CN1155843A - Composition for inducing a mucosal imune response - Google Patents

Abstract

The invention relates to a pharmaceutical composition intended for inducing in a host mammal a protective immune response against an antigen, at a mucosal effector site, which comprises at least two identical or different products each containing an inducing agent for the immune response, selected from the antigen and, provided the antigen is protein in nature, an expression cassette capable of expressing the antigen, for a concomitant or consecutive administration; one of the products being formulated so as to be administered via the nasobuccal route so that the inducing agent is targeted to the inducer site(s) for an immune response in the naso-oropharynx or the salivary glands, the other product being formulated so as to be administered via a suitable mucosal route other than the nasal route, so that the inducing agent is targeted to the inducer site for an immune response at the effector site at which the immune response is sought. Optionally, such a composition can also comprise a third product, identical to or different from the first two, formulated for systemic administration.

Description

The compositions that mucosa immunity-inducing is replied

The present invention relates to a kind of vaccinating agents box that is used for inducing the protective immune response of the Pathogenic organisms that the mammal opposing infects mucosa.

The immunity cell can be concentrated in organ, perhaps forms the lymphoid tissue of more or less disperse, and these tissues and organ are formed lymphsystem jointly.Primary lymphatic organ is lymphocytopoietic main position (thymus, a bone marrow), secondary lymphoid organ and organize medium-sized lymphocyte to interact or and antigenic action, this is putative.Secondary lymphoid organ comprises spleen, and lymph node and the lymph sample relevant with mucosa form (MALT refers to the lymphoid tissue that mucosa is relevant), peyer's patches and palatine tonsil.Except the lymphoid tissue of forming MALT, in the mucosa of stomach, small intestinal, colon, trachea and other many organs, also find a large amount of lymphocytes.

Lymphocyte is moved to secondary lymphoid organ after breaking up in primary lymphatic organ.The latter is the inductive site of systemic immunity or mucosal immunity.Because they also are called " system " or " mucosa " organ.

In " system " organ, generally acknowledged spleen and entered sanguimotor antigen to react; The periphery tuberosity plays defense reaction to entering its antigen that influences the anatomic region of lymphatic drainage.List different tuberositys in the following table corresponding to water conservancy diversion zone (inducing or effective-site).

The immune system relevant with mucosa protection body is resisted by the mucous epithelium surface and is entered and at the antigen of this stop.This comprises waldeyer ring and occurs and respiratory tract (BALT is the relevant lymphoid tissue of bronchus), digestive tract (GACT is the relevant lymphoid tissue of the intestinal) lymphoid tissue relevant with urogenital tract.The immune system relevant with mucosa (inductive site) sees the following form:

In case stimulate secondary to induce organ, lymphocyte can transport by lymph moves to effective-site, through the tuberosity that links to each other with effective-site, be suitable for by these one-level tuberositys of bigger tuberosity drain at there, effusive lymph venule ends at thoracic duct.Lymph adds blood circulation from the latter, goes to target organ or effective-site by the blood circulation cell.And the lymphocyte of MALT, the latter is recycled to mucosal areas.For example, activated cell passes continuous lymph node in the Pai Shi knot, enters blood then and rests on some mucosal areas.The ability of the adhesion molecule that this selectivity recirculation should particularly be expressed at mucosa capillary venule endotheliocyte owing to the lymph part Identification.As this machine-processed result, the antigenic stimulus of mucosal areas (inducer) can be induced the reaction (effector) of other mucosal areas.

So far, many immunization methods have been reported in the scientific literature.In general the principal character of these methods is: (i) immunogen essence, (ii) give immunogenic approach, and (iii) immunogenic composition.

About immunogenic essence, be that (RNA, it is that proteinic immunogenic probability has been known for a long time that immunogen DNA) substitutes essence to nucleic acid with essence.Therefore needn't elaborate to this respect.

Be beneficial to prevention or the treatment immunization route of mucosal infections and method as the target of some researchs, however, do not run into the method for the system of the successful system that the tackles infection of picture vaccination yet.

As if yet these researchs show when relating to a kind of with the pathogen that self is fixed on the mucosa jointly, and the immunity that system gives is not enough to the protection that provides enough.In order to resist this infection effectively, except that must be by mucosa inducing immunoreactive, system induction immunity in addition can get ideal results usually.The submerged mucosa of mucosal administration immunostimulation lymphoid tissue drain pathogen is essentially possible, thus at this/these mucosas obtain immunne response.

A type immunoglobulin (IgA) is the key component of immunoglobulin on gastrointestinal, breathing, urogenital or other the mucomembranous surface.They are secreted in these mucosas, and are considered to the infection that influences these positions is shielded.

Mucosal immune response is directly obtaining at the effector mucosa or after another mucosal sites mucosal administration immunity that certain distance is arranged apart from the infection site of resisting in advance usually.The mucosa main path that can enter immunity is oral cavity route, gastric approach, nose approach, urogenital approach and rectum approach.And no matter oral cavity route is that inoculation is to resist the infection that gastrointestinal mucosa infects or resist other mucosa because it is convenient to utilize is preferred approach.

In order to explain this point, the various examples of prior art provide as follows:

Recently, Czinn etal., Vaccine (1993) 11:637 have recommended in order to resist the inoculation method summary of helicobacter pylori, and this bacterium is the cause of disease material of most gastric ulcers.Germfree mouse gives the sonicate (sonicate that gives directly enters gastric by intubate) of felis Helicobacter pylori by the gastric approach as adjuvant with cholera toxin.After the immunity of felis Helicobacter pylori, find protected by immune mouse.

For convenience's sake, be called " oral immunisation " in this step of paper remainder.The phase jljl of this paper is at Czinn; Nedrud Patent Application WO93/20,843 can find.

Jerborn et al., the cholera vaccination research that Vacccine (1992) 10:130 report is finished with a group Sweden experimenter.Give two kinds of dosage vaccines, swallow with the solution form.This vaccine proof effectively there is no danger.

By the nose approach influenza inoculation is successfully realized on one's body that child and adult report is seen Andeerson et al., J. Clin.Microbiol. (1992) 30:2230 and Treanor etal., Ann.Iater.Med. (1992) 117:625.

Gallichan et al. after J.Infect.Dis. (1993) 168:622 report intranasal is expressed the recombinant adenovirus of herpes simplex virus (HSV) Glycoprotein B, may cause the reaction of mucosa and systemic immunity.In a word, authors think that in general, their method may obtain to resist mucosa or spread through sex intercourse the long-term protection of virus.

Some research, as Forest et al., it is a kind of route of entry to whole mucomembranous immune system that Voccine (1990) 8:209 proposes the rectum approach, and it should induce the mucosal immune response away from the mucous membrane of rectum position, can be used as immunogenic route of entry.

For obtaining the selection mode that a kind of ideal is replied, several authors describe the combination of different immunization routes.For example, being combined in the following paper that mucosal administration and system give has description.

Keren et al., Infect.Immun. (1988) 56:910 shows a kind of method by the immunity of associating approach, and is parenteral and oral, a ratio good immune effect by a kind of approach aspect the IgA reaction of resisting shigella flexneri.In fact, mice intramuscular injection under paralysis reaches and accepts antigen by conduit in gastric.

Yoshimura et al., Arch.Ptolaryngol.Head Neck Surg. (1991) 117:889 suggestion is resisted this immunization method of streptococcus pneumoniae otitis by the inoculation with oral combination of system and is tested on Cavia porcellus.In fact, said oral administration is by duodenum or stomach catheter, or takes the intestinal capsule and finish.Authors only point out with capsular form system and oral administration use in conjunction just to be for the best.

Forest.et al., Infect.Immun. (1992) 60 (2): 465 in order to induce the reaction of IgA to salmonella typhi, tested several immunization wayses on the person.Mouth and subcutaneous route usage are as follows: mouthful; Mouth/mouth; Mouthful/subcutaneous and subcutaneous/mouthful.After the author pointed out oral several days of the first time, the parenteral injection once was not enough to into IgA reaction again.On the contrary, oral vaccine and repeat once to be for the best.

Hartman et al., Infect.Immun. (1994) 62 (2): 412 describe several immunization methods to shigella.One of them comprises intraperitoneal or subcutaneous injection first especially, gives the booster immunization agent by the order approach again.This method is tested in the keratoconjunctivitis of contrast groups Cavia porcellus.The author points out that in zoopery first the mucosal administration immunity is necessary to inducing protection.By parenteral and twice immunity mucosa, strengthened defence capability.

Nedrud et al., J.Immunol. (1987) 139:3484 describe the immunization method of a kind of anti-Sendai viral infection (nasopharynx that may develop into bronchitis and pneumonia infects).By carrying out this method, the effective-site of the immunne response of searching is whole respiratory tract.People's such as Nedrud method comprises two key steps: oral immunity (gastric) and the activation by the nose approach first.In general, the desirable approach of one of mouthful approach (gastric) inductive site of not being considered to make derivant (being Sendai virus herein) arrive immunne response in the respiratory tract.

Have been found that various mucosal sites resist various antigenic immunne response, can strengthen greatly in conjunction with the immunization method of several approach by replenishing.

Therefore, the present invention relates to a kind of pharmaceutical composition, it is used for inducing host mammal to resist antigenic protective immunological reaction at the mucosa effective-site, it contains at least two kinds of identical or different components, every kind contains and is selected from antigenic immunoreation derivant, if antigen is protein, also contain and can express this antigenic expression cassette, be used to follow or successive administration; A kind of product is for preparing by muzzle chamber administration, make the inductive site of immunne response in derivant targeting nose-oropharynx or the salivary gland, another kind of product is for preparing the immunological effect position that derivant targeting immunne response is sought by the suitable mucosal route administration beyond the nose approach.

Randomly comprise the third product according to medicine of the present invention, with preceding two kinds identical or different, it contains and is selected from antigenic immune response inducing agent, if and antigen is in the nature protein, then have and to express this antigenic expression cassette, preferably before preceding two products that illustrated, preparation is with being administered systemically.

In other words, purpose of the present invention is in the host mammal, at effective-site at a kind of antigen, the test kit that mucosa immunity-inducing is replied, it comprises:

(i) preferred first kind of immune response inducing agent is optional from antigen, and if antigen be protein, then be selected from and can express this antigenic expression cassette, the DNA of coding for antigens or RNA fragment; And

(ii) second of immunne response and the third derivant, be selected from antigen, and if antigen be essentially protein, be selected from and can express this antigenic expression cassette, encode this antigenic DNA or RNA fragment; And

(a) randomly, the guidance that is administered systemically of first kind of derivant,

(b) guidance of the muzzle chamber administration of second kind of derivant,

(c) the third derivant by suitable mucosa but not the administration of nose approach instruct so that antigen targeting effector site's immunoreation inductive site, this effective-site be this immunne response seek and

(d) the first, the second and the third derivant is followed or the guidance of successive administration.

The invention still further relates at the mucosa effective-site, induce host mammal, arrange as follows according to random order to antigenic immunne response method:

(i) first kind of immune response inducing agent randomly is administered systemically to host mammal, is selected from antigen, and if antigen be protein, be selected from can antigen expressed expression cassette this antigenic DNA of coding or RNA fragment;

(ii) second kind of immune response inducing agent gives host mammal by nose and/or oral cavity (muzzle chamber) approach, is selected from antigen, and if antigen be protein, be selected from and can express this antigenic expression cassette, encode this antigenic DNA or RNA fragment; With

(iii) the third immune response inducing agent is by suitable mucosa but not the nose approach gives host mammal, so that the immunological effect position that antigen targeting immunne response is sought, be selected from antigen, if and antigen is in the nature protein, be selected from and express this antigenic expression cassette, encode this antigenic DNA or RNA fragment.

The administration of first kind of derivant can be carried out with the injection of single dose system easily, as vein, muscle, intradermal or subcutaneous injection.The selection of injection site and approach will depend on the lymph node of desiring targeting especially.Can point out that if for example desire the tuberosity in targeting abdominal cavity, then preferably use intramuscular approach (but not subcutaneous route) to inject in back of the body territory, lumbar region, this derivant is preferably with particulate form administration.Derivant is mended with adjuvant by precipitation or absorption easily.Adjuvant can be the adjuvant of traditional aluminum phosphate, hydroxide or calcium-phosphate type, perhaps as the adjuvant of calcium-phosphate type, perhaps as the adjuvant of polyphosphazene.Also can be liposome, microsphere, ISCOM or viruslike particle (VLP) type adjuvant, when desiring the tuberosity in targeting water conservancy diversion urogenital organ zone, use latter's advantageous particularly.All these adjuvants are familiar with those skilled in the art.Proper dosage changes corresponding to some parameter, as the essence of processed individuality or derivant.From application point, antigenic dosage can change between 5-100 μ g, preferred 25-50 μ g.

Purpose of the present invention relatively is that this approach makes immunogen arrive Wa Erdaiershi ring or its equivalent substantially by " muzzle chamber approach " meaning, is NALT non-human kind on the kind.Should know that muzzle chamber (or oral cavity) approach can not obscure with " mouthful approach " that be often referred to, more rightly called after " gastric approach ".

Mouthful approach comprise that the gastric approach should make derivant (antigen) mainly arrive the mucosa (digestive tract and be mainly small intestinal and send the Er Shi joint) of lower area, and oral cavity route transports the mucosa of derivant arrival upper area basically.The entry site of oral cavity route and mouthful approach can be identical; Entry site is a mouth in this case.Yet approach is different in essence.

Identical explanation is applicable to the lung approach, and it makes derivant reach the mucosa of central region (bronchus).

In order to optimize the purpose immunne response, immunogenic preparation also is important.In general, mucosa immunity-inducing reply aspect the antigen of microgranule combination more effective than soluble antigen.

The approach that the derivant that begins from same entry site is followed depends on multiple factor; Particulate character and size as the derivant existence form are wherein arranged, and help the atomizing suspended particulates and in order to promote particulate instrument and equipment, particularly its shape, spout direction and driving velocity.

About particulate character, those skilled in the art has extensive selection on it is handled; Though this selection without limits, preferably from two groups: liposome and microsphere.It is conventional preparing these particulate methods, and the needs according to oneself are selected one of them within those skilled in the art's ability, and determine particulate size, according to the path of being adopted, particulate size must be suitable for derivant, and is distributed in ideally on the target mucosa.

Thereby the suggestion particle diameter by nose or oral cavity route administration is greater than 10 μ m; By the lung administration, particle diameter 0.05-10 μ m, preferred 0.05-5 μ m; The through port administration, particle diameter 0.05-10 μ m, preferred 0.05-5 μ m.

The immune main effects thing position that can find is respiratory system (bronchus, nasopharynx, a lung), stomach, intestinal and genitourinary system.With regard to respiratory system, preferably the third derivant preparation is beneficial to by lung administration (as liposome, microsphere etc.).With regard to stomach or intestinal, preferably the third derivant is beneficial to the through port approach, comprises the preparation (as having protection, liposome, microsphere, disulfate or ' Yanming ' capsules for clearing) of gastric administration.With regard to intestinal or genitourinary system, preferably the third derivant is beneficial to the preparation of urinary system administration, as with the vaginal capsule form, or by the rectum approach, as with suppository form.

Second or the third derivant can also replenish adjuvant outside nontoxic, liposome or the microsphere and the adjuvant outside more nontoxic base or the bacteriotoxic detoxification form.

According to preferred embodiment, antibacterial such as escherichia coli, salmonella minnesota, the main lipopolysaccharide of Salmonella typhimurium or shigella flexneri (MPLA: main boivin antigen) can be used as second or the adjuvant of the third derivant.

Such chemical compound has now found that to have good adjuvant characteristic, can carry out immunity at this by mucosal route.

Therefore, another aspect of the present invention covers the mucosal adjuvants of MPLA as the preparation preparation, said preparation (i) contains a kind of antigen, if antigen is essentially protein, then be to express this antigenic expression cassette, encode this antigenic DNA or RNA fragment (ii) are used for antigenic mucosal immune response, and (iii) are used for by the mucosal route administration.

Should point out as instructing, to second kind or the third derivant, when the latter is antigen, can the administration of every dose 100 μ g-1mg ratio.

According to preferred embodiment, first kind of derivant (being administered systemically) at first injected during administration, allows during strengthening (give second or the third derivant) preceding 7-45 of having days first preferred 20-30 days interval.

According to another embodiment, first kind of derivant also can with second or the third derivant give simultaneously.

Second kind and the third derivant can be followed or give continuously.When in a period of time, scattering administration, with 7-45 days at interval administration for well, preferred 28 days.

If desired, also may imagine first kind and second kind of derivant and use (just almost on the same day) simultaneously, and repeat this operation once after several days at interval.

The selection of each does not all rely on other kind in three kinds of derivants.At least a antigen is favourable among the three.These three kinds of derivants are identical to be very common, and in this case, it is easy selecting antigen.

As being proteinic antigenic substitute in essence, also available (i) vaccine carrier, as poxvirus or adenovirus type, contain this antigenic dna fragmentation of coding, and be positioned under the suitable promoter control, (ii) this dna fragmentation (not carried by vaccine carrier) is placed into plasmid form (dna fragmentation preferably inserts plasmid, but not remains on a kind of simple transcript unit state), or be present in (anion or cationic) Liposomal formulation, (iii) or be corresponding RNA fragment.This probability has description in the literature.

For any different probability of implementing to mention in the earlier paragraphs, can use can be in mammalian cell the encode promoter of this antigenic dna fragmentation of abduction delivering.Because vaccine is often referred to based on DNA (for they being different from the vaccine based on viral vector), the loose virus of human cell (hCMV) early promoter is a kind of alternative promoter.For such inoculation, the plasmid that preferred use can not be duplicated in mammal.Basically unconformable plasmid also is suitable.

According to preferred embodiment, be a kind of Heliobacter pylori antigen to the antigen of the morbific antibacterial of host mammal, as the pheron form of helicobacter pylori urase, perhaps one of the ureA of urase of the same race or ureB subunit.

More at large, position from immunization method, and simultaneously more accurately from antigenic position as target, can point out that theme of the present invention also is the dna fragmentation with a kind of Heliobacter pylori antigen of coding, be used to prevent or treat the manufacturing of a kind of compositions of helicobacter pylori infections, and be used for nose or the administration of muzzle chamber.For this purpose, the dna fragmentation as Inoculant meets above-mentioned standard.

Also finding needn't give immunogen at these positions in order to induce the mucosal immune response to the source of disease organism that infects stomach or intestinal, is enough and give immunity by the top approach, promptly by muzzle chamber approach, and suitably coupling system administration.

Therefore, on the other hand, the present invention relates in host mammal, induce compositions to a kind of antigen immune response, in stomach or intestinal, comprise the derivant that is used for immunne response, it is selected from can express this antigenic expression cassette, encode this antigenic DNA or RNA fragment, and preparation is used for the derivant by muzzle chamber administration.

This identical aspect, the present invention also covers the application of product, this product is selected from a kind of antigen, if and antigen is essentially protein, then choosing can be expressed this antigenic expression cassette, and encode this antigenic DNA or RNA fragment are used to prepare a kind of compositions, it induces the immunne response to product in host mammal stomach or intestinal, and is used for by muzzle chamber administration.

This compositions is useful when it comprises a kind of antigen that infects the source of disease organism of stomach or intestinal mucosa, particularly because its protection host mammal is avoided above-mentioned infection, especially provides the long-time protection that continues, association memory T and bone-marrow-derived lymphocyte.Possible infection is by helicobacter pylori, vibrio cholera, shigella flexneri, close Nei Shi shigella, Salmonella enteritidis, difficile clostridium, and small intestine colon yersinia and the enterotoxication and escherichia coli intestinal pathogenic cause.As for related antigen, itself can be kill, the pathogenic agent of form such as cracking or perform toxic attenuation, or the antigenic component of this pathogen, as the membrane antigen of capsid polysaccharide or purified form or the polypeptide character of this pathogen, obtain from the pathogen direct purification or by recombinant DNA technology.

For example, with regard to the compositions of prevention helicobacter pylori infections, the antigen of selecting can be the pheron of urase, form by A and B subunit, corresponding D NA fragment is as Labigne etc., J.Bact. (1991) 173 (6): described in 1920, perhaps one of subunit of pheron, or cytotoxin (WO93/181850), or adhesin family (can be incorporated into the protein on the host cell receptor, and can mediate pathogen and host cell be connected initial course of infection) protein, or the protein regulated of ferrum.

With regard to cholera vaccine, the antigen of selection can be the b subunit of cholera toxin of describing in the document.

The present invention is by being explained as follows with reference to figure 1-5.

Fig. 1 describes the Elispot analysis and causes salivary gland (1A) stomach function regulating (1B) immunne response by giving b subunit of cholera toxin (CTB).The result relates to three kinds of immunization methods: subcutaneous/mouthful (ScO); Subcutaneous/nose (ScN); With subcutaneous/mouth+nose (Sc+N)." mouth " is interpreted as finger " gastric " certainly.The corresponding IgA of dark shade on the bright background replys.The corresponding IgG2a of shallow shade on the dark background replys.Reaction in the stomach is with reaction mice quantitaes in one group of 5 mice; The number of the point of per 1,000,000 cells is 9 powers (order).

Fig. 2 describes according to subcutaneous/subcutaneous+mouth+nose (Sc/Sc+O+N) method, gives the Elispot analysis that CTB induces salivary gland (2A) stomach function regulating (2B) immunne response." mouth " is interpreted as finger " gastric " certainly.The corresponding IgA of dark shade on the bright background replys.The corresponding IgG2a of shallow shade on the dark background replys.Reaction in the stomach is with reaction mice quantitaes in one group of 5 mice; The number of the point of per 1,000,000 cells is 8.2 powers.

Fig. 3 describes according to subcutaneous (Alumen)/mouth+nose (liposome) method, gives the Elispot analysis that jack bean urease is induced salivary gland (3A) stomach function regulating (3B) immunne response." mouth " is interpreted as finger " gastric " certainly.The corresponding IgA of dark shade on the bright background replys.The corresponding IgG2a of shallow shade on the dark background replys.Reaction in the stomach is with reaction mice quantitaes in one group of 5 mice; The number of the point of per 1,000,000 cells is 620 powers.

Fig. 4 describes according to subcutaneous (liposome)/mouth+nose (liposome) method, gives the Elispot analysis that jack bean urease is induced salivary gland (4A) stomach function regulating (4B) immunne response." mouth " is interpreted as finger " gastric " certainly.The corresponding IgA of dark shade on the bright background replys.The corresponding IgG2a of shallow shade on the dark background replys.Reaction in the stomach is with reaction mice quantitaes in one group of 5 mice; The number of per 1,000,000 cell points is 15 powers.

Fig. 5 describes to be used for to produce the plasmid pTG8665 of the pheron of helicobacter pylori urase.

Fig. 6 describes plasmid pCMC/E1a, wherein HiadIII (1)-SacII (754) fragment contains the hCMV promoter, XhoI (771)-SmaI (2104) fragment contains E1aORF, SmaI (2104)-EcoRI (2810) fragment contains BGH3 ' end, and the corresponding pUC19 skeleton of EcoRI (2810)-HindIII (1) fragment.

Fig. 7 describes plasmid pCB-11.

Fig. 8 describes plasmid pCB-ureB, and wherein ureB ORF extends to 2487 from nucleotide 777.

Fig. 9 is with tiring that graphic representation antiurease antibody writes down in the Balb/c mice with plasmid pCB-ureB immunity.Successive curve is described IgG and is tired, and alternate curve is described IgA and tired.■ is corresponding to intranasal approach repeat administration 3 (DO, 21 and 42; Independent plasmid or plasmid+liposome).◆ corresponding to intramuscular approach first immunisation (plasmid), again through the intranasal approach at D21 and twice of 42 booster immunization (plasmid+liposome).● corresponding to intradermal approach first immunisation (plasmid), again through the intranasal approach at D21 and 42 booster immunizations 2 times (plasmid+liposome).

Figure 10 with the graphic representation immunity after the optical density of mice stomach medium, suitably attack there with the pheron of helicobacter pylori urase.First post: infecting mouse not; Second post: obtain the immunity of empty liposome first through subcutaneous mice, again through twice booster immunization of (nose+gastric) approach; The 3rd post: mice is by the subcutaneous immunity that obtains containing the urase liposome first, again through twice booster immunization of (nose+gastric) approach; The 4th post: mice contains the liposome three times of urase through (nose+gastric) approach.In all cases, use all is the DC-Chol liposome.

Embodiment 1: the inducing of the mucosal immune response of anti-cholera toxin subunit B (CTB)

1.A. the preparation of immune composition

1.A.a) be used for by the subcutaneous route administration

1 μ l purification and the CTB preparation that is concentrated into 10 mg/ml (being equivalent to 10 μ gCTB) mixes with 100 μ l, 1% aluminium hydroxide preparation.It is 500 μ l that mixed liquor is diluted to final volume with the PBS buffer.This just form one individually dosed.

1.A.b) be used for through port (gastric) administration

Take out the latex bead (Polysciences cat.17 34) of 3 μ l volumes, wash (centrifugal three minutes of 1000rpm) 3 times with the PBS buffer then.These latex bead are mixed so that obtain the preparation that CTB is diluted to 1/20 (being equivalent to final concentration is 0.5mg/ml) with purification and the CTB preparation that is concentrated into 10mg/ml again.This preparation is stirred 2 hours.

With 200 μ M carbonate buffer solutions this preparation is diluted to 1/25 at last.

1.A.c) be used for by the nose administration

Being coated in CTB preparation on the latex bead with as 1.A.b) method described in saving obtains, has only finally to dilute this step and save with carbonate buffer solution.

This preparation reuse PBS buffer dilution as required.

1.1.d) be used for through port+nose administration

By as 1.A.b) and 1.A.c) described method, mouthful and nasal administration unite and be used for finishing administration.

1.B. immunization method

Compare three kinds of immunization methods.They are:

1) subcutaneous/mouthful (gastric)

2) subcutaneous/nose

3) subcutaneous/mouthful (gastric)+nose

By subcutaneous route, the Balb/c mice is accepted 500 μ l with as 1.A.a) method make contain the preparation of 10 μ gCTB with aluminum salt adjuvant.

The PBS of the subcutaneous acceptance 500 μ l of control group mice.

Behind the subcutaneous injection 28 days, tried mice and be divided into 3 groups.

First group of mice, through being connected with the intubate of 1ml syringe, gastric is accepted as 1.A.b) joint describe be coated in the 10 μ gCTB that contain on the latex bead, the preparation of volume 500 μ l.By same approach, control group mice is accepted 500 μ l carbonate buffer solutions.

Second group of mice, nasal route is accepted as 1.A.c) joint describe be coated in the 10 μ gCTB that contain on the latex bead, the preparation of volume 20 μ l.Whole 20 μ l are splashed in the muzzle.By same approach, control group mice is accepted 20 μ lPBS.

The 3rd group of mice, per os (gastric) approach and nose approach are respectively accepted 10 μ gCTB simultaneously.Being coated in CTB preparation on the latex bead with as 1.A.d) method of description obtains in the joint.The part mice is used as contrast.

Behind the booster immunization 15 days, the harmonization of the stomach salivary gland of excision mice; According to Mega etc., the method that J.ofImmunology (1992) 148:2030 describes is extracted cell, and according to Czerkinsky etc. at Theoretical and technical aspects of ELISA and other Solid PhaseImmuno Assays (D.M.kenneny and S.J.Chalacombe Eds): John Wiley﹠amp; Sons, Chichester, the method that NY describes, Elispot analyzes IgA and replys.

The result is presented at Fig. 1, and comments on as follows:

Subcutaneous/mouthful (gastric) method proof can not be induced strong mucosal immune response, and such replying in the situation of subcutaneous/nose and subcutaneous/mouthful (gastric)+nose method can be observed.

A kind of method in back proves best, because the good local-acknowledgement that produces by IgA all can obtain in the salivary gland stomach function regulating.

1.C. the immunization method that replenishes

As described in the 1.B. part, the mice of subcutaneous injection CTB, inject after 28 days, simultaneously:

-through port (gastric) approach contains 40 μ g such as 1.A.d) CTB of part preparation, the preparation of volume 500 μ l.

-by the nose approach, contain 10 μ g such as 1.A.d) and the CTB of part preparation, the preparation of volume 20 μ l.

-by subcutaneous route, contain 10 μ g such as 1.A.a) and the CTB of part preparation, the preparation of volume 300 μ l.

Behind the booster immunization 15 days, the harmonization of the stomach salivary gland of excision mice extracted cell, and IgA replys Elispot and analyzes.

The results are shown in Figure 2.Obtained good IgA type immunne response (response of 5/5 mice), this is an index of mucosa local immune response.

Embodiment 2: the inducing of the mucosal immune response of anti-jack bean urease

2.A. the preparation of immune composition

2.A.a) make the urase of adjuvant with aluminum

In the PBS buffer, be condensed into the 5 μ l jack bean urease preparation (Boehringer of 4 mg/ml; Ref 737 348) mix with 100 μ l, 1% aluminium hydroxide preparation.This mixture obtains 500 μ l with the dilution of PBS buffer, wherein contains 20 μ g urases.This of composition is individually dosed.

2.A.b) urase in the liposome

Adopt following three kinds of technology:

1. injection ethanol

The 16.4mg lipoprotein mixture that cholesterol (Sigma), dipalmitoyl phosphatidyl choline (Nattermann phospholipid) and GLYCEROL,DIMYRISTOYL PHOSPHATIDYL sodium alkoxide are formed with mol ratio at 5: 4: 1 is dissolved in 50 μ l dehydrated alcohol.This solution contains to 2ml in the aqueous solution of 4mg/ml jack bean urease by the Hamilton injector to inject, is diluted to 1/10 with the PBS buffer.Then 45 ℃ of continuous stirring.

In water contacted, fat spontaneously formed liposome (being mainly mean size is the monolayer shape liposome of 50-100nm), encased the urase solution of certain volume.

With Sepharose CL-4B (Pharmacia) gel filtration column, these liposomees of purification (separating) from excessive free urase.Urase (Enzymobeads with the iodine-125 labelling ^TMTechnology Biorad) records urase parcel amount 3～6%.If desired, the liposome suspension is limited to the Novacell of 10kD by exclusion ^TMCell (Filtron) ultrafiltration and concentration.

2. extruding

The 16.4mg lipoprotein mixture that cholesterol (Sigma), dipalmitoyl phosphatidyl choline (Nattermann phospholipid), GLYCEROL,DIMYRISTOYL PHOSPHATIDYL sodium alkoxide are formed with mol ratio at 5: 4: 1 is dissolved in the 4ml chloroform in the 25ml round bottom Pyrex flask.Solution evaporation (Buchi rotary evaporator) forms thin adipose membrane on flask walls.Adipose membrane high vacuum dry 2 hours is then with the 2ml water dissolution that contains the 8mg jack bean urease.45 ℃ were stirred after 4 hours, and suspension is the polycarbonate membrane (Nucleopore of 400nm by two stack porositys ^TM, Costar) extruding (Extruder ^TM, Lipex Biomembrances Inc., Vancouver) 5 times, form an equally distributed about 400nm of diameter that is mainly, contain the monolayer shape liposome of urase.With Sepharose CL-4B (Pharmacia) gel filtration column, these liposomees of purification (separating) from excessive free urase.Urase (Enzymobeads with the iodine-125 labelling ^TMTechnology Biorad) records urase parcel amount 5～10%.If desired, the liposome suspension is limited to the Novacell of 10 kD by exclusion ^TMCell (Filtron) ultrafiltration and concentration.

3. Micro Fluid bed process

Obtain by alcoholic solution (D3F-France) lyophilization, the 82mg lipoprotein mixture that cholesterol (Sigma), dipalmitoyl phosphatidyl choline (Nattermann phospholipid), GLYCEROL,DIMYRISTOYL PHOSPHATIDYL sodium alkoxide are formed with mol ratio at 5: 4: 1, contain 150mM NaCl with 10ml, the Hepes buffer dissolving of pH7.410mM.The Hepes buffer contains the helicobacter pylori urase of 3.6mg/ml reorganization pheron form.After 4 hours, the suspension that obtains carries out 5 with M110S microfluidization instrument (Microfluidics Co.) at 500 kPa and takes turns microfluidization 45 ℃ of stirrings, forms the uniform distribution that is mainly unilamellar liposome, and this liposome diameter is about 100nm and contains urase.These liposomees by the gel filtration purification (Sepharose CL-4B, Pharmacia).Adopt Micro BCA test kit (Pierce), the urase parcel amount that records by the albumen test is 14.5%.If desired, the liposome suspension is limited to the Novacell of 10kD by exclusion ^TMCell (Filtron) ultrafiltration and concentration.

2.A.c) make the urase in the liposome of adjuvant with MPLA

When the preparation liposome, the MPLA that can add in lipoprotein mixture with respect to fat amount 1,2 or 5% ratio (extracts from escherichia coli, Sigma).

2.B immunization method

Two kinds of immunization methods have been tested.They are:

1) subcutaneous (aluminum)/[mouthful (gastric)+nose] (liposome)

2) subcutaneous (liposome)/[mouthful (gastric)+nose] (liposome)

The OF1 mice is accepted through subcutaneous approach:

-or contain 20 μ g urases, resemble 2.A.a) as described in the joint with aluminum as adjuvant, final volume is the preparation of 500 μ l,

-or in Liposomal formulation, contain 20 μ g urases, by 2.A.b) joint obtains, volume is the preparation of 500 μ l.

Behind the subcutaneous injection 28 days, mice is accepted simultaneously:

-through port (gastric) approach is by 2.A.b) save the 20 μ g urases that contain in the Liposomal formulation that obtains, volume is the preparation of 500 μ l; And

-by the nose approach, by 2.A.b) and saving the 20 μ g urases that contain in the Liposomal formulation that obtains, volume is the preparation of 50 μ l.

Behind the booster immunization 15 days, the harmonization of the stomach salivary gland of excision mice; Extract cell according to method when beginning, and according to the method for describing, Elispot analyzes IgA and replys when beginning to sample description.

The results are shown in Figure 3 and 4.Fig. 3 demonstration, with regard to subcutaneous (aluminum)/[mouthful (gastric)+nose] (liposome) method, though a little less than the IgA of salivary gland replys, main, and, have only 3 in 5 mices to immunne response for stomach (3B), have the point of high quantity.

Fig. 4 shows, with regard to subcutaneous (liposome)/[mouthful (gastric)+nose] (liposome) method, reply at salivary gland (4A) fine, and in the stomach a little less than (4B).This prompting, except that used method, antigenic preparation is important.

Embodiment 3: to the vaccinating agents box of helicobacter pylori infections

Three kinds of preparations that contain the pheron of helicobacter pylori urase, each is prepared in a different manner according to the instructions of taking of facing, and is installed in the test kit.

3.A. preparation pheron

Wherein a kind of plasmid (pILL914) from description such as Labigne (on seeing), produce the N-end parts segment (up to HindIII inscribe site) of coding UreA with primer OTG5973 and OTG5974 by PCR, and in the UreA translation initiation codon, contain a BspHI site.

BspHI

OTG5973：CCAAATC?ATG?AAA?CTC?ACC?CCA?AAA?GAG?TTA

Met?Lys?Leu?Thr?Pro?Lys?Glu?Leu??GAT?AAG?TTG??Asp?Lys?Leu

HindIII

OTG?5974：GCTTCTACATAGTTAAGCTTAATGCCTT

Digest the segment that PCR produces with BspHI and HindIII, and insert the pTG3704 carrier that digests with NcoI and HindIII simultaneously, obtain plasmid pTG8665 shown in Figure 5 with the 2.35kbHindIII segment of the pILL914 that has UreA and UreB3 ' part.This plasmid has UreA and the UreB group that merges with the araB promoter.The pTG3704 carrier is being published in the European patent application EP T584 of 1994.3.9, description is arranged in 266.This carrier is used by oneself, and the Klenow polymerase is handled, the destructive plasmid para13 (Cagnon etc., Prot.Eng. (1991) 4:843) in the SphI site.

Coli strain Xac-I (Normandy etc., PNAS (1986) 83:6548) transforms with plasmid pTG8665.Transformant is cultivated in the LB culture medium that is supplemented with 100 μ g/ml ampicillin.In exponential phase of growth, add 0.2% arabinose, be used for inducing the expression of ureA and ureB.Different induction times (1～3 hour) afterwards, the generation level of UreA and UreB very high (account for greatly total protein 10%), cell is removed then.

By the centrifugal 220g cell that from 2.51 culture medium, reclaims.

These cytolysiss contain in the 20mM sodium phosphate buffer of 175mgPMSF (1mM) at about 1 liter of pH7.5.Adding 4 μ l concentration then in cell suspension is 250U/ μ l (Merck; Ref.1654), be equivalent to the benzoic acid enzymatic solution of final concentration 1 unit/ml, and 1mlMMgCl2 solution.Reaction was carried out 30 minutes.

The pressure 1 hour that suspension is introduced in Rannie device (high pressure homogenizer) and stands 1000bars is with smudge cells.

In two kinds of purification process, make one's options then.

3.A.a) first method

The fragmentation of cell is monitored by optical density.When OD is the order of 2.5-2, takes off suspension and add 1ml0.5MEDTA solution from device.At 10000rpm centrifugal 2 hours, reclaim supernatant then and centrifugal 1 hour, to remove striping at 100000 * g.

According to being similar to Hu etc., the method that Infect.Immun. (1992) 60:2657 describes is carried out purification.Adjusting contains the supernatant of soluble protein to pH6.8, then with sample on the flow velocity of 4ml/min to ion exchange column (DEAE-Sepharose, Pharmacia) on, column volume 5cm * 25cm is with the 20mM kaliumphosphate buffer balance of the pH6.8 that contains 1mMPMSF (PO buffer).The KCl linear gradient elution of pillar from 0 to 0.5M.Each collect 14ml and analyze with SDS-PAGE.Containing, the fraction of pure urase is merged.

KCl joins in the fraction that obtains thus, makes that the KCl final concentration is 1M, this solution by last sample to phenyl-Sepharose (Pharmacia) post.The KCl linear gradient elution of pillar from 1 to 0M.With in the past the same, part is collected and is analyzed with SDS-PAGE.Contain that the fraction of pure urea is merged, to the 20mM kaliumphosphate buffer dialysis of pH7.5.

Sample is to the equilibrated ion exchange column of 20mM kaliumphosphate buffer (the Q-Sepharose Fast Flow with pH7.5 on the fraction that obtains; Pharmacia) on; With in the past the same, the KCl linear gradient elution of pillar from 0 to 0.5M, the collection component is also analyzed with SDS-PAGE.

Merge the fraction that contains urea and also be the membrance concentration of 100kDa, arrive on the obtained component with on the equilibrated solvent resistant column of 20mM sodium phosphate buffer (Sephacryl400HR) of pH7.5 by interceptive value (cut-offthreshold); After having analyzed different components, collect those components that contain urase and by blocking the membrance concentration that threshold values is 100kDa, and see through the membrane filtration of porosity 0.22 μ m with SDS-PAGE.Aseptic sucrose solution is added in the urase solution, to obtain 2% final concentration.This solution of lyophilization and store with this form is stand-by then.

3.A.b) second method

Regulate this supernatant to pH7.5, the flow velocity with 4ml/min is downloaded to ion exchange column (Q-Sepharose Fast Flow then; Pharmacia; Ref.17-0510-01) on, column volume 5cm * 25cm, elder generation's 20mM potassium phosphate level pad balance pillar of the pH7.5 that contains 1mMPMSF.KCl level pad linear gradient elution (the gradient volume: 2.251 of pillar from 0 to 0.5M; Flow velocity: 4ml/min).

Each collect the 14ml fraction and analyze with SDS-PAGE.Collect and merge the most purified component (the 82-121 fraction that these normally begin from gradient).

It is pillar (the chelating Sepharose Fast Flow of the zinc chelating of 2.6cm * 11cm to volume with sample on the flow velocity of 2ml/min that Q-Sepharose merges sample; Pharmacia; Ref.l7-0575-02) on.This post prepares in advance by following method.

Pillar is with the 0.2MZnCl of 2 times of volumes ₂Sample on the solution metal, then with the flushing of the 0.5MNaCl solution of 3 times of volumes, 3 times of volumes of reuse contains 0.5MNaCl, 1mM imidazoles and 1mMPMSF, the 50mM Tris-HCl level pad flushing of pH8 subsequently.The level pad that contains the 10mM imidazoles with 1 times of volume is washed pillar, and then contains the level pad flushing of 1mM imidazoles with 3 times of volumes.

After load was finished, pillar was washed till washings with level pad and gets back to baseline value (the flow velocity washing with 0.2ml/min is spent the night).

Pillar reuse 200ml contains the level pad flushing of 7.5mM imidazoles, flow velocity 1ml/min.

From imidazoles is linear gradient (gradient volume from 7.5mM to 30mM; 250ml; Flow velocity 1ml/min) level pad carries out eluting.

Each 10ml component of collecting is analyzed with SDS-PAGE.Collection also merges the component (generally being the 19-30 component that begins from gradient) that contains pure urase.

Chelating Sepharose merges the ultrafiltration reconcentration of sample through passing through Amicon YM100 film to 25ml.

Then on this concentrate sample to Sephacryl S-300 pillar (Pharmacia; Ref.17-0599-01) on, column volume 2.6cm * 96cm, this post 20mM potassium phosphate of pH7.5,0.15M NaCl buffer balance.

Chromatograph is finished with the flow velocity of 0.5ml/min.Each collect the 10ml component and analyze with SDS-PAGE.The fraction that contains pure urase is merged (these generally are 21 to 27 components behind the end of the sample), and the ultrafiltration and concentration through passing through Amicon YM100 film is to about 2.5mg/ml.The pheron preparation membrane filtration of porosity 0.22 μ m, stored frozen is-20 ℃ or lyophilization in the presence of sucrose.

Being prepared as follows of test kit:

3.B. be used for is the pheron of adjuvant with aluminum through subcutaneous administration

The potion injection is prepared as follows: with the aluminium hydroxide preparation (alhydrogel of 250 μ l1mg/ml; Superfos) adsorb the 20 μ l pheron solution (being equivalent to 50 μ g) that 3.A. obtains; + 4 ℃ of absorption after 2 hours, by add PBS with volume-adjustment to 500 μ l.

3.C. the pheron in liposome is used for the administration of per nasal oral cavity route with aerocolloidal form

The helicobacter pylori urase is wrapped in the liposome with the pheron form.The average diameter of these liposomees is 100nm, and protein content is 60 μ g/mg fat.

Total amount is the urase per nasal oral cavity route administration by the prescription manufacturing of 0.1mg.Aerocolloidal use can be passed through (the Le Prieure of VALOIS company, BPG, 27110 Le Neubourg) two spouts (nose and mouth) pump of the model of selling allows to discharge limited volume according to its type, and be fit to be equipped with the spout (each no more than 300 μ l of administration can repeat at this dosage of the interval of selecting) of the variable-size of pump receptacle.

3.D. be used for the pheron of the liposome of intragastric administration

Giving total amount by the gastric approach is the urase that 0.5mg makes by prescription.Pheron is according to the described method preparation of 3.C part, and lyophilization is also dissolved with the 200mM sodium bicarbonate solution of 20ml then.

3.E. immunization method

The dosage of being grown up and preparing among the subcutaneous 3.B. of acceptance.After injecting 28 days first, the dosage of accepting to prepare among the 3.C. by muzzle chamber approach and swallowing the dosage for preparing among the 3.D. on the same day again.

Embodiment 4: the vaccine kit (DNA of coding urase ureB subunit is as Inoculant) that is used for helicobacter pylori infections

4.A. the structure of plasmid vector

Eukaryotic expression vector pCB-11 makes up from following three kinds of elements:

-in advance with the plasmid pUC19 (can buy) of XbaI and EcoRI digestion;

-isolating SepI-SacII segment from plasmid pCMV/E1a (Fig. 6), it contains just like USP 5,168, the early promoter of 062 described people's cytomegalovirus (hCMV); And

-contain the SacII-EcoRI segment of bovine growth hormone gene 3 ' part, comprise mRNA polyadenylation signal and mRNA critical sequences.This SacII-EcoRI segment obtains from plasmid pBS-BGH, makes up by inserting Bluescript plasmid (can buy) from the BamHI-EcoRI segment of plasmid pCMV/E1a.

These three segments couple together and form plasmid pCB-11 (Fig. 7).

The UreB gene is from plasmid pILL914 and pass through pcr amplification with following primer:

Forward primer:

5′cgtctcgagccaccatgaaaaagattagcagaaaag

Downstream primer:

5′atcgtcccgggcaggcctcttagaaaatgctaaagagttgcgccaagct.。

Forward primer makes the upstream of XhoI restriction site and Kozak sequence importing ureB open reading-frame (ORF), and downstream primer makes the SmaI site import the downstream of ORF.The segment that PCR produces is digested, and inserts the plasmid PCB-11 that digests with XhoI and SmaI in advance then and produces plasmid pCB-ureB (Fig. 8).

With this plasmid transformation escherichia coli XI1, cultivate according to routine techniques then.The plasmid of amplification is collected with standard mode, i.e. alkaline lysis isodensity caesium chloride density gradient centrifugation then.DNA dissolves with distilled water or normal saline (0.9%NaCl).

4.B. prepare a kind of liposome/DNA compositions

According to Kunitake etc., the described method of J.Am.Chem.Soc. (1984) 106:1978, production bromination O, O ', O " three-dodecyl-N-(ω-trimethyl ammonia-dodecyl) three (methylol) ammonia ethane (being called TCI-12 usually).Get this product of 10mg and be dissolved in 50 μ l ethanol then.Said preparation with Hamilton syringe fast injection to 2ml getting in the ionized water 42 ℃ of stirrings.

Diameter is about liposome spontaneous formation in the water-soluble course of dissolution of ethanol of 50nm.Thereby obtain to contain the Liposomal formulation of 5.3mMTC1-12.

The preparation that 100 μ l are obtained above adds 150 μ l distilled water dilutings.Add the water soluble preparation that 250 μ l concentration are the plasmid pCB-ureB of 2 μ g/ μ l then.Application of sample ratio (TC1-12/ nucleotide) is 0.35.

4.C. immunization method

The Balb/c mice in age in 6-8 week is injected the anesthesia of xylazine+ketamine mixture in advance.They are the pCB-ureB that gives three times 50 μ g at interval respectively with three weeks.

In different immunization methods, people use intranasal (IN) approach usually, intramuscular (IM) approach and intradermal (ID) approach.

When being used for, be that 100 μ g/ml are dissolved in the dna solution of normal saline or liposome/DNA mixture that 4.B. obtains splashes into the nostril with 50 μ l concentration by the intranasal administration.

When being used for, be that 100 μ g/ml are dissolved in the dna solution of normal saline with having 29 with 50 μ l concentration by the intramuscular administration ^#The Hamilton injector to inject of syringe needle is gone into musculus quadriceps.

When being used for, be the dna solution gas blowout mouth syringe (Mesoflash of 500 μ g/ml with 100 μ l concentration by the intradermal administration ^TM10) be expelled to five in advance the back scrape the hair skin part.

Various immunization methods are as follows:

Group	First administration (0 day)	Booster immunization (21 days) for the first time	Booster immunization (42 days) for the second time
				1 (15 mice)	?Lipo-pCB?ureB/IN	??Lipo-pCB?ureB/IN	???Lipo-pCB?ureB/IN
2 (15 mices)	????pCB?ureB/IN	?????pCB?ureB/IN	??????pCB?ureB/IN
				3 (10 mices)	?????pCB?ureB/IM	??lipo-pCB?ureB/IN	??lipo-pCB?ureB/IN
4 (10 mices)	?????pCB?ureB/ID	??lipo-pCB?ureB/IN	??lipo-pCB?ureB/IN

At 14,35 and 56 days, from every mice, get serum sample.Detect antiurease production of antibodies (with the solubility helicobacter pylorus fungus extract of purification) by ELISA.

The result who concludes among Fig. 9 shows that various immunization methods can induce strong IgG to reply and more weak IgA replys.

Embodiment 5: the inducing of the mucosal immune response of anti-helicobacter pylori urase

5.A. the preparation of immune composition

0.8gDC-Chol and 2.4g dioleoyl phospholipid phatidylcholine (DOPC) are joined in the 20ml chloroform of 1 liter of round-bottomed flask.With this mixture vacuum evaporation, make flask walls form one deck adipose membrane.This film is dried overnight under fine vacuum then.

This film is with being dissolved in the 20mMHepes buffer, pH6.2, and concentration is 400ml pheron solution (as preparation as described in the embodiment 3.A.) dissolving of 1.5 mg/ml.Mixture was stirring at room 6 hours.

The multilamellar vesicle suspension that obtains carries out 10 with M110S Micro Fluid bed (Microfluidics Co.) at 500kPa and takes turns microfluidization, forms the uniform distribution that is mainly unilamellar liposome, and this liposome diameter is about 100nm and contains pheron.

(0.45 μ Millipore) filters, and is adding 20g sucrose postlyophilization then by the Stenivex-HV filter membrane with these liposomees.

The size that records liposome by light scattering (Zetamaster, Malvern Instruments) is 148 ± 52nm.The parcel degree of pheron is 20%; The remainder of total amount is with free form (not wrapping up) existence.

5.B. immunization method

Age in 6-8 week, the Swiss mice was divided into four groups (10 mice/groups), and at J0, J28 and J56 obtain a dosage of the preparation that obtains above by all means.

Two kinds of immunization methods have been tested.They are:

1) subcutaneous/gastric+nose/gastric+nose; With

2) gastric+nose, triplicate.

Dosage is as follows: when being used for by the nose administration, be dissolved in 30 μ l normal saline (0.9%NaCl) before the lyophilization thing that is equivalent to the total pheron of 10 μ g (parcel+not parcel) uses.When being used for by the subcutaneous route administration, the lyophilization thing of same dose is dissolved in the 300 μ l saline.Be dissolved in 300 μ l before the lyophilization thing that is equivalent to the total pheron of 40 μ g (parcel+not parcel) when being used for by the gastric administration uses and replenish 0.2MNaHCO ₃Saline in.With the intubate administration that is connected with the 1ml syringe.

After the last administration 15 days, by irritating stomach with 10 ⁸The helicobacter pylori infected by microbes mice of individual adaptation mice.Infected back 1 month, the excision stomach is also measured the urease activity (JatroxND) of 1/4 stomach.Excise back 4 hours optical density in the 550nm measuring media.The results are shown in Figure 10.

These results show, though behind the DC-Chol dosage that uses, do not organize and protected fully, observe with positive control (accepting the mice of empty liposome) and compare, and infect the back urease activity and significantly reduce.These results also prove, and are (subcutaneous by parenteral route targeting back of the body territory, lumbar region; The advantage of first immunisation also available intramuscular approach, and will make the abdominal cavity tuberosity easily) more specifically as target.

Sequence table

(1) physical data:

(i) applicant:

(A) name: Pasteur Merieux Serums﹠amp; Vaccins

(B) street: 58, avenue Leclerc

(C) city: Lyons

(E) country: France

(F) postcode: 69007

(G) phone: 72 73 79 31

(H) fax: 72 73 78 50

(ii) denomination of invention: the compositions that mucosa immunity-inducing is replied

(iii) sequence number: 4

(iv) computer-readable mode:

(A) media type: tape

(B) computer: IBM PC compatible

(C) operating system: PC-DOS/MS-DOS

(D) software: PatentIn Release#1.0, #1.30 version (EPO)

(2) explanation of SEQ ID NO:1:

(i) sequence signature:

(A) length: 41 base pairs

(B) type: nucleotide

(C) chain: two strands

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: SEQ ID NO:1:

CCCAAATCAT?GAAACTCACC?CCAAAAGAGT?TAGATAAGTT?G?41

(2) explanation of SEQ ID NO:2:

(i) sequence signature:

(A) length: 28 base pairs

(B) type: nucleotide

(C) chain: two strands

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: SEQ ID NO:2:

GCTTCTACAT?AGTTAAGCTT?AATGCCTT?28

(2) SEQ ID NO:3 explanation:

(i) sequence signature:

(A) length: 36 base pairs

(B) type: nucleotide

(C) chain: two strands

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: SEQ ID NO:3:

CGTCTCGAGC?CACCATGAAA?AAGATTAGCA?GAAAAG?36

(2) SEQ ID NO:4 explanation:

(i) sequence signature:

(A) length: 49 base pairs

(B) type: nucleotide

(C) chain: two strands

(D) topological structure: linearity

(ii) molecule type: cDNA

(xi) sequence description: SEQ ID NO:4

ATCGTCCCGG?GCAGGCCTCT?TAGAAAATGC?TAAAGAGTTG?CGCCAAGCT?49

Claims (22)

1. one kind is used at host mammal mucosa effective-site, induce pharmaceutical composition to a kind of antigenic protective immune response, it comprises and is used to follow or successive administration: (i) optional first kind of product and (ii) at least one second kind and the third product: these three kinds of identical or different products respectively contain a kind of immune response inducing agent, and be selected from antigen, if and antigen is in the nature protein, the expression cassette that choosing can antigen expressed then; First kind of product is used to be administered systemically by preparation, second kind of product is used for by muzzle chamber administration by preparation, so that the immune response inducing position in derivant targeting nasopharynx or the salivary gland, the third product is used to be different from the nose approach by suitable mucosal route administration by preparation, so that derivant targeting immunne response is sought the immune response inducing position of the effective-site of (recherch é e).

2. the compositions of claim 1, wherein first kind of product prepared in order to by the parenteral route administration.

3. claim 1 or 2 compositions are used at host mammal, induce a kind of antigenic immunne response at respiratory system (bronchus, nasopharynx, lung), and wherein the third product is used for by the lung administration by preparation.

4. claim 1 or 2 compositions are used at host mammal, at the mucosa effective-site that is selected from intestinal and genitals mucosa, induce a kind of antigenic immunne response, and wherein the third product is used for by the urogenital administration by preparation.

5. claim 1 or 2 compositions are used at host mammal, induce a kind of antigenic immunne response at stomach or intestinal, and wherein Pei Zhi the third product is used for the through port approach, comprises the gastric administration.

6. the compositions of one of claim 1-5, wherein first kind of product also contains a kind of adjuvant, as aluminium hydroxide or aluminum phosphate or a kind of ISCOM type adjuvant.

7. the compositions of one of claim 1-6, wherein second kind of product is mixed with particle form, as liposome or microsphere.

8. the compositions of claim 7, wherein second kind of product is mixed with the particle form that diameter is 0.05-5 μ m.

9. the compositions of one of claim 1-8, wherein the third product is mixed with particle form, as liposome or microsphere, is used for comprising the gastric administration by lung approach or through port approach.

10. the compositions of claim 9, wherein the third product is mixed with the particle form that diameter is 0.05-5 μ m, is used for by the lung administration.

11. the compositions of claim 9, wherein the third product is mixed with the particle form that diameter is 0.05-5 μ m, is used for the through port approach and comprises the gastric administration.

12. the compositions of claim 10 or 11, wherein second kind or the third product are spray or aerosol.

13. the compositions of one of claim 1-12, wherein the third product is a kind of intestinal protection preparation.

14. the compositions of one of claim 1-13, wherein second kind or the third product also contain a kind of avirulence adjuvant, are beyond bacteriotoxic nontoxic subunit or the detoxification form, also be and liposome or microsphere beyond adjuvant.

15. the compositions of one of claim 1-14, wherein second kind or the third product also contain MPLA.

16. the compositions of one of claim 1-15, wherein the first, the second or the derivant that contains of the third product be antigen.

17. the compositions of one of claim 1-16, wherein second is identical with the contained derivant of the third product.

18. the compositions of claim 17, wherein the first, the second is identical with the contained derivant of the third product.

19. the compositions of one of claim 2-18, wherein first kind of product is used for by subcutaneous by preparation, intradermal or intramuscular administration.

20. the compositions of one of claim 1-19, wherein antigen is a kind of antigen to the morbific antibacterial of host mammal.

21. the compositions of claim 5 and 20, wherein antigen is a kind of Heliobacter pylori antigen.

22. the compositions of claim 21, wherein antigen is the pheron form of helicobacter pylori urase.

Images