation and time difference of the four methods are indicated by a sketch (A picture in figure 2). The differences between the genomic DNA extracted by the four genome extraction methods (FIG. 2, panel B), the PCR results (FIG. 2, panel C), the RPA results (FIG. 2, panel D) and the LFB results (FIG. 2, panel E) were characterized by agarose gel electrophoresis, and the differences in the yields and purities of the genomes obtained by the four methods (FIG. 3) were compared. The result shows that the invention shortens the extraction time, only needs 5min, sacrifices the yield and purity of the extracted genome, but does not affect the results of the subsequent PCR, RPA amplification and LFB.

2. With respect to the RPA reaction System

The RPA amplification system comprises: freeze-dried enzyme powder, primer free regeneration buffer, forward Primer, reverse Primer, template DNA, magnesium acetate and H ₂ And O. The amplification system is shown in Table 1.

TABLE 1 RPA amplification System

(1) Regarding the optimal primer sequence of the RPA amplification system, the designed partial primer sequences are shown in Table 2, and the results are shown in the graph A in FIG. 4, which can prove the advantages of the primer sets (including the primer sets c, d, e) of the present invention, wherein the primer set e has the optimal effect, and combines the subsequent LFB reaction effect, so the final primer sequence is designed as follows:

RPA-F primer: TTTTTTTTTTTTT (SEQ ID No. 13)/iSP 18/TACAACGCCAAGCACGAGAC (SEQ ID No. 9);

RPA-R primer: (ii)/FITC/-ATCTGCTGCAGGTGGTGTGTCTTAC (SEQ ID No. 10);

TABLE 2 RPA System primer optimization sequences

(2) As for the RPA reaction time, 5min,10min,15min,20min and 30min were selected, and the results were as shown in B-diagram in FIG. 4, indicating that the optimum reaction time was 15min.

(3) As for the RPA reaction temperatures, 25 ℃,30 ℃,37 ℃,42 ℃ and 47 ℃ were selected, respectively, and the results are shown in FIG. 4, panel C, which indicates that the optimum reaction temperature is 37 ℃.

3. With respect to LFB systems

The LFB system comprises: auNPs-anti-FITC solution on the combination pad, RPA product and LFB buffer solution on the sample pad, a detection line (T line) with the components of streptavidin-biotin-PolyA, and a quality control line (C line) with the components of goat anti-mouse antibody, an absorption pad and a PVC backboard.

(1) As for the addition amount of AuNPs-anti-FITC solution on the conjugate pad, 1. Mu.L, 1.5. Mu.L, 2. Mu.L, 2.5. Mu.L, 3. Mu.L and 3.5. Mu.L were selected, respectively. The results are shown in FIG. 5, panel A, top LFB image, bottom image J quantification, which indicates 2.5. Mu.L of AuNPs-anti-FITC solution is the optimal addition.

(2) As for the amount of the RPA product added to the sample pad, 1. Mu.L, 2. Mu.L, 3. Mu.L, 4. Mu.L, 5. Mu.L, and 6. Mu.L were selected, respectively. The results are shown in graph B of FIG. 5, where the top is an LFB image and the bottom is an image J quantification, indicating that the optimum amount of RPA product added is 4. Mu.L.

(3) The amounts of LFB buffer added to the sample pad were selected from 50. Mu.L, 100. Mu.L, 150. Mu.L, 200. Mu.L, 250. Mu.L and 300. Mu.L, respectively. The results are shown in the graph C in FIG. 5, in which the top part is the LFB image and the bottom part is the image J quantification result, indicating that the optimum addition amount of the LFB buffer solution is 150. Mu.L.

(4) With respect to the type of LFB buffer on the sample pad, the selection was made separately

a：1x PBS+2％BSA+0.05％Tween20；

b：1x PBS+2％BSA+0.05％Tween20+0.002％Triton x-100；

c：1x PBS+2％BSA+0.05％Tween20+0.002％Triton x-100+10mM Tris-HAc+5mM KAc；

d：4x SSC+2％BSA+0.05％Tween20；

e：4x SSC+2％BSA+0.05％Tween20+0.002％Triton x-100；

f：4x SSC+2％BSA+0.002％Triton x-100+10mM Tris-HAc+5mM KAc；

g:4x SSC+2％BSA+0.05％Tween20+0.002％Triton x-100+10mM Tris-HAc+5mM KAc。

The results are shown in graph D in FIG. 5, where the top is the LFB image and the bottom is the image J quantification result, indicating that the optimal type of LFB buffer is: the aqueous content of 4x SSC +2 BSA +0.05% Twen20 +0.002% Triton x-100+10mM Tris-HAc +5mM KAc was determined.

4. Sensitivity testing

Corn samples containing 100wt%, 50wt%, 25wt%, 10wt%, 1wt% and 0.1wt% of MON810 by mass are selected, and the results of the tests on the optimum reaction system and the reaction conditions are shown in FIG. 6, and the samples containing 0.1wt% of MON810 by mass can be measured and meet the national regulation standard.

5. Specificity verification

8 transgenic crops were selected, respectively: transgenic maize MON810 (a), transgenic maize GA21 (b), transgenic maize BT11 (c), transgenic maize MIR640 (d), transgenic soybean MON87769 (e), transgenic soybean MON87705 (f), transgenic rice 10% tt51 (g), transgenic rapeseed RF3 (h). The optimal reaction system and reaction conditions obtained by the experiment are used for determination, the result is shown in figure 7, only the T line and the C line of the MON810 show red, and only the C line of other transgenic crops shows red, which indicates that the detection method constructed by the invention has good specificity.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of agriculture in China

<120> primer group and method for detecting transgenic corn MON810 based on RPA-lateral flow chromatography technology

<130> KHP211117137.4

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tacctgatcc gctacaacgc 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aaaaggacct gactgctcgc 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggctacatcg aagacagcca 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctgctcgcaa gcaaattcgg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gctcaaggct tacactcgct 20

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaaggacctg actgctcgc 19

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agctcaaggc ttacactcgc 20

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tgactgctcg caagcaaatt c 21

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tacaacgcca agcacgagac 20

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atctgctgca ggtggtctta c 21

<210> 11

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cgctgagcgc ccccagcccg atcggcaagt gtgcc 35

<210> 12

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

attaacagct gcaatggctc aatctggtcg gcgcc 35

<210> 13

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tttttttttt ttttt 15

Claims (10)

1. A primer group for detecting transgenic corn MON810 based on an RPA-lateral flow chromatography technology is characterized by comprising one or more of the following primer groups:

a primer set I:

the forward primer sequence is: 5 'TACAACGCCAAGCCAAGCACGAGAC-3';

the reverse primer sequence is as follows: 5 'ATCTGCCTGCAGGTGGTCTTAC-3';

and (3) primer group II:

the forward primer sequence is: 5 'GCTCAAGGCTTACACTCGCT-3';

the reverse primer sequence is: 5 'AAAGGACCTGACTGCTCGC-3';

primer set III:

the forward primer sequence was: 5 'AGCTCAAGGCTTACACTCGC-3';

the reverse primer sequence is as follows: 5 'TGACTGCTCGCAAGCAAATTC-3'.

2. The primer set of claim 1, wherein the 5' end of the forward primer is modified with iSP18, and the other end of iSP18 is connected with nucleic acid molecules with sequence number TTTTTTTTTTTTT; FITC is modified at the 5' end of the reverse primer.

3. A kit for detecting the transgenic corn MON810 based on RPA-lateral flow chromatography comprising the primer set of claim 1 or 2.

4. Use of the primer set of claim 1 or 2 or the kit of claim 3 for detecting transgenic corn MON 810.

5. A method for detecting transgenic corn MON810 based on RPA-lateral flow chromatography technology is characterized by comprising the following steps:

1) Extracting DNA of corn to be detected;

2) Performing RPA amplification using the primer set according to claim 1 or 2 using the DNA as a template;

3) The RPA amplification product is detected by lateral flow chromatography techniques.

6. The method as claimed in claim 5, wherein in step 1), the extraction of the DNA of the corn to be tested using the reagent in the Wizard magnetic DNA purification system for food kit specifically comprises:

mixing the corn powder to be detected with 490-510 mu L lysine buffer A and 4-6 mu LRNaseA by taking 100mg of the corn powder to be detected as a calculation reference, and shaking vigorously for 8-15s; adding 240-260 mu L of lysine buffer B, shaking vigorously for 8-15s, standing at room temperature for 0.8-1.2min, adding 740-760 mu L of Precipitation solution, shaking vigorously for 8-15s, and filtering to remove impurities;

adding 45-55 μ L of the solution after impurity removal

PMP, shaking vigorously for 4-6s, adding 790-810 mu L of isopropanol, inverting the sample for 10-15 times, aggregating magnetic beads with a magnet, discarding the supernatant, adding 240-260 mu L of lysine buffer B into the magnetic beads, inverting for 2-3 times, aggregating the magnetic beads with a magnet, discarding the supernatant, and cleaning the magnetic beads with an ethanol solution;

adding 90-110 mu L of nuclease-free water into the washed magnetic beads, inverting for 4-6 times, incubating at 37-42 ℃ for 0.8-1.2min, gathering the magnetic beads by a magnet, and collecting supernatant, namely the DNA of the corn to be detected.

7. The method according to claim 5 or 6, wherein in the RPA amplification of step 2), the reaction temperature is 37-42 ℃; and/or the reaction time is 15-30min.

8. The method of any one of claims 5-7, wherein in the lateral flow chromatography technique of step 3), the LFB buffer solution on the sample pad comprises:

4 × SSC, 2% BSA, 0.05% Tween20, 0.002% Triton x-100, 10mM Tris-HAc and 5mM KAc.

9. The method according to any one of claims 5 to 8, characterized in that, in the lateral flow chromatography technique of step 3),

the addition amount of the AuNPs-anti-FITC solution on the bonding pad is 2.5-3.5 mu L;

and/or the amount of RPA product added to the sample pad is 4-6 μ L;

and/or the LFB buffer solution on the sample pad is added in an amount of 150-200. Mu.L.

10. An apparatus for implementing the method of any one of claims 5-9, comprising:

(1) A water tank with a clamping groove;

(2) A sample tube with a piston;

the clamping groove is used for fixing the sample tube, the water tank is used for providing water bath, and the piston can divide the sample tube into an upper space and a lower space and is used for controlling the separation and the communication of the upper space and the lower space.

Images