CN115505635A

CN115505635A - MiRNA marker and kit for tuberculosis diagnosis and identification

Info

Publication number: CN115505635A
Application number: CN202211206248.4A
Authority: CN
Inventors: 伊正君; 付玉荣; 李崇辉; 王文涛; 张波; 唐媛媛; 曲梅花
Original assignee: Weifang Medical University
Current assignee: Weifang Medical University
Priority date: 2022-09-30
Filing date: 2022-09-30
Publication date: 2022-12-23

Abstract

The invention belongs to the technical field of diagnosis markers, and particularly relates to a miRNA marker and a kit for tuberculosis diagnosis and identification. The miRNA is any one or any combination of the following 3 miRNAs, and the names and the sequences are respectively as follows: miR-342-3p which is SEQ ID NO:1 sequence miR-199a-3p which is SEQ ID NO:2 sequence; miR-199b-3p, which is a sequence of SEQ ID NO. 2. A kit for diagnosing and identifying tuberculosis comprises a primer designed by a miRNA marker. The invention innovatively discovers that the expression compositions of peripheral blood miR-342-3p and miR-199a/b-3p are used as an important diagnosis marker, provides a new direction for tuberculosis hematology diagnosis from a molecular level, and has important theoretical value and potential application value. The high-efficiency auxiliary diagnosis of the lung cancer and the PTB can assist in the differential diagnosis of the simple PTB and the PTB combined extrapulmonary tuberculosis and the simple PTB and the PTB combined hemoptysis.

Description

MiRNA marker and kit for tuberculosis diagnosis and identification

Technical Field

The invention belongs to the technical field of diagnosis markers, and particularly relates to a miRNA marker and a kit for tuberculosis diagnosis and identification.

Background

Tuberculosis is an infectious disease that is the focus of WHO control, and early diagnosis of tuberculosis (PTB) is important for treatment and prevention of continued dissemination. When PTB disease occurs, PTB patients can be used as an active infection source to spread pathogenic bacteria, and the number of infected people is continuously increased. Furthermore, early diagnosis of tuberculosis is crucial for the treatment and survival of PTB patients. Therefore, early differential diagnosis of PTB is of particular importance.

Current differential diagnostic methods suffer from various deficiencies for differentiating PTB from lung cancer, and PTB subgroups. The main diagnostic methods currently in clinical use for PTB:

(1) Sputum smear: (1) the positive rate is low: about 30%, usually 5000-10000 bacteria/ml are needed to obtain positive result; (2) poor specificity: various mycobacteria can be colored, and whether the mycobacteria are mycobacterium tuberculosis needs to be further identified; (3) dead bacteria and live bacteria cannot be distinguished; (4) the influence factors are many: influenced by the technical level of the inspector and the quality of the collected sputum specimen. In conclusion, a large amount of missed diagnosis and misdiagnosis can be caused. (2) bacterial culture: (1) the culture period is long (6-8 weeks); (2) the positive rate is not high: about 30% to about 40%; (3) further characterization is required to determine whether it is M.tuberculosis. (3) tuberculin test (PPD): the main problem is the high level of false positive result, PPD positive only indicates that tuberculosis infection has occurred, and does not represent the current disease, and PPD test measurement is susceptible to various factors, such as inoculation of BCG vaccine. And (4) detecting tubercle bacillus antigens: (1) difficulty in antibody production: the preparation of the high-activity specific tuberculosis antibody of the anti-tubercle bacillus antigen is very difficult, so that the method is limited to be applied in a large quantity; (2) antibody specificity is not ideal: the existing research uses the method of immunizing animals to prepare antiserum, although high-titer tubercle bacillus antibodies can be obtained by purification, the specificity is not high, and cross reaction can also occur with non-tubercle bacillus and even bacteria without genetic relationship. (5) gamma-interferon release assay (IGRA): the price is expensive and difficult to popularize, and the technology cannot carry out specific and sensitive differential diagnosis on PTB subgroups; (6) detection of tuberculosis antibody: the sensitivity and the specificity are not high. Based on the above problems, the development of new diagnostic strategies is imminent.

MicroRNAs (miRNAs) as biomar: miRNAs are novel single-stranded non-coding small RNAs endogenous to cells, and play an important role in regulation and control in the pathophysiological processes of cell proliferation and apoptosis, organ development and differentiation, disease development, tumor formation and the like. In recent years, as research on miRNA continues to be advanced, it shows advantages in differential diagnosis of diseases: (1) miRNAs have high specificity and high conservation to different diseases; (2) circulating miRNAs existing in body fluids such as serum or plasma have good stability, are stably expressed and can stably exist in the peripheral blood of normal people, and have no obvious individual difference; (3) the blood sample is easy to obtain, is not easy to pollute and has low detection cost; has great potential in the application field as the biomarker.

At present, commercial microRNA early-stage detection kit products exist in the market. However, in the differential diagnosis of PTB, the following problems remain: 1. the differential diagnosis efficiency of the lung cancer and the PTB is to be improved, the specificity (75.0%) of the differential diagnosis of the PTB is to be improved, and the accuracy of the diagnosis is greatly influenced. 2. The auxiliary diagnosis of the simple PTB and the subtype thereof has limitations, relates to the identification of patients with pneumonia and chronic obstructive pulmonary disease, and cannot analyze the simple tuberculosis and the subtype thereof; 3. the number of the marker molecule combinations is large, and the cost is high; 4. the sample analysis is not large and may affect the confidence. Therefore, it is a difficult point of the detection method to find a miRNAs marker with high specificity and high sensitivity.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides the miRNA marker and the kit for diagnosing and identifying tuberculosis, so as to improve the diagnosis efficiency of tuberculosis, improve the capacity of differentially diagnosing PTB and lung cancer, improve the capacity of differentially diagnosing pure PTB and subtypes thereof, reduce the number of marker molecule combinations and reduce the cost.

In order to achieve the purpose, the invention adopts the following technical scheme: a miRNA marker for diagnosing and identifying tuberculosis is any one or any combination of the following 3 miRNAs, and the names and the sequences are respectively as follows:

miR-342-3p: UCUCACACAGAAUCGCACCCGU, which is a sequence shown in SEQ ID NO: 1;

miR-199a-3p and miR-199b-3p: ACAGUGUCUGCACACUGUUA, which is a sequence shown in SEQ ID NO. 2.

Further, the miRNA marker is used for tuberculosis diagnosis and identification.

A kit for diagnosis and identification of tuberculosis, the kit comprising primers designed according to the miRNA marker of claim 1.

Further, the primers comprise a reverse transcription primer designed according to each miRNA marker, a specific upstream primer and a specific downstream primer of a fluorescence quantitative reaction.

Further, in the above-mentioned case,

the reverse transcription primer sequence of the miR-342-3p is shown as SEQ ID NO. 4, the specific upstream primer sequence of the fluorescent quantitative reaction is shown as SEQ ID NO. 5, and the specific downstream primer sequence of the fluorescent quantitative reaction is shown as SEQ ID NO. 6;

reverse transcription primer sequences of the miR-199a-3p and miR-199b-3p are shown as SEQ ID NO. 7, and a specific downstream primer sequence of the fluorescent quantitative reaction is shown as SEQ ID NO. 10;

the specific upstream primer sequence of the miR-199a-3p fluorescence quantitative reaction is shown as SEQ ID NO. 8,

the specific upstream primer sequence of the miR-199b-3p fluorescence quantitative reaction is shown as SEQ ID NO. 9.

Further, the kit also comprises a plasma RNA extracting solution, a reverse transcription reaction solution, a fluorescent quantitative PCR reaction solution and an internal reference primer.

Further, the internal parameter is U6:

<xnotran> GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU, SEQ ID NO:3 ; </xnotran>

The sequence of the internal reference U6 upstream primer is shown as SEQ ID NO. 11, and the sequence of the reverse transcription primer and the sequence of the downstream primer are shown as SEQ ID NO. 12.

Further, in the above-mentioned case,

the plasma RNA extract comprises: trizol-LS reagent, chloroform, isopropanol, 75% ethanol and RNase-free aqueous solution;

further, the reverse transcription reaction solution includes: plasma RNA, 5 × reaction buffer solution, deoxyribonucleoside triphosphate mixture, ribonuclease inhibitor, modified reverse transcriptase and RNase-free aqueous solution;

further, the fluorescent quantitative PCR reaction solution includes: TB

Premix Ex Taq ^TM (Tli RNaseH Plus) and RNase free aqueous solution.

The miRNA marker and the kit for diagnosing and identifying tuberculosis have the advantages that:

the invention innovatively discovers that the expression compositions of peripheral blood miR-342-3p and miR-199a/b-3p are used as an important diagnosis marker, provides a new direction for performing hematological diagnosis of tuberculosis from a molecular level, and has important theoretical value and potential application value. High-efficacy adjuvant diagnosis of lung cancer and PTB, AUC =0.949, sensitivity: 88.30%, specificity, 89.23%, prediction accuracy, 86.70%. Can assist in differential diagnosis of simple PTB and PTB combined extrapulmonary tuberculosis and simple PTB and PTB combined hemoptysis. Auxiliary diagnosis can be realized by combining 2-3 marker molecules.

Drawings

FIG. 1 is an example of the present invention of miRNA differentially expressed in PTB patients;

FIG. 2 is a representation of miRNA differentially expressed in lung cancer patients according to embodiments of the present invention;

FIG. 3 shows the intersection of the Venne plots and the differential expression of miRNA in the examples of the present invention;

wherein, A: intersection of the Venne maps of the three datasets; b: differential expression of three mirnas in PTB patients; c: differential expression of three mirnas in LC patients; d: differential expression of three mirnas in LC patients;

FIG. 4 is the expression levels of three miRNAs in PTB and LC patients according to the present example;

wherein, A: expression levels of mirnas in PTBs; b: expression level of miRNA in LC (GSE 31568); c: expression level of miRNA in LC (GSE 61741);

FIG. 5 shows the expression level of miRNA in the PTB group and the healthy control group according to the embodiment of the present invention;

wherein, A-C: expression levels of miR-342-3P, miR-199a-3P and miR-199b-3P in PTB group and healthy control group ([ P ] 0.05, [ P ] 0.01, [ P ] 0.001);

FIG. 6 shows the expression levels of three plasma miRNAs in the PTB group and the lung cancer group according to the present invention;

wherein, A-C: expression levels of miR-342-3P, miR-199a-3P and miR-199b-3P in the PTB group and the lung cancer group ([ P ] 0.05, [ P ] 0.01, [ P ] 0.001);

FIG. 7 shows the expression levels of three miRNAs in PTB combined extrapulmonary tuberculosis in the examples of the present invention;

wherein, A-C: expression of miR-342-3P, hmir-199a-3P and miR-199b-3P in PTB-associated extrapulmonary tuberculosis (P < 0.05, P < 0.01, P < 0.001);

FIG. 8 is the expression levels of three miRNAs in a patient with hemoptysis in the presence of PTB according to an embodiment of the present invention;

note: A-C: expression of miR-342-3P, miR-199a-3P and miR-199b-3P in the presence of PTB in hemoptysis ([ P ] 0.05, [ P ] 0.01, [ P ] 0.001);

FIG. 9 is a ROC curve for diagnosis of PTB by serum miRNAs compositions of tuberculosis groups and healthy control groups in accordance with the present invention;

FIG. 10 is a ROC curve for diagnosis of PTB by serum miRNAs compositions of tuberculosis and lung cancer groups in accordance with the present invention;

FIG. 11 is a ROC curve for diagnosis of PTB by serum miRNAs compositions of plain PTB and PTB in combination with extra-pulmonary PTB in accordance with an embodiment of the present invention;

fig. 12 is a ROC curve for diagnosis of PTB with serum miRNAs compositions of plain PTB and PTB combined hemoptysis according to an embodiment of the present invention.

Detailed Description

The following further describes the embodiments with reference to the drawings.

The reagents and instruments in the following examples are all conventional laboratory reagents and instruments.

Example 1:

a miRNA marker for tuberculosis diagnosis and identification:

1. data downloading:

the raw expression data of plasma-derived mirnas were downloaded from the GEO database.

Healthy control 172 cases.

PTB sample dataset (7 cases): GSE116542. Based on GPL19117[ miRNA-4] Affymetrix Multispecies miRNA-4Array sequencing platform.

LC sample data set (105 cases): GSE31568, GSE61741. Based on GPL9040 febit Homo Sapiens miRbase.

2. Screening for differential miRNAs

The limma R package performs differential screening on the normalized miRNA expression data of PTB and LC patient samples. The screening criteria were: miRNAs were up-regulated in PTB samples (log 2 Fold Change > 1), down-regulated in LC samples (log 2 Fold Change < 0) and P values < 0.05. And drawing a heat map and a volcano map by adopting a ggplot package.

Screening for PTB-differentiated miRNAs

A total of 312 statistically significant (P < 0.05) miRNAs were selected (FIG. 1), of which 193 were up-regulated and 119 were down-regulated.

Screening of MiRNA for Lung cancer Difference

142 and 395 miRNAs with statistical significance (P < 0.05) were screened from the GSE31568 and GSE61741 datasets, respectively (FIGS. 2A and B), wherein there were upregulated miRNAs (67), downregulated miRNAs (75), and upregulated miRNAs (201), and downregulated miRNAs (194).

Venn analysis

Analysis of up-regulated mirnas in PTB samples and down-regulated mirnas in LC samples using Draw Venn Diagram software identified miRNA molecules with a common intersection in the data set. Taking intersection of the PTB patient GSE116542 data set and the LC patient GSE31568 and GSE61741 data sets, wherein a Venne analysis result shows that 3 common miRNA molecules are intersected in the three data sets, and the three common miRNA molecules are respectively as follows:

miR-342-3p, miR-199a-3p and miR-199b-3p (FIG. 3A). Wherein miR-342-3p, miR-199a-3p and miR-199B-3p is up-regulated in PTB patients and down-regulated in LC patients (FIGS. 3B-D). Expression levels of 3 common miRNA molecules in three data sets (fig. 4).

miR-342-3p: UCUCACACAGAAUCGCACCCGU, which is a sequence shown in SEQ ID NO: 1;

miR-199a-3p: ACAGUGUCUGCACACUGUUA which is a sequence shown in SEQ ID NO. 2;

miR-199b-3p: ACAGUGUCUGCACACUGUUA, which is a sequence shown in SEQ ID NO. 2.

Endogenous reference is U6 (M. Mu.s. Mu.sc. Mu.l. Mu.s U6 small n. Mu. Clear RNA-Rn. Mu.6):

<xnotran> GUGCUCGCUUCGGCAGCACAUAUACUAAAAUUGGAACGAUACAGAGAAGAUUAGCAUGGCCCCUGCGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU, SEQ ID NO:3 . </xnotran>

Example 2:

a kit for diagnosing and identifying tuberculosis comprises a primer designed according to a miRNA marker, a plasma RNA extracting solution, a reverse transcription reaction solution, a fluorescent quantitative PCR reaction solution and an internal reference primer.

Designing synthetic primers, wherein the corresponding sequences of the primers designed by the miRNA markers and the reference primers are as follows:

miR-342-3p reverse transcription primer:

5 'GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACGGGT-3', the sequence is SEQ ID NO:4,

miR-342-3p upstream primer: 5 'GCGTCTCACACACACAGAGAATCGC-3', the sequence is shown as SEQ ID NO. 5,

miR-342-3p downstream primer: 5 'AGTGCAGGGTCCGAGTATT-3', the sequence is shown as SEQ ID NO. 6,

miR-199a-3p reverse transcription primer:

5 'GTCGTATCCAGTGCAGGGTCCGAGTATTCGCACTGGATACGACTAACCA-3', the sequence is shown as SEQ ID NO:7,

miR-199a-3p upstream primer: 5 'GCTGCGACAGTAGTTCTGCACACAT-3', the sequence is shown as SEQ ID NO:8,

miR-199a-3p downstream primer: 5 'AGTGCAGGGTCCGAGTATT-3', the sequence is shown as SEQ ID NO:10,

miR-199b-3p reverse transcription primer:

miR-199b-3p upstream primer: 5 'GCGCGCGACAGTAGTCTGCACAT-3', the sequence is shown as SEQ ID NO:9,

miR-199b-3p downstream primer: 5 'AGTGCAGGGTCCGAGTATT-3', the sequence is shown as SEQ ID NO:10,

u6 upstream primer: 5 'CTCGCTTCGGCAGCACA-3', the sequence is shown as SEQ ID NO:11,

u6 reverse transcription primer and downstream primer: 5 'AACGCTTCACGAATTTGCGT-3', the sequence is shown as SEQ ID NO:12,

the plasma RNA extract comprises: trizol-LS reagent, trichloromethane, isopropanol, 75% ethanol and RNase-free water solution; the reverse transcription reaction solution includes: plasma RNA, 5 × reaction buffer solution, deoxyribonucleoside triphosphate mixture, ribonuclease inhibitor, modified reverse transcriptase and RNase-free aqueous solution; the fluorescent quantitative PCR reaction solution comprises: TB

Premix Ex Taq ^TM (Tli RNaseH Plus) and RNase free aqueous solution.

The biomarker has good stability, good diagnosis specificity and high sensitivity, and miRNA is not easy to degrade in a specimen and has very high stability; three molecular combined diagnostic potency: (1) PTB: AUC =0.949, sensitivity: 88.30%, specificity, 89.23%, prediction accuracy, 86.70%. (2) PTB and lung cancer: AUC =0.9462, sensitivity: 98.94%, specificity: 80.00%, the prediction accuracy is: 88.50 percent; the PTB is used for assisting in differential diagnosis of the lung cancer and PTB subtypes, one or any combination of miR-342-3p and miR-199a/b-3p is used for differential diagnosis of the PTB, including PTB and lung cancer, simple PTB and subtypes thereof, such as PTB combined extrapulmonary tuberculosis and PTB combined hemoptysis. The operation is simple, the time consumption is short, and compared with the fungus culture, the specimen collection process is not easy to pollute; the operation is simple, after the reagent preparation, the sample can be analyzed only by simple RNA extraction, reverse transcription and fluorescent quantitative PCR, and the time consumption is short. Compared with the gamma interferon release experiment, the method has good advantages in price and is convenient to popularize and promote; the number of the marker molecule combinations is reduced, and the control is carried out on the basis of the basic cost.

Example 3:

a method for using a kit for diagnosing and identifying tuberculosis,

1. extraction of plasma Total RNA

Collecting samples: a total of 191 subjects were enrolled, 71 patients with PTB, 55 patients with LC, and 65 healthy controls. Among them, in the PTB patient group, 43 patients with PTB alone, 19 patients with PTB-complicated extrapulmonary tuberculosis, and 9 patients with PTB hemoptysis were treated. Patient basic characteristics (table 1).

Inclusion criteria were: all samples were from a hospital. All experiments were approved by the ethics committee and all participants signed informed consent. Meanwhile, basic information such as sex, age and hospitalization number of the test participants are collected. All patients included in the group were excluded from syphilis, hepatitis b and aids.

TABLE 1 clinical profiles of inclusion subjects

The extraction is carried out according to the relevant operation instructions of Trizol-LS reagent, and the extraction operation is as follows:

(1) 250 μ L of plasma was added to the RNase removal centrifuge tube followed by 750 μ L of Trizol-LS reagent.

(2) Blow and beat up and down by using a pipette, and uniformly mix the used samples.

(3) The mixed sample was stood on an ice box for 5min.

(4) 150. Mu.L of chloroform was added to the RNase-free centrifuge tube.

(5) The tube containing the above reagents was vigorously mixed for 2min.

(6) The EP tube was set aside on an ice box for 10min.

(7) Centrifugation is carried out for 15min at 12000g/min at 4 ℃. At this time, the contents of the EP tube containing the above reagents are divided into three layers. The upper layer is a colorless clear aqueous layer (RNA remains in this layer), the middle layer is white (DNA remains in this layer), and the lower layer is a pink organic layer (protein remains in this layer).

(8) The tube was tilted at 45 ℃ to remove RNase, and 300. Mu.L of the aqueous layer was carefully pipetted twice with a pipette gun. At this time, special attention should be paid to avoid sucking up the contents of the middle layer and the lower layer.

(9) Transfer the aspirated 300. Mu.L of aqueous phase to a new RNase removal centrifuge tube.

(10) Add 600. Mu.L of isopropanol to the tube and mix it up and down.

(11) The RNA removing enzyme centrifuge tube containing the contents is placed on an ice box statically for 10min.

(12) The samples were centrifuged at 12000g/min for 10min at 4 ℃. The supernatant was decanted slowly, leaving the RNA pellet as filaments at the bottom of the RNase removal tube.

(13) The tubes were filled with 1000. Mu.L of 75% ethanol reagent and the RNA precipitated at the bottom of the tube was washed.

(14) The samples were centrifuged for 10min at 12000g/min at 4 ℃. After that, the supernatant was slowly decanted off.

(15) Drying the RNA precipitate at room temperature for 5-10 min.

(16) And sucking 10 mu L of RNase-free aqueous solution by a pipette, resuspending the RNA precipitate in the bottom of the RNase removal centrifuge tube, and gently blowing and beating to fully mix the RNA precipitate with the RNase-free aqueous solution to form a uniform RNA solution.

The aqueous RNA solution was incubated in a metal bath at 60 ℃ for 15min. Immediately thereafter, reverse transcription was performed.

Reverse transcription of miRNA into cDNA

The reverse transcription procedure was performed strictly according to the instructions of the Kit PrimeScriptTM II 1st Strand cDNA Synthesis Kit of TaKaRa. The stem-loop method is used to reverse transcribe the aqueous RNA solution into cDNA. The reaction system is as follows:

the following miRNA reaction systems were prepared

Reverse transcription Primer (RT Primer) (50. Mu.M)

Incubate in metal bath at 65 ℃ for 5min and cool rapidly on ice.

The above reagent was added to the following reverse transcription system

The above reagents were mixed well and then reverse transcription was carried out according to the following reaction conditions.

42℃60min

95℃5min

4℃15min

3. Fluorescent quantitative PCR reaction

The relevant operation of RT-qPCR reaction process is strictly performed according to TaKaRa company TB

Premix EX TaqTM (Tli RNaseH Plus) kit instructions. The reaction system is as follows:

sealing the reagent, and centrifuging and mixing the reagent uniformly by a centrifuge. RT-qPCR was performed according to the following temperature reaction requirements.

After the reaction, melt cut analysis was performed to detect the amplification product.

And (3) carrying out quantitative calculation on the target miRNA of the plasma to be detected by using a relative quantitative calculation method by using U6 as an endogenous reference substance. Calculated as 2- Δ ct (Δ ct = miRNA-U6 endogenous reference of interest).

The expression level in the PTB group and the healthy control group, the expression in the lung cancer group, the expression in the PTB-combined extrapulmonary tuberculosis, and the expression in the hemoptysis patient (fig. 5, 6, 7, 8) were observed.

4. Statistical analysis

The data obtained from the experiment were analyzed by SPSS 23.0 software. Statistical data among groups are respectively subjected to independent sample t test, nonparametric Mann-Whitney U test and pairing t test according to distribution characteristics, and differences with the P being less than 0.05 have statistical significance. Data are presented as SD ± SEM. Diagnostic performance analysis was performed by GraphPad Prism 8.0, AUC values in the ROC curve, sensitivity and specificity were used to assess the ability of the miRNA of interest as a diagnostic factor.

Calculating ROC curves of plasma miR-342-3p and miR-199a/b-3p composition diagnosis PTB by adopting a Logistic stepwise regression model, and constructing a regression equation of the Logistic stepwise model through data calculation and analysis: logic (P) = -3.771-0.667 (miR-342-3P) -17.906 (miR-199 a-3P) -10.673 (miR-199 b-3P). The ROC curves for the diagnosis of PTB by serum miRNAs compositions (fig. 9, 10, 11, 12), the diagnostic potency of individual miRNA molecules and their combination molecules (tables 2, 3, 4, 5).

TABLE 2 diagnostic value of three miRNAs in PTB

Note: a: miR-342-3p + miR-199a-3p; b: miR-342-3p+miR-199b-3p; c: miR-199a-3p+miR-199b-3p; d is miR-342-3p + miR-199a-3p + miR-199b-3p.

TABLE 3 diagnostic value of three miRNAs in PTB and lung cancer

Note: a: miR-342-3p+miR-199a-3p; b: miR-342-3p + miR-199b-3p; c: miR-199a-3p+miR-199b-3p; d is miR-342-3p + miR-199a-3p + miR-199b-3p.

Table 4 diagnostic value of miR-342-3p and miR-199a/b-3p in PTB combined extrapulmonary tuberculosis

Note: a: miR-342-3p + miR-199a-3p; b: miR-342-3p+miR-199b-3p; c: miR-199a-3p + miR-199b-3p; d is miR-342-3p+miR-199a-3p + miR-199b-3p.

TABLE 5 diagnostic value of three miRNAs in the presence of PTB in hemoptysis

Note: a: miR-342-3p + miR-199a-3p; b: miR-342-3p+miR-199b-3p; c: miR-199a-3p + miR-199b-3p; d miR-342-3p + miR-199a-3p + miR-199b-3p

And (3) analyzing the diagnostic efficacy:

PTB: (1) the single miR-342-3p molecule has the highest diagnosis specificity, and the single miR-199b-3p molecule has the highest diagnosis sensitivity. (2) The sensitivity of the miR-199a-3p and miR-199b-3p duplex diagnosis is kept to be even compared with the triplet diagnosis, but the specificity is slightly lower. (3) Triple diagnostic efficacy: AUC =0.949, cutoff >0.53, sensitivity: 88.30%, specificity: 89.23%, prediction accuracy: 86.70 percent;

lung cancer: (1) the diagnostic sensitivity of the single miR-199a-3p molecule is highest, and the diagnostic specificity of the single miR-199b-3p molecule and the single miR-342-3p molecule is equivalent. (2) The sensitivity, specificity and cutoff value of the miR-199a-3p and miR-199b-3p duplex diagnosis are the same as those of the duplex diagnosis, which indicates that the duplex diagnosis can play a good diagnosis effect. (3) Triple diagnostic efficacy: AUC =0.9462, cutoff ≦ 0.70, sensitivity: 98.94%, specificity: 80.00%, the prediction accuracy is as follows: 88.50 percent;

PTB combined with extrapulmonary tuberculosis: (1) the diagnostic specificity of the single miR-342-3p molecule is highest, and the diagnostic sensitivity of the single miR-199a/b-3p molecule is kept level. (2) The sensitivity of the miR-342-3p and miR-199a-3p duplex diagnosis is lower than that of the triplet diagnosis, but is superior to that of the triplet diagnosis in the aspect of specificity, and the specificity and the sensitivity of the miR-342-3p and miR-199b-3p duplex diagnosis are both equal to those of the triplet diagnosis, which shows that the duplex diagnosis can play a good diagnosis effect. (3) Triple diagnostic efficacy: AUC =0.998, cutoff >0.07, sensitivity: 100.0%, specificity: 98.44 percent;

PTB has hemoptysis: (1) the sensitivity of single molecular diagnosis of miR-342-3p and miR-199a-3p is kept level, and the specificity of single molecular diagnosis of miR-199b-3p is highest. (2) The combined sensitivity of all the bipartite diagnoses is comparable to the tripartite diagnosis, but the specificity is lower than the tripartite diagnosis. (3) Triple diagnostic efficacy: AUC =0.995, cutoff >0.04, sensitivity: 100.0%, specificity: 95.31%, prediction accuracy: 86.70 percent.

Example 4:

a method for using a kit for diagnosing and identifying tuberculosis,

1. blood collection/separation for suspected patients

The intravenous blood collection method is generally adopted to collect the blood of the hospitalized patient (heparin anticoagulation is forbidden). Plasma was centrifuged at 3000rpm, 15min.

2. Fluorescent quantitative PCR

(1) Reverse transcribing the extracted RNA water solution into cDNA by adopting a stem-loop method, wherein the reaction system comprises the following steps:

the following miRNA reaction systems were prepared

Reverse transcription Primer (RT Primer) (50. Mu.M)

Incubate in metal bath at 65 ℃ for 5min and cool rapidly on ice.

The above reagent was added to the following reverse transcription system

The reagents were mixed well and then reverse transcription was carried out according to the following reaction conditions.

42℃60min

95℃5min

4℃15min

(2) Carrying out fluorescent quantitative PCR on cDNA obtained by reverse transcription, wherein the reaction system is as follows:

After the reaction, melt cut analysis was performed to detect the amplified product.

3. Interpretation of results

In the embodiment, the interpretation of the results only takes the miR-342-3p and miR-199a/b-3p triple diagnosis PTB as an example. In addition, any molecule or combination of miR-342-3p and miR-199a/b-3p is not excluded from having better differential diagnosis capability.

Δ Ct = Ct (miRNA) -Ct (U6 endogenous reference)

And (3) carrying out quantitative calculation on the target miRNA of the plasma to be detected by using a relative quantitative calculation method by using U6 as an endogenous reference substance. The calculation is carried out according to the formula 2- Δ ct.

logit(P)＝-3.771-0.667(miR-342-3p)-17.906(miR-199a-3p)-10.673(miR-199b-3p)

The cutoff value for diagnostic PTB was >0.53.

The above embodiments are only for illustrating the technical concept and features of the present invention, and the purpose thereof is to enable those skilled in the art to understand the contents of the present invention and implement the present invention accordingly, and not to limit the protection scope of the present invention accordingly. All equivalent changes or modifications made in accordance with the spirit of the present disclosure are intended to be covered by the scope of the present disclosure.

Sequence listing

<110> Weifang medical college

<120> miRNA marker and kit for tuberculosis diagnosis and identification

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> RNA

<213> Homo sapiens

<400> 1

ucucacacag aaaucgcacc cgu 23

<210> 2

<211> 22

<212> RNA

<213> Homo sapiens

<400> 2

acaguagucu gcacauuggu ua 22

<210> 3

<211> 107

<212> RNA

<213> Homo sapiens

<400> 3

gugcucgcuu cggcagcaca uauacuaaaa uuggaacgau acagagaaga uuagcauggc 60

cccugcgcaa ggaugacacg caaauucgug aagcguucca uauuuuu 107

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacacgggt 50

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gcgtctcaca cagaaatcgc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agtgcagggt ccgaggtatt 20

<210> 7

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgactaacca 50

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gctgcgacag tagtctgcac at 22

<210> 9

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcgcgacagt agtctgcaca t 21

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

agtgcagggt ccgaggtatt 20

<210> 11

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctcgcttcgg cagcaca 17

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aacgcttcac gaatttgcgt 20

Claims

1. A miRNA marker for tuberculosis diagnosis and identification is characterized in that: the miRNA is any one or any combination of the following 3 miRNAs, and the names and the sequences are respectively as follows:

miR-342-3p: UCUCACACAGAAUCGCACCCGU, which is a sequence shown in SEQ ID NO. 1;

2. The use of miRNA markers for tuberculosis diagnosis and identification according to claim 1, wherein: the miRNA marker is used for tuberculosis diagnosis and identification.

3. A kit for tuberculosis diagnosis and identification is characterized in that: the kit comprises a primer designed according to the miRNA marker of claim 1.

4. Kit for tuberculosis diagnosis and identification according to claim 3, characterized in that: the primers comprise a reverse transcription primer designed according to each miRNA marker, a specific upstream primer and a specific downstream primer of a fluorescent quantitative reaction.

5. Kit for tuberculosis diagnosis and identification according to claim 4, characterized in that:

reverse transcription primer sequences of the miR-199a-3p and the miR-199b-3p are shown as SEQ ID NO. 7, and a specific downstream primer sequence of the fluorescent quantitative reaction is shown as SEQ ID NO. 10;

6. Kit for tuberculosis diagnosis and identification according to claim 3, characterized in that: the kit also comprises a plasma RNA extracting solution, a reverse transcription reaction solution, a fluorescent quantitative PCR reaction solution and an internal reference primer.

7. Kit for tuberculosis diagnosis and identification according to claim 6, characterized in that: the internal parameter is U6:

The sequence of the internal reference U6 upstream primer is shown as SEQ ID NO. 11, and the reverse transcription primer and the downstream primer are shown as SEQ ID NO. 12.

8. Kit for tuberculosis diagnosis and identification according to claim 6, characterized in that:

the plasma RNA extract comprises: trizol-LS reagent, chloroform, isopropanol, 75% ethanol and RNase-free aqueous solution.

9. Kit for tuberculosis diagnosis and identification according to claim 6, characterized in that: the reverse transcription reaction solution includes: plasma RNA, 5 × reaction buffer, deoxyribonucleoside triphosphate mixture, ribonuclease inhibitor, modified reverse transcriptase, and RNase-free aqueous solution.

10. The kit for tuberculosis diagnosis and identification according to claim 6, wherein: the fluorescent quantitative PCR reaction solution comprises: TB

Premix Ex Taq ^TM (Tli RNaseH Plus) and RNase-free aqueous solution.