CN1154970A - Antibiotic peptide and production method and application thereof - Google Patents

Antibiotic peptide and production method and application thereof Download PDF

Info

Publication number
CN1154970A
CN1154970A CN 96100376 CN96100376A CN1154970A CN 1154970 A CN1154970 A CN 1154970A CN 96100376 CN96100376 CN 96100376 CN 96100376 A CN96100376 A CN 96100376A CN 1154970 A CN1154970 A CN 1154970A
Authority
CN
China
Prior art keywords
sequence
dna
gene
cell
peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN 96100376
Other languages
Chinese (zh)
Other versions
CN1073117C (en
Inventor
贾士荣
屈贤铭
冯兰香
唐惕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BIOLOG TECHNOLOGY RESEARCH CEN
Original Assignee
BIOLOG TECHNOLOGY RESEARCH CEN
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BIOLOG TECHNOLOGY RESEARCH CEN filed Critical BIOLOG TECHNOLOGY RESEARCH CEN
Priority to CN96100376A priority Critical patent/CN1073117C/en
Publication of CN1154970A publication Critical patent/CN1154970A/en
Application granted granted Critical
Publication of CN1073117C publication Critical patent/CN1073117C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Landscapes

  • Peptides Or Proteins (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The present invention provides a group of new antibacterial peptides. As compared with natural antibacterial peptides, these antibacterial peptides possess stronger resistance to plant pathogen, in particular, possess stronger biochemical activity for resisting bacterial infection. Said invention also provides the chemical synthesizing process and DNA recombination technology for production of the above-mentioned antibacterial peptides, and provides the application of these antibacterial peptides and their fusion bodies in the control of plant, animal or human pathogens and resisting microbial infection.

Description

Antibacterial peptide and production method thereof and application
The present invention relates to antibacterial peptide, produce the method for said peptide and syzygy thereof with chemosynthesis and DNA recombinant technology, and the application in causal organisms such as the bacterium of control animal and plant and human body, fungi, protozoon, tumour cell of such peptide and syzygy thereof.
Causal organisms such as bacterium, fungi, protozoon, cancer cells are the one of the main reasons that influences animal and plant and the growth of human body normal growth.Different with animal, itself does not have immunity system plant, thereby must resist infecting of causal organism by the various mechanism of himself.Yet because the variation of causal organism and the simplification of regional Cultivar, these diseases cause very big loss still for the production of farm crop.For example in China, nineteen fifty reaches 6,000,000,000 kilograms because of the popular crop failure that causes of stripe rust of wheat, the financial loss that the annual potato in the world causes because of Micobial Disease (being mainly bacterial wilt and soft rot) is up to 4,000,000,000 dollars, and bacterial wilt is produced the potato of China and also caused several hundred million yuans loss.According to statistical information in 1981, reach 100,000,000 dollars although be used for the agricultural chemicals input of controlling plant diseases, global grain loss still accounts for about 10% of ultimate production.
Because plant pathogenic microorganisms develops immunity to drugs gradually to various agricultural chemicals, and because agricultural chemicals easily causes environmental pollution, residual agricultural chemicals can cause damage to human or animal's health again after entering food chain, and the application of agricultural chemicals is restricted.Therefore, people are carrying out cultivating the effort with new crop varieties of resisting different diseases always by traditional breeding method for a long time.Yet, because the traditional breeding method cycle is long, and reason such as useful genetic resources is limited, cause traditional breeding way to be difficult to satisfy the demand.Along with the development of molecular biology and plant gene engineering technology,, bring vast potential for future development for Resistant breeding and the new disease-resistant transgenic plant of production provide a brand-new route.
To less known to the disease-resistant mechanism of plant itself and the molecular biology basis thereof, also compare difficult in view of at present so from plant, separate disease-resistant gene.In addition, because the fungus strain of phytopathogen is generally all very complicated, so be difficult to by from plant, separating disease-resistant gene and the method in the plant of importing obtains the various pathogenic bacteria cording is had the effect of resistance of wide spectrum.
It is known after some pathogenic bacterium is infected giant silkworm (Hyalophora cecropia), can in its hemolymph, induce generation N,O-Diacetylmuramidase, Attacin and cecropin three major types such as (Cecropin) to comprise that about 15-20 kind has the protein of fungicidal activity (Hultmark D.et al, Eur.J.Biochem.106:7-16,1980).Wherein the fungicidal activity of cecropin B (Cecropin B) is the strongest, and to Gram-positive and the equal tool lethal effect of negative bacterium, but to then not injury of eukaryotic cell.It is made up of 35 amino-acid residues (comprising 13 seed amino acids), about 4000 dalton of molecular weight.Based on the little difference of primary structure, cecropin is divided into three types of A, B and D (Hultmark D.et al., 1980, document is the same).
In addition, a series of similar antibacterial peptides also from some other insect, have been separated to, for example be derived from the Bombyx Cm4 (Tu Yizeng of fortunatus, Shanghai Inst of Insectology, Chinese Academy of Sciences, Master degree candidate's paper, 1987), be derived from Antheraea p9B and p9D (Tang Xianghui and Qu Xianming, the zoological research of antherea pernyi, 9:61-68,1988), be derived from Lepidopteran A, B and the C of lepidopterous insects and be derived from Sarcotoxin IA, the IB of Sarcophga fuscicauda and IC etc.These polypeptide generally comprise about 33 to 39 amino-acid residues, and molecular weight is about 4,000 dalton, and has higher iso-electric point.These peptides also have very high anti-microbial activity to some specific plant pathogen respectively, and can not injure eukaryotic cell.
These have the peptide of lethal effect to be referred to as antibacterial peptide in this article from different insects to phytopathogen.Aminoacid sequence between them has higher similarity.Molecule is rich in hydrophilic amino-acid residue, particularly is rich in basic aminoacidss such as Methionin, arginine; The C end then comprises more hydrophobic residue.The C-terminal amino acid of all these antibacterial peptides all is amidated.People's such as Matsumoto N. (Biochemistry J.239:717-722,1986) result of study proof amidation has vital role to the anti-microbial activity of peptide molecule.In addition, find on many specific positions of this class peptide, to have conservative amino-acid residue, as the tryptophane on 2; 5, the Methionin on 8 and 9, and (Steiner H.et al, Nature 292:246-248,1981) such as aspartic acids on 11 and 20.
For understanding fully the sterilization mechanism of antibacterial peptide, existing many investigators study the 26S Proteasome Structure and Function of these antibacterial peptides, find that α helicity and its fungicidal activity in the molecule are closely related under the hydrophobic environment of analogue membrane.The preliminary study result shows in addition, and antibacterial peptide is brought into play the integrity that its mechanism to the lethal effect of bacterium is to destroy film, causes the inside and outside barrier function (Nakajima Y.et al, J.Biol.Chem.262:1665-1669,1987) of bacterial cell forfeiture film.Therefore, the someone attempts to seek the antibacterial peptide with stronger anti-microbial activity by amphiphilic structure in the increase molecule.For example people (FEBS Letters 137:283-287,1982) such as Steiner design and successfully having synthesized than the stronger antibacterial peptide Shiva 1 of natural cecropin B fungicidal activity.This peptide not only has the functionally active of aforesaid natural antibacterial peptide, but also has the ability that suppresses growth of malaria parasites (Jaynes J.M.et al, FASEB J.2:2878-2883,1989).Because these antibacterial peptide molecules and corresponding D NA encoding sequence are shorter, therefore can be according to the aminoacid sequence of antibacterial peptide, select the preferences codon for use, the synthetic antibacterial peptide gene, construction of expression vector, and changing it over to protokaryon and eukaryotic cell expression system, preparation has genetic engineering body of antibacterial peptide and products thereof, is used to prevent and treat the causal organism of animal and plant and human body.
The present invention relates to antibacterial peptide, the method for producing said antibacterial peptide with chemical synthesis process or DNA recombinant technology, and such peptide and syzygy thereof be at control plant, animal and human body pathogen, the application during particularly bacillary plant pathogenic microorganisms infects.
An aspect, the invention provides peptide sequence with fungicidal activity, these peptides have sterilization or the bacteriostatic activity stronger than the natural antibacterial peptide that derives from insect to vegetative bacteria and fungoid disease substance, to the eukaryotic cell that comprises vegetable cell then without any injury effect.
In the preferred embodiment of the present invention aspect this, the peptide and the varient thereof that phytopathogen are had killing activity are provided, this peptide has the wide spectrum killing activity to phytopathogen, but do not injure eukaryotic cell and tissue thereof, and this peptide have the function equivalent or the varient of the aminoacid sequence shown in the sequence numbering 1 in the sequence table or its brachymemma.The function equivalent of said brachymemma has the aminoacid sequence of amino acid sequence number 1 to 12 and 33 any length of natural antibacterial peptide cecropin B.
In the present invention's this preferred embodiment aspect this, the said peptide that phytopathogen is had killing activity, be known amino acid sequence based on natural antibacterial peptide, what make through wild sequence is suitably modified has the peptide of stronger fungicidal activity to phytopathogen, and just like the aminoacid sequence shown in the sequence numbering in the sequence table 2 or its function equivalent or varient.
This another preferred embodiment on the one hand according to the present invention, the wherein said peptide that phytopathogen is had killing activity, be to have improved the peptide of the fungicidal activity of wild antibacterial peptide the aminoacid sequence of known natural antibacterial peptide suitably being modified the back, and have aminoacid sequence or its function equivalent or varient shown in sequence numbering in the sequence table 3.
This another preferred embodiment on the one hand according to the present invention, the wherein said peptide that phytopathogen is had killing activity, be to the aminoacid sequence of known natural antibacterial peptide suitably modify and make phytopathogen is had the peptide of stronger fungicidal effectiveness, and have the aminoacid sequence shown in sequence numbering in the sequence table 4.
This preferred embodiment on the one hand according to the present invention, wherein said modification are to realize by the one or more amino acid that begin to delete the natural antibacterial peptide molecule from C-terminal.
A preferred embodiment according to this aspect of the present invention, wherein said modification are by changing indivedual amino acid of molecule, realizing to increase its α spiralization degree.
This respect preferred embodiment according to the present invention, wherein said modification realizes with the hydrophobic amino acid of amphiphilic on the said natural antibacterial peptide peptide chain of positively charged any amino-acid substitution.
This preferred embodiment on the one hand according to the present invention, wherein said have the peptide of killing activity to produce with the solid state chemistry synthetic method to phytopathogen.
This another preferred version on the one hand according to the present invention, wherein said have sequence numbering 1,2,3 in the sequence table and 4 phytopathogen is had the peptide of killing activity, be the nucleotide sequence that utilizes these peptides of coding, produce with the DNA recombinant technology.
This preferred embodiment on the one hand according to the present invention, wherein said have an antibacterial peptide of aminoacid sequence shown in the sequence numbering 1,2,3 or 4 in the sequence table, can make fusogenic peptide and the non-fusogenic peptide that comprises bridge joint sequence or non-bridge joint sequence with any array mode.
This preferred embodiment on the one hand according to the present invention, wherein said plant is any monocotyledons or dicotyledons, and comprise vegetable cell, callus, whole strain plant and part thereof, and said phytopathogen comprises plant pathogenic Gram-negative and positive bacteria, and some fungi.The plant pathogen that particularly comprises potato or bacterial wilt of tomato bacterium (pseudomonas solanacearum).Wherein said bacterium comprises but is not only limited to potato bacterial wilt bacterium, bacterial wilt of tomato bacterium, potato rot positive germ, Cauliflower Bacteria erwinia, cabbage black rot bacterium, rice leaf spot bacteria, xanthomonas oryzae pv. oryzicola, bacterial canker of tomato, bacterial ring rot o potato bacterium, agrobacterium tumefaciens, and colibacillary bacterial strain.
In yet another aspect, thus the invention provides expression level and the active encoding antimicrobial peptide of biological function of expression product and dna sequence dna or its function equivalent or the varient of fusion product thereof improved in vegetable cell through modifying.
According to this preferred embodiment on the one hand, the dna encoding sequence of said antibacterial peptide is the peptide sequence of sequence numbering 1 to 4 in the code sequence tabulation respectively and dna sequence dna and the varient thereof with sequence numbering 5 to 8, and said encoding sequence is molecular by vegetable cell preferences password under the prerequisite that does not change its aminoacid sequence basically.
According to this another preferred embodiment on the one hand, the wherein said modification that coding is had a dna encoding sequence of the antibacterial peptide shown in the sequence numbering 1,2,3 and 4 in the sequence table comprises displacement, adds, repeats or lacks the one or more Nucleotide in the said encoding sequence.The result of these modifications has not only further improved the expression efficiency of these dna sequence dnas in vegetable cell, and further improved by the sterilization and/or the bacteriostatic activity of antibacterial peptide of coding.
Another aspect, the invention provides carry coding shown in sequence numbering 1,2,3 and 4 antibacterial peptide or the aminoacid sequence of its function equivalent and ordered list in the nucleotide sequence shown in the sequence numbering 5,6,7 and 8 or the recombinant expression vector of its varient.In the said recombinant expression vector, at 5 ' end of above-mentioned encoding sequence be operably connected enhancer sequence, Ω sequence, the secretory signal sequence of the promoter sequence of one or more restriction enzyme sites, one or more different sourcess, one or more different sourcess, the terminator sequence that then having coding in 3 ' of above-mentioned dna encoding sequence can amidated amino acid whose nucleotide sequence, multienzyme is cut site and one or more different sourcess.
This preferred embodiment on the one hand according to the present invention, promotor (Pmas), cauliflower mosaic virus (CaMV) 35SRNA promotor (P35S), Pmas promotor that wherein said promoter sequence is selected from the mannopine synthase gene merge double-promoter (Pmac) that forms and the CaMV 35S promoter (2 * Enhancer-P35S) that has two enhancement sequences mutually with the CaMV 35S promoter.This preferred version on the one hand according to the present invention, wherein said terminator is selected from T-DNA 7 ' 5 ' two-way terminators (T-DNA7 ' 5 ' T), rouge alkali synthetase gene terminator (nosT), octopine synthase gene terminator (ocsT), CaMV 35SRNA terminator (35ST) and the T-DNA tml gene terminator (tmlT) of plasmid pTiA6.The preferred secretion signal peptide sequence of the present invention secretory signal sequence (α-Amyl sp) that is alpha-amylase gene wherein.Yet, it will be appreciated by those skilled in the art that, also can use the secretion signal peptide sequence of animal, plant or insect genes.
This preferred embodiment on the one hand according to the present invention, the structural gene sequence of said each antibacterial peptide of coding and 5 ' the controlling element sequence that is connected with 3 ' the distolateral wing thereof be chemically synthetic or obtain with DNA recombinant technologys such as PCR (polymerase chain reaction) amplifications.
This preferred embodiment on the one hand according to the present invention, wherein said recombinant expression vector is selected from pBZ863, pBT567, pTYB1, pTBM20, pBC174, pTYB3, pTYB3A, pTYB3B, pTYB2, pTYB4A, pTYB4B, pSMC, pMC and pSSA.The carrier that is used for carrying above-mentioned dna sequence dna is the plasmid vector that is suitable at bacterium and plant or zooblast self-replication, for example can be pWR13, pGV3850, pBIN19, pBIN400, pGA471, pT Ω 4A and pBI121 etc.
Another aspect the invention provides with the dna sequence dna of code book invention antibacterial peptide or carries recombinant expression vector plant transformed cell or its callus of these sequences, and by said by the plant of cell transformed or tissue regeneration.
This preferred embodiment on the one hand according to the present invention, wherein said antibacterial peptide encoding sequence has nucleotide sequence or its functional equivalent varient shown in sequence numbering in the sequence table 5,6,7 or 8 respectively.
This preferred embodiment on the one hand according to the present invention, wherein said plant comprises but is not only limited to potato, tomato, tobacco, paddy rice, citrus, mulberry tree, cherry etc.Wherein preferably potato, tomato and tobacco.
Another aspect the invention provides the method for producing antibacterial peptide with the DNA recombinant technology, and this method comprises the following steps:
(1) obtains having nucleotide sequence or its functional equivalent varient of the antibacterial peptide shown in the sequence numbering 1 or 2 or 3 or 4 in the code sequence tabulation;
(2) nucleotide sequence that obtains in the step (1) is operatively coupled on suitable controlling element and suitable expression, obtains being suitable for the recombinant expression vector of in protokaryon or eukaryotic cell, expressing;
(3) recombinant expression vector that obtains in the step (2) is transformed in the host cell of selection, and screening is by cell transformed;
(4) being suitable for expressing under the condition of said antibacterial peptide, cultivate said by cell transformed;
(5) directly obtain or the required antibacterial peptide of separation and purification therefrom from above-mentioned cell culture.
Another aspect the invention provides the method for producing the transgenic plant with anti-plant pathogenetic bacteria and fungi ability, and said method may further comprise the steps:
(1) provide and have coding as sequence numbering in the sequence table 1 or 2, or 3, or the nucleotide sequence of the antibacterial peptide shown in 4 or its functional equivalent varient;
(2) resulting nucleotide sequence in the step (1) is operatively coupled on suitable controlling element sequence and suitable expression, obtains being suitable for the recombinant expression vector of expression in vegetable cell or tissue;
(3) with the recombinant expression vector transformed host cell that obtains in the step (2), and screening is by the plant transformed cell or tissue;
(4) express under the condition of said antibacterial peptide being suitable for, cultivate and breed said by the plant transformed cell or tissue;
(5) regeneration of transgenic plant from the culture of above-mentioned cell or tissue.
According to this preferred embodiment of the present invention, wherein said host cell is prokaryotic cell prokaryocyte or eukaryotic cell, comprises Bacillus coli cells, yeast cell, vegetable cell, insect cell and mammalian cell.Wherein said carrier comprises plasmid, or virus, for example plant virus, insect viruses and animal virus, or phage.
Another aspect again, the invention provides a kind of with the bioactive method of antibacterial peptide in the quantitative detected sample of thin layer agarose plate hole diffusion process, its improvement comprises bed board gauge control with the thin layer agarose plate between 0.3 to 0.7mm, and based on the antibacterial peptide content in the mathematical relation calculation sample between antibacterial circle diameter and substratum thickness.
Another aspect, the invention provides the method that is used for screening in a large number transgenic plant, this method is based on known enhancing chemiluminescence method (ECL) realization, the improvement of being done comprises handling with deactivation with SDS-urea boiling water bath and is present in horseradish peroxidase (HRP) in the plant sample material, thereby improves the susceptibility of detection method.
Another aspect, the invention provides and be used to resist bacterium of plant or agricultural chemicals or the feed additive composition that fungal pathogens infects, so that one or more antibacterial peptides are activeconstituents according to the present invention, and be mixed with on one or more agricultural chemicals or acceptable carrier and/or other additives on the fodder additives in the said composition.
Last aspect, the invention provides and be used to resist human or animal's the bacterium or the pharmaceutical composition of fungi infestation or tumprigenicity eqpidemic disease, said composition is an activeconstituents with one or more antibacterial peptides according to the present invention, and is mixed with one or more pharmaceutically acceptable carriers and/or other additives.
The invention provides one group of new, that stronger fungicidal activity is arranged than natural antibacterial peptide small peptide compounds.In order to further investigate the structure-function relationship of this quasi-biology active compound, we utilize known segmentation solid-phase synthesis (Merrifield R.B.et al., Biochennistry 21:5020-5031,1982) synthesized the varient of the clipped form of the antibacterial peptide that is called cecropin B.As a representative instance, we have at first synthesized and have had antibacterial peptide following amino acid sequences, that be called cecropin BN-17: Lys-Trp-Lys-Val-Phe-Lys-Lys-Ile-Glu-Lys-Met-Gly-Arg-Asn-Ile-Arg-Asn (sequence numbering 1)
Utilize the improved what is called of the present invention " thin layer agarose plate hole diffusion process " (being designated hereinafter simply as the TAPWE method) (seeing embodiment 2 for details) that the biological activity of this peptide is analyzed, the result shows that this 17 peptide has kept the natural cecropin B of 35 peptides (Boman H.G.et al. fully, Biochemistry 11:33-42,1981; Dickinson L.et al., J.Biol Chem.263:19424-19429,1988) fungicidal activity.
On this basis, we are further synthetic one by one to be short to 12 amino acid, grow to the antibacterial peptide that 33 amino acid whose this paper are called cecropin BN-12 to BN-33, and according to the TAPWE method described in the embodiment 2, with the natural cecropin B of synthetic (Cecropin B) in advance in contrast, carrying out fungicidal activity detects.Found that the cecropin B of all these clipped forms all has and the same or analogous fungicidal activity of above-mentioned 35 peptides (seeing embodiment 2 for details).
Cecropin B is that giant silkworm (Hyalophora cecropia) pupa that people's (1980, document is the same) such as Hultmark handles diapause with intestinal bacteria is induced generation at first in its hemolymph.Known cecropin B is active the strongest in all natural antibacterial peptides.Equally, for further anti-microbial activity and the antimicrobial spectrum that improves this native peptides, and be on dna level, the encoding sequence of this peptide to be done further to modify, we have designed and synthesized this paper and have been called cecropin B-M (CB-M 1And CB-M 2) new antibacterial peptide.The amino acid composition of this small peptide and important different be of sequence with native peptides, its N-terminal has added an Ala or Pro, and adds that at the native peptides C-terminal Gly is beneficial to the amidation of C end.Thereby obtain having the peptide that shows 38 aminoacid sequences down, wherein X is selected from Ala (CB-M 1) and Pro (CB-M 2):
Met-X-Lys-Trp-Lys-Val-Phe-Lys-Lys-Ile-Glu-Lys-Met-Gly-Arg-
Asn-Ile-Arg-Asn-Gly-Ile-Val-Lys-Ala-Gly-Pro-Ala-Ile-Ala-Val-
Leu-Gly-Glu-Ala-Lys-Ala-Leu-Gly (sequence numbering 2)
People such as Jaynes J.M. (FASEB J.2:2878-2883,1989) design the antibacterial peptide that synthetic is called Shiva 1 with cecropin B for source, and it is said has stronger fungicidal activity than cecropin B.In order further to study the molecular structure and the function relationship of this peptide species, we calculate (Steiner H with Chou-Fasman, FEBS Letters 137:283-287,1982) and GOR directed information method (Gamier Jet al, J.Mol.Biol.120:97-120,1978) designed and synthesized this paper and named novel antimicrobial peptide into Shiva A.This peptide basically by under show that comprising 36-38 amino acid whose sequence forms: Met-(Ala)-Arg-Trp-Arg-Leu-Phe-Arg-Arg-Ile-Asp-Arg-Val-Gly-Lys-Gln-Ile-Lys-Gln-Gly-Ile-Leu-Arg-Ala-Gly-Pro (Lys)-Ala-Ile-Ala-Leu-Val-Gly-Asp-Ala-Arg-Ala-Val-(Gly) (sequence numbering 3)
Compare with known Shiva 1, this peptide sequence is characterised in that: at the deputy Pro of Shiva 1 N end deletion, add or do not add Ala, the Pro on the 26th of the Shiva 1 keeps or is substituted by Lys, keeps or leave out the glycine residue of Shiva 1 sequence end; Leave out behind the Gly then with the amidation of Val C-terminal as this new peptide.Through biologic activity analysis, find that it has the antibacterial ability of the Shiva 1 that is significantly higher than people such as Jaynes (seeing embodiment 2 for details) to Shiva A.
As previously mentioned, based on research to mutual relationship between the structure-function of antibacterial peptide, if with the intrinsic amino acid on the appropriate location in the natural peptide chain of aminoacid replacement that is beneficial to antibacterial peptide peptide chain formation α spiral, to help improving antibiotic/bacteriostatic activity (Kaiser E.T.and Kezdy F.J. of said peptide, Science 223:249-255,1984).For this reason, we attempt to replace 6 intrinsic amino-acid residues on the hydrophobic surface of amphiphilic of peptide chain of known cecropin B with leucine residue, be the 4th Val, the 8th Ile, the 11st Met, the 15th Ile, the 19th and 20 Ile and Val on N → C extreme direction, and design has been synthesized to have down and has been shown that this paper of aminoacid sequence is referred to as the antibacterial peptide of WHD:
Met-Lys-Trp-Lys-Leu-Phe-Lys-Lys-Leu-Glu-Lys-Leu-Gly-Arg-Asn-
Leu-Arg-Asn-Gly-Leu-Leu-Lys-Ala-Gly-Pro-Ala-Ile-Ala-Val-Leu-Gly-
Glu-Ala-Lys-Ala-Leu-Gly (sequence numbering 4)
The aminoacid sequence of this peptide and known cecropin B has about 83% homology.The biologic activity detected result shows, no matter is with method of peptide synthesis synthetic or the WHD that produces with the DNA recombinant technology, all than native peptides (cecropin B) wideer fungicidal spectrum and stronger anti-microbial activity arranged.For example, subtilis that WHD of the present invention can not kill and wound cecropin B (Bacillus subtilis) and Pseudomonas aeruginosa (Pseudomonas aeruginosa) also show anti-microbial activity, and Pseudomonas solanacearum (P.solanacearum) is had anti-microbial activity (seeing embodiment 2 for details) a little more than cecropin B.
Basically according to people such as Merrifield (Merrifield R.B.et al., Biochemistry 21:5020-5031,1982; Merrifield R.B.Science 21:178-185,1984) described method, promptly with the synthetic above-mentioned four kinds of antibacterial peptides of the present invention of the manual solid-phase synthesis of the improved a little carbodiimide/I-hydroxybenzotriazole of the inventor (DCC/HOBt).Synthetic schemes as shown in Figure 1.Wherein, the synthetic vectors that uses is the mBHA resin.In general, the speed of response at building-up reactions initial stage is very fast, productive rate is higher, but along with the prolongation of peptide chain, reaction is difficulty gradually.For this reason, should suitably increase the number of times of condensation reaction this moment and strengthen the concentration of total free aminoacids.After building-up process was finished, general available hydrogen fluoride (HF) downcut required synthetic peptide from vector resin.
Synthetic product through handling with hydroxylamine chloride, is removed the formyl group on the tryptophan residue under the alkaline pH condition after using Sephadex G-25 desalination.After crossing Sephadex G-25 post once more, separate and the required antibacterial peptide product of purifying with high pressure liquid chromatography (HPLC) method (HPLC) respectively.These products all present sharp-pointed single elution peak through identifying with HPLC.Through the aminoacid sequence of automatic edman degradation method analysis synthetic antibacterial peptide of the present invention, the result shows that the N of all four kinds of peptides holds the identical of 10 amino acid and design in advance.
In order to detect the anti-microbial activity of synthetic antibacterial peptide as stated above, we have detected our cecropin B N-17, CB-M with the thin layer agarose plate hole diffusion process of the improvement of this laboratory foundation 2, Shiva A and WHD be to the anti-microbial activity of pathogenic micro-organism.The target pathogenic bacteria that experiment is used comprises bacterial wilt of tomato bacterium (P.solanacearum) QT 5And QT 6Bacterial strain, potato bacterial wilt bacterium (P.solanacearum) BP04, NP11, HP36 and SP32 bacterial strain, potato rot positive germ (Erwinia carotovora pv.carotovora), Cauliflower Bacteria erwinia (E.carotovorapv.carotovora), cabbage black rot bacterium (Xanthomonas campestris pv.campestris) BC01 bacterial strain, rice leaf spot bacteria (X.oryzae pv.oryzae), xanthomonas oryzae pv. oryzicola (X.oryzae pv.oryzicola), bacterial canker of tomato (Clavibacter michiganense pv.michiganense), bacterial ring rot o potato bacterium (C.michiganense pv.sepedonium), six genus such as agrobacterium tumefaciens (Agrobacterium tumefaciens) and intestinal bacteria (E.coli) K12 are totally 15 kinds of bacteriums.Detection method sees hereinafter embodiment 2 for details.Experimental result shows that cecropin B N-17 has kept the equal basically anti-microbial activity with natural cecropin B (35 peptide).In addition, we have also further carried out preliminary antibacterial activity test to we synthetic clipped form cecropin B, found that,, in said detecting system, still demonstrate anti-microbial activity to a certain degree some pathogenic bacteria even the peptide chain length is as short as 12 amino acid.We had once carried out the firsts and seconds structural analysis to 12 kinds of natural antibacterial peptides.The result shows that the conserved amino acid major part of these antibacterial peptides is positioned at the sequence of N end.N end 1-12 amino acids has the trend of consistent formation αLuo Xuanjiegou, thereby infers that the N terminal amino acid sequence has vital role to its anti-microbial activity.In addition, the existence of the Gly of C-terminal also is crucial.The anti-microbial activity detected result of we synthetic cecropin B N-17 has convincingly demonstrated the exactness of above-mentioned supposition.
Though the structural modification and the chemosynthesis of other antibacterial peptides that natural cecropin and relevant insect are produced described above are successful, and for structure-functional relationship of further studying various antibacterial peptides provides new experimental evidence, but this class peptide material that obtains with chemical synthesis process not only cost height but also output is very limited, therefore, may be used for the production practice purpose hardly.In addition, though also might produce these peptide class biological bactericides by various insects through bacteria-induction, generally still there are pollutents such as proteolytic enzyme in this class peptide of separation and purification from insect, cause antibacterial peptide (the Florack et al. that is degraded, Transgenic Res.4:123-41,1995).Therefore, based on above-mentioned we to the result of study of chemosynthesis cecropin modified outcome or associated products, might be with the dna encoding sequence of synthetic these peptides of DNA recombinant technology, and utilize the plant compatibility recombinant expression vector, the gene transfered plant cell and the acquisition of these peptides are expressed, and then obtained the transgenic plant of antibacterium and fungi.This is one of purpose of reaching of the present invention expection just.
Based on the amino acid structure through four kinds of high reactivity antibacterial peptides modifying of aforementioned chemosynthesis, property example as an illustration, we have synthesized the said cecropin BN-17 of the present invention, cecropin B-M (CB-M with dna synthesizer successively 1And CB-M 2), the dna encoding sequence of Shiva A and WH-D.Simultaneously, for comparing, also synthesized the gene order of the natural cecropin B that encodes.Synthesizing of cecropin B and novel antimicrobial peptide gene order of the present invention all is to adopt at first several small segments of salvage basically, after the small segment phosphorylation is handled, connects each other under the effect of T4 dna ligase, obtains complete gene order.Purified back is after for example the M13mp19 phage vector is connected with appropriate carriers, cell with gained ligation product transformed into escherichia coli (for example E.coliJM103), screening positive clone then, and further confirm the exactness of gained encoding sequence through determined dna sequence.Be worth especially should be mentioned that, in synthetic cecropin B gene and above-mentioned four kinds of new antibacterial peptide genes of the present invention, all according to its codon-bias (Murray E.E.et al., Nucleic Acid Res.17:477-488,1989 in vegetable cell; Campbell W.H.andGowri G., Plant phygiol.92:1-11,1990) each amino acid whose codon of encoding is designed, and add that the multienzyme of being convenient to be connected with both sides controlling element sequence cuts site (referring to embodiment 3-6) before and after the structure gene.
Utilize in the plant-preference codon synthetic cecropin B gene at us, closely follow the codon (Xie Yi etc., biotechnology journal 6:311-315,1990) that Val, Asn are arranged behind the initiator codon ATG.If begin to express from initiator codon ATG, the promptly more natural cecropin B of the N-terminal of expression product has more Met, Val and three amino-acid residues of Asn, and this may influence the formation of α spiral on its secondary structure and thereby influence its anti-microbial activity.In addition, 3 ' end of cecropin B gene also is connected to Val and Asn codon after the Gly-39, and this will make the C-terminal of its expression product in higher eucaryotic cells can't amidation, thereby cause its anti-microbial activity to reduce.For this reason, utilize round pcr that former cecropin B gene order has been carried out the modification of following (1) and (2) dual mode:
(1) gene 3 ' is held Gly-39 Val, the deletion of Asn encoding sequence afterwards, and removed Barn HI and EcoRI restriction enzyme site in the former sequence, and replace TAG and two terminator codons of TAA and Xba I site.
(2) delete EcoRI, the Hind III of gene 5 ' end and the base sequence of BglII restriction enzyme site, atg start codon ATG and subsequent coding Val and Asn, replace the CCA of 5 ' end BamHI site, initiator codon ATG and coding Pro accordingly.
In addition, can after 5 ' end Barn HI site described in above-mentioned (2), insert the ribosome bind site ACAACA of plant, and change the CCA behind the initiator codon ATG (Pro) into GCT (Ala).
Through as above modifying the nucleotide sequence (being sequence numbering 6) that can obtain encoding and have peptide sequence shown in the sequence numbering 2.Realization is well-known to those skilled in the art to the method for the above-mentioned modification of natural cecropin B, and has made detailed description among the embodiment 4 hereinafter.
In addition, on the dna sequence dna level, synthetic and clone the cecropin BN-17 of brachymemma of the present invention and the method for the BN-12 to BN-33 that peptide length is 12-33 amino-acid residue also is well-known to those skilled in the art, and the preparation method of the cecropin BN-17 gene (sequence numbering 5) of relevant clipped form has also done concise and to the point description in embodiment 3.
As the antibacterial peptide Shiva l of high homology being arranged with Shiva A of the present invention, be at first by people such as Jaynes J.M. based on the aminoacid sequence of natural cecropin B with solid phase synthesis process synthetic (Jaynes J.M.et al., 1987, document is the same).In order in vegetable cell, to express ShivaA of the present invention, we are based on the aminoacid sequence of synthetic Shiva A as indicated above, designed and synthesized the dna encoding sequence (sequence numbering 7) of Shiva A antibacterial peptide, it is characterized in that the base sequence that (1) is easy to express in use as much as possible on the codon usage in plant; (2), be connected with the Omega sequence that strengthens the structure gene accurate translation in the upstream of structure gene; (3) this antibacterial peptide encoding sequence and two flank non-coding sequences include 8 restriction endonuclease sites.In order to obtain Shiva A gene, at first synthetic 16 small segments after with ligase enzyme connection and pcr amplification, are connected on suitable medial expression vector such as the M13BM20 (this research department preserves).With resulting recombinant vectors transformed host cell (as E.coii DH5 α F '), and carried the clone identical with expected sequence from filtering out the transformant.About the synthetic of Shiva A gene with clone as described in the embodiment 5 hereinafter.
The inventor is based on present known aminoacid sequence with natural cecropin B of maximum anti-microbial activity, and the alleged WHD gene (sequence numbering 8) of this paper has further been synthesized in modified and design.One or more hydrophobic amino acids on the said aminoacid sequence N section amphiphilic, promptly Val (4), Ile (8) and Met (11) Ile (15) and Ile (19) and Val (20) Leu that had a positive charge substitutes.In a preferred embodiment, above-mentioned six hydrophobic amino acids are all replaced by Leu.According to this preferred embodiment, before and after the initiator codon (ATG) of its structure gene, be added with ribosome bind site ACAACA and GCT (Ala) codon respectively.Be added with Gly codon GGT before its terminator codon so that the amidation of expression product.The two ends of encoding sequence are added with suitable restriction enzyme site respectively.This external structure gene N end is connected with the Omega sequence, also is provided with a Stu I site of being convenient to differentiate the uniqueness of this gene at the afterbody of gene order.The complete genome sequence of this WHD antibacterial peptide is shown in sequence table sequence encoding 8.About the synthetic of WHD gene with clone as described in the embodiment 6 hereinafter.
As previously mentioned, antibacterial peptide is having very big application potential aspect antibacterium and tumour.On the basis of the gene of cloning cecropin and related peptides thereof, many investigators have proposed the report of their expressing said gene in intestinal bacteria and eukaryotic cell (for example referring to Anderson D.et al., Biochem.J.28:219-24,1991; Mellers M.et al., Eur.J.Biochem.199:435-439,1991; Pang S.K.et al., Gene 116:165-72,1992; Pier V.L.et al., Gene 134:7-13,1993).In order to verify the expressiveness of our synthetic antibacterial peptide gene, be example with Shiva A gene, studied its expression in prokaryotic cell prokaryocyte intestinal bacteria and eukaryotic cell (fortunatus cell).At first will be as stated above synthetic Shiva A gene respectively with the pMAL carrier on maltose binding protein (MAL) coding region or be connected with multienzyme joint on the pUC plasmid, in e. coli host cell after inducing with IPTG, with expressing fusion protein it.Obtain required Shiva A peptide molecule through column chromatography purification and after with the CNBr cracking.Wherein be easier to separation and purification (antibacterial peptide account for total fusion protein product 60%), and in external bacteriostatic experiment and Western experiment, show the bacteriostatic activity and the immunologic competence of antibacterial peptide with multienzyme joint sequence connectionist with pUC.And, in Bacillus coli cells, then can cause host cell death, and be difficult to be expressed because of antibacterial peptide with the expression vector that Shiva A structure gene and Pl promotor and SD sequence connect and compose.These results of study provide valuable data for further selecting more effective antibacterial peptide gene expression system.
In addition, in order to study the expression of antibacterial peptide gene of the present invention in zooblast, use fortunatus nuclear polyhedrosis virus (BmNPV) as carrier, behind the bombyx mori cell through cultivating with recombinant transfer plasmid and BmNPV transfection, screen positive plaque, and detect expression product with the ECL spot hybridization.Found that the expression of BmNPV recombinant chou in silkworm cultured cell of carrying Shiva A gene is not as high in polypide.People's (Bioehem.J.28:219-24,1991) such as this discovery and Anderson D result of study conforms to.
Antibacterial peptide with chemosynthesis or the production of DNA recombinant technology, comprise the openly natural antibacterial peptide and the novel antimicrobial peptide of the present invention of aminoacid sequence, be expected separately or with other antibacteriums or anti-mycotic agent with multi-form associating, and according to the difference of application target, be mixed and made into various agricultural chemicals or feed or pharmaceutically acceptable vehicle or other additives and can directly be applied to plant, agricultural-food, agricultural chemicals in feed or the soil or feed additive composition, be used for control by bacterium, fungi, the various Plant diseasess that virus or parasite cause are perhaps made the antibacterium that can directly apply to human body, anti-mycotic agent, antiviral agent or antineoplastic agent or its medical composition.
According to the present invention, wherein said vehicle comprises pharmaceutical carriers such as starch, sucrose, lactose.Other additives or auxiliary can comprise wetting agent, epidermis penetration agent, solubilizing agent, dispersion agent and stablizer etc.With antibacterial peptide of the present invention is that the agricultural chemicals or the medical composition of primary activity composition can be made tablet, powder agent, slow-release microcapsule agent, solvent, emulsion or sprays.
Be worth especially should be mentioned that, the bacterial cell suspension that also can directly use antibacterial peptide gene of the present invention to transform in pharmaceutical composition is made basal component, make the agricultural chemicals or the fodder additives of various different dosage forms, be used to prevent and/or treat the animal or plant disease.
For the dna sequence dna of the antibacterial peptide that coding of the present invention is new integrate or homologous recombination in the chromogene group of organism (for example vegetable cell), a normally used carrier system is for example tl plasmid of agrobacterium tumefaciens (Agrobacterium tumefaciens) of Agrobacterium.Agrobacterium can be incorporated into the T-DNA fragment in the Plant Genome.The left and right sides border sequence of known T-DNA particularly right margin zone plays an important role in T-DNA shifts.Another major progress of genetically engineered plant technology is to use the regulating and controlling sequence of expressing mosaic gene in plant.These mosaic genes contain promotor, structural gene sequence to be expressed and 3 ' non-coding region of poly-adenosine.In recent years, developed two plasmid-type carrier systems again, in this class carrier, foreign gene be integrated into one have extensive host range than between the T-DNA border sequence on the miniplasmids.The inventor is in research for many years, along with updating and modifying, the cecropin B-m (CB-m of successively made up and carried antibacterial peptide cecropin B gene, connected two copy cecropin B genes, genetic modification the natural antibacterial peptide gene order 1And CB-m 2) gene, Shiva A gene and carry the expression vector of two kinds of antibacterial peptide genes simultaneously.Because our synthetic antibacterial peptide gene all is to be cloned among the phage vector M13 to increase at first, so the present invention at first is cloned into gene order in the general plasmid vector.To be suitable in plant expression promoter and terminator then and be connected with antibacterial peptide encoding sequence of the present invention and obtain mosaic gene, be built into can be in vegetable cell the expression vector of high expression level.At last, said expression vector is changed in the suitable agrobacterium strains, after method such as cut through molecular hybridization and enzyme confirms wherein to carry the correct recombination sequence that is connected, can be directly used in the genetic transformation (embodiment 10 vide infra) of plants such as potato, tomato, tobacco, citrus.
Potato (Solamm tuberosum) is the fourth-largest food crop in the world that are only second to paddy rice, wheat, corn.In China, about 3,000,000 hectares of the cultivated area of potato (Chinese agriculture yearbook, Chinese agriculture press, 1994), gross output occupies the second place of the world.Worldwide, potato accounts for 25% of ultimate production because of the production loss that bacterial soft rot and potato bacterial wilt are caused.Therefore, explanation as an example, this paper mainly describes the research and the result thereof of our completed potato genetic transformation.
For antibacterial peptide gene is imported in the potato, the present invention uses blade that potato kind rice draws or stem tuber sheet as explant, (A.tumefaciens) makes amboceptor with agrobacterium tumefaciens, set up the mode system of potato commentaries on classics NPT II and gus gene, the result shows that transformation frequency is about 14-34%.And then transform, and on the selection substratum that contains kantlex (Kan), obtained Kan resistance (Kan with agrobacterium tumefaciens or Agrobacterium rhizogenes (A.rhizogenes) R) plant.Antibacterial peptide gene of the present invention has been imported in 7 potato main breeds (being).Histochemical method's detected result shows that gus reporter gene all obtains expressing, and can pass to the offspring by nourishing and generating in root, stem, leaf and the stem tuber of regeneration plant.At present, the present invention has successfully obtained 1050 transgenic lines that import antibacterial peptide of the present invention.
More be applicable to potato genetic conversion system of the present invention in order to set up one.We have systematically studied agrobacterium strains and plasmid, explant kind and have been total to the influence of incubation time to the gus gene transient expression.The result shows that gus gene transient expression rate is significantly higher than octopine (Octopine) and agropine (Agropine) type bacterial strain when transforming with nopaline (Nopaline) type bacterial strain.The contained plasmid of same LBA4404 bacterial strain not simultaneously, the transient expression rate of gus gene also has very big-difference.
Amboceptor as antibacterial peptide gene of the present invention being imported in the vegetable cell except using the agrobacterium tumefaciens, can also use Agrobacterium rhizogenes.The advantage that shifts with the Agrobacterium rhizogenes mediated gene is to obtain higher transformation frequency, but owing to there is the Ri plasmid of the hair-like root induction of inherent in the bacterial cell, and cause some transfer-gen plant multi-form paramophia phenomenon (i.e. " root of hair syndromes " to occur, Jia Shirong and Wang Zhixing, see that big gram edits " agro-biological engineering " by force, chemical industry press waits to publish).
According to the difference of employed carrier, available blade kalamycin resistance (Kan R) detection method and gus reporter gene detection method determine that whether antibacterial peptide gene obtains in the plant tissue expressing being transformed.Also can use PCR, dot blotting hybridization method and Southern blot hybridization method, and confirm that by sequencing said gene order correctly is incorporated into (referring to embodiment 11,12) in the Plant Genome antibacterial peptide gene of the present invention.
Use the synthetic Oligonucleolide primers through the PCR reaction from plant leaf amplification antibacterial peptide gene sequence of the present invention total DNA, prove that it is with original design and synthetic corresponding gene sequences size is identical.From reaction mixture, reclaim and purified pcr product after, through and have the suitable phage vector reorganization of beta galactosidase enzyme gene, obtain recombinant phage.This recombinant phage that carries antibacterial peptide gene of the present invention contain cultivate on the substratum of X-gal after, select and obtain colourless plaque.With gained plaque ehec infection XL-l Blue and after cultivating propagation, extract cell chromosome DNA, cut digestion and, screen and obtain positive colony with suitable restricted endoenzyme through the agarose gel electrophoresis analysis.Extract single stranded DNA from the gained positive colony, with dideoxy method order-checking, the result shows that the dna sequence dna that obtains is in full accord with the antibacterial peptide structural gene sequence that our design from the potato plants genomic dna through the breeding of two generations.This fact shows that not only antibacterial peptide gene of the present invention has been incorporated in the transgenic plant genome, and the stable gene that is transferred of explanation pass to its offspring, and do not have any rearrangement or the change of producer sequence.
In addition, the Northern engram analysis that presents the male transfer-gen plant in PCR, dot blotting and Southern detect is shown that antibacterial peptide gene of the present invention not only has been incorporated in the genome of vegetable cell, and on transcriptional level, realized expression.
The present invention adopts by our improved enhancing chemiluminescence (ECL) Dot blot hybrid method above-mentioned transfer-gen plant is carried out detection on the translation skill, found that in 52 parts of transgenic line samples that detected, there are 12 strain systems to be positive, thereby confirm that antibacterial peptide gene of the present invention has been translated into corresponding polypeptide product in these strain systems.
ECL (Enhanced chemiluminescence) method has the susceptibility than isotope detection Fa Genggao as a kind of protein detection method.Yet, because ECL produces fluorescent substance based on horseradish peroxidase (HRP) catalytic substrate, but and vegetable cell or organize in contain the HRP of detection level, thereby false positive results appears easily.Therefore, this method is not widely used in the detection of plant protein at present as yet.The present invention is to replace previously used sodium azide (NaN with sodium laurylsulfonate (SDS) and urea boiling water bath to the improvement of this method 3), inactivation HRP, thus improve detection sensitivity and avoided false positive results significantly.In addition, it is little also to have the point sample amount through our improved ECL dot hybridization method, and the sample number of waiting to reflect is many, and reduces in the specimen preparation process protein by advantages such as enzyme liberating.We with this method and ECL Western blotting relatively after, find that the former is more suitable for the screening of a large amount of transgenic plant.Therefore, the ECL method of this improvement can be widely used in the screening to various transgenic plant.This modification method also belongs to the scope of request patent protection of the present invention.
Because the plant-bacterial-wilt bacterium is to breed in the vascular bundle of plant, the result stops up the vascular bundle of plant and causes the plant sudden death.The synthetic antibacterial peptide can not touch germ very soon in the born of the same parents, so limit its performance germicidal action, antibacterial peptide is degraded.In order to make recombinant expressed antibacterial peptide of the present invention be secreted into the extracellular to improve its fungicidal effectiveness, the cecropin B gene (CB-m that synthetic of the present invention is modified 2) or Shiva A gene be connected with the signal peptide sequence of αDian Fenmei gene respectively, and further the Ω sequence of translation is strengthened in adjunction, under the control of CaMV 35S promoter, is built into mosaic gene.The mosaic gene that this is new is cloned into modified plant expression vector, in pBI121, is built into secreted expression carrier.This expression vector is imported in the plant materials, be secreted into the extracellular, set up protection mechanism at cell surface in the hope of making expression product.Because antibacterial peptide itself is a kind of secreted polypeptide, thereby can gets rid of it and contain the signal (Iturriaga D.et al., Plant Cell Rep.13:295-299,1994) that is positioned on other organoids.With immune electron microscopy by above-mentioned secreted expression carrier plant transformed tissue of the present invention, in stem, leaf cell matter and the intercellular substance of the transgenic potato plant of discovery adjunction signal peptide sequence the gold grain precipitation is arranged all, do not connect the signal peptide sequence person then only observes gold grain in tenuigenin.There is no the gold grain precipitation in tenuigenin of non-transgenic adjoining tree and the intercellular substance.
In order further to study possibility of carrying the practical application in production transgenosis antibacterial plant of antibacterial peptide gene recombinant expression vector of the present invention, we utilize domestic main 7 the susceptible bacterial wilt potato kinds of planting in China's Mainland or strain (i.e. rice draw, river taro 56, rich No. 1 of capital, No. 9, dam potato, 802-552,74-6-9 and Favorita) as the target plant, and to commentaries on classics cecropin B/Shiva A unit price gene and CB-m 2The transgenic Rhizoma Solani tuber osi strain system of/Shiva A bivalent gene has carried out becoming the resistance to bacterial wilt experiment of strain phase with sick garden, field indoor seedling stage.In the experiment, use be stained with the root inoculation method (Fang Zhongda, disease resistance and Differentiation of Pathogenicity are measured, and reach chief editor's " disease-resistant organon " in square, the 359-360 page or leaf, agriculture press, Beijing, 1979) inoculation plant in seedling stage, and to hinder the sick garden of root filling bacterium method (Fang Zhongda, document is the same) inoculation one-tenth strain phase plant.Using within Chinese territory, the major physiological microspecies of potato bacterial wilt are that No. 3 bacterial strains of physiological strain are as pathogenic bacterium.The preliminary evaluation result that 230 strain systems are carried out proves that the rice that imports MS1-PL69, MS1-X4, MS1-1102-20-1 and the MS1-1102-12 of Shiva A unit price gene draws strain system, imports the CS1-B1-9 of Shiva A unit price gene and imports the cecropin B (CB-m that modifies 2) the CC-E10-1 river taro 56 strain cordings of unit price gene have good bacterial wilt resistance, reach basically and be stabilized in medium disease-resistant level.
The lethal effect of antibacterial peptide to tumour cell reported in many researchs.As people such as Dai Zhuying [Nanjing Normal University's journal (natural science edition) 1:88-93,1988] report natural antibacterial peptide the B4 transformant is had obvious suppression and lethal effect, making it can not adherent and normal growth.A kind of antibacterial peptide of Jaynes J.M. (WO89/00199) report not only has stronger lethal effect to bacterium, fungi and protozoon, but also can quicken cytodifferentiation and promote wound healing and B16 myeloma cell is had killing activity.People such as Han Xianping (biotechnology communication 5:1,1994) have studied the lethal effect of tussah antibacterial peptide D to cervical cancer cell.Our research cooperative groups has further been studied four kinds of new antibacterial peptides of the present invention, i.e. cecropin BN-17, CB-M 2, Shiva A and WHD and the synthetic antibacterial peptide ABP3 that reported before our be to the external killing activity of leukemia cell K562, and to the restraining effect of mouse S180 sarcoma and V14 cervical cancer cell transplanted tumor.The K562 cells in vitro is being killed and wounded in the research, finding that antibacterial peptide of the present invention has destruction to the cytolemma of tumour cell, but also observing the corresponding change of the subcellular structure of the oncocyte that is subject to processing.After handling K562 cell 24h with antibacterial peptide, the cytolemma local damage, entocyte leaks, and the obvious swelling of plastosome, the cavity that differs in size wherein occurs, and ridge comes off or disappears.Press down in vivo in the knurl experiment, show that then antibacterial peptide Shiva A of the present invention has obvious suppression effect (referring to embodiment 14) to mouse S180 sarcoma and V14 cervical cancer cell transplanted tumor.
Description of drawings Fig. 1 describes to show antibacterial peptide synthetic schematic flow sheet.Fig. 2 describes the making method of thin layer agarose plate.Fig. 3 describes with the synoptic diagram of PCR method to the transformation of Shiva A gene.Fig. 4 shows the building process of transfer vector pBM-S1.Fig. 5 shows the structure of the integrated expression vector pBZ863 that has cecropin B gene.The implication of each code name is C among the figure: cecropin B gene; Pmas: the bidirectional promoter of mannopine synthase gene; The promotor of P35S-cauliflower mosaic virus 35S RNA; The two-way terminator of the T-DNA7 ' of 7 ' 5 ' T-pTiA6 and 5 ' gene; NosT: the terminator of rouge alkali synthetase gene; OcsT-octopine synthase gene terminator; Border-T-DNA border order; The RB-right margin; The LB-left margin; Ec:EcoRI; Bm:BamH I; Bg:Bgl II; Kp:Kpn I; Sc:Sac I; Ps:Pst I; Hd:Hind III; Ev:EcoRV.Fig. 6 shows the structure of the two plasmid expression vector pBT567 that have cecropin B gene.The implication of each code name is identical with Fig. 5 among the figure.Fig. 7 shows the structure of the two plasmid expression vectors that have the two copies cecropin B gene that merges end to end.The two copies cecropin B gene that the 2C representative is merged end to end among the figure, the implication of other each code names is identical with Fig. 5.Fig. 8 shows the structure that has Shiva A expression carrier pTYB1 and pTBM20.Sh represents Shiva A gene among the figure, and the implication of other each code names is identical with Fig. 5.Fig. 9 shows the structure of the Shiva A expression carrier of the CaMV 35S promoter regulation and control with two enhansers.Sh represents Shiva A gene among the figure, and the P2e35S representative has the CaMV 35S promoter of two enhansers, and the implication of other each code names is identical with Fig. 5.Figure 10 demonstration has CB-m 1The structure of expression vector.The cecropin B gene (CB-m that the mC representative is modified among the figure 1), on behalf of mannopine synthase gene promoter and CaMV 35S promoter, Pmac merge the promotor that forms, and the implication of other each code names is identical with Fig. 5.Figure 11 demonstration has CB-m 2The structure of expression carrier.M among the figure *C represents CB-m 2Gene; Pmac-mannopine synthase gene promoter and CaMV 35S promoter merge the promotor that forms; The implication of other each code names is identical with Fig. 5.Figure 12 shows the structure have the dual-gene expression vector of cecropin B and Shiva A.Sh represents Shiva A gene among the figure, the terminator of tm1T-T-DNA tm1 gene, and the implication of other each code names is identical with Fig. 5.Figure 13 demonstration has CB-m 2Structure with the dual-gene expression vector of Shiva A.M among the figure *C represents CB-m 2Gene, Sh are represented Shiva A gene; Pmac-mannopine synthase gene promoter and CaMV 35S promoter merge the promotor that forms, and the implication of other each code names is identical with Fig. 5.Figure 14 shows the structure of the expression vector of the antibacterial peptide gene that carries the α-Dian Fenmei signal peptide sequence.M among the figure *C represents CB-m 2, 2e represents two enhansers, and P35S represents the CaMV 35S promoter; The implication of other each code names is identical with Fig. 5.
EXAMPLE Example 1: the synthetic and separation and purification of antibacterial peptide
Present embodiment is described the synthetic and separation and purification novel antimicrobial peptide of the present invention of design, i.e. cecropin BN-17, modified cecropin B (CB-M 2), Shiva A and WHD, synthesized cecropin B and Shiva 1 simultaneously in contrast.
Present embodiment adopts solid phase synthesis process (Merrifield R.B.et al, Biochemistry21:5020-5031,1982; Andreu D.et al, Proc.Natl.Acad.Sci.USA 80:6475-6479,1983) synthetic above-mentioned 6 kinds of antibacterial peptides.The raw material amino acid that uses is the amino acid (Sigma company) of t-Boc protection of N end and the active functional group protection of side chain; carrier is mBHA resin (p-Methyl Benzhydrylamine Resin; ABI company); main agents and solvent have carbodiimide (DCC), I-hydroxybenzotriazole (HOBt), diisopropyl ethyl amine (DIEA); methylene dichloride; N, dinethylformamide (DMF), trifluoracetic acid (TFA).Fig. 1 is the synoptic diagram of synthesis flow.
After finishing, building-up reactions in the 1g peptide resin, adds 1g to first-phenol, the 1g toluene-, and 1ml mercaptoethanol and 20ml hydrogen fluoride (HF), hydrogen fluoride (HF) is removed in the suction of reaction 1-2h final vacuum, and washs with ether.Use 50% acetate dissolution then, be diluted to below the content to 10% of acetic acid.Lyophilize then obtains synthetic antibacterial peptide component.
Sample on the antibacterial peptide component is arrived with 7% acetic acid equilibrated Sephadex G-25 (Superfine, Pharmacia company) post is (on the 14mm * 100cm), with same balance liquid wash-out, monitor the 280nm absorption value with the 1ml/min flow velocity, collect first peak value part and lyophilize.People's such as employing MerrifieldR.B. method (Biochemistry 21:5020-5031; 1982) formyl radical (Formyl) on the tryptophane (TrP) in the excision freeze drying example; last Sephadax G-25 post (23mm * 50cm), collect first peak value part of eluate.
The synthetic antibacterial peptide is with half preparation type C18 reversed-phase column (Ultrasphere ODS, 5 μ, 10mm * 25cm, Beckman company), and preparation type high pressure liquid chromatography (HPLC) instrument (Waters 990, Waters company) carries out separation and purification.With acetonitrile solution (respectively containing 0.05%TFA in water and the acetonitrile) linear gradient elution of 20%-30%, flow velocity 3ml/min collects abundance maximum elution peak.The ultimate yield of each antibacterial peptide that separation and purification obtains is respectively cecropin B:4.1%, Shiva 1:2.2%, cecropin BN-17:11.3%, CB-M 2: 3.7%, Shiva A:8.8%, WHD; 3.7%.
The antibacterial peptide of separation and purification is type C18 reversed-phase column (Ultrasphere ODS5 μ, 4.6mm * 15cm, Beckman company) by analysis, and analysis mode high pressure liquid chromatography (HPLC) instrument (Waters 490, Waters company) detects, and its purity is all more than 99%.Each antibacterial peptide is all used acetonitrile solution (respectively containing 0.05%TFA in water and the acetonitrile) linear gradient elution of 20%-50% during purity detecting, and flow velocity is 1ml/min; The urea-denatured polyacrylamide gel electrophoresis of 8M (Swank R.T.﹠amp; Munkers K.D., Anal.Biochem.39:462-477,1971) or sds polyacrylamide gel electrophoresis (The Pharmaciapolypeptide molecular weight electrophoresis calibration kit working instructions) result show that each antibacterial peptide all is single electrophoretic band.
Add 6N azeotropic hydrochloric acid in each antibacterial peptide that obtains, taking out anhydrates separates pipe air and sealing.In 110 ℃ of hydrolysis 24 hours, after hydrochloric acid is removed in evaporation residue is dissolved in the 0.2 M standard sodium citrate buffer solution (pH2.2) again.Analyze its composition with automatic amino acid analyser, proofread and correct with each amino acid whose rate of recovery in the standard amino acid mixture.The result shows that its composition is in full accord with the composition of the antibacterial peptide of design.Hold the different sulphur hydracid of the amino acid whose benzene derivative of degrading successively with the automatic edman degradation method from N, analyze the N terminal amino acid sequence of each antibacterial peptide with Applied Biosystems 477A type gas phase protein order instrument and AppliedBiosystems 120A type PTH amino acidanalyser, the result is consistent with the antibacterial peptide of design.The aminoacid sequence of synthetic novel antimicrobial peptide is shown in sequence table numbering 1 to 4.Embodiment 2: the biological activity of antibacterial peptide
Present embodiment is described the present invention to general so far plate agarose hole diffusion process (BomanH.G.et a1., Insect Biochemistry 11:33-42,1981) improvement of being done, thereby setting up a kind of 2.2-3.8 times of detection sensitivity raising, antibacterial peptide content of making can be observed the new thin layer agarose plate hole diffusion process of tangible inhibition zone, and has measured the biologic activity of antibacterial peptide of the present invention with this method when being 0.1 μ g.
Use the improved above-mentioned detection method of the present invention (TAPWE method) in the present embodiment, and this method is estimated with artificial solid phase synthesis antibacterial peptide Shiva 1 standard substance (referring to embodiment 1) and intestinal bacteria (Escherichiacoli) K12 D31.Quantification of protein adopts the Lowry method (Peterson G.L.et al., Anal.Biochem.83:346-356,1977) of improvement.
Follow these steps to measure the biological activity of antibacterial peptide with thin layer agarose plate hole diffusion process:
(1) by preparation thin layer flat plate mold shown in Figure 2, wherein a is a rectangle simple glass sheet; B is the U-shaped thin slice, superposes with X-ray film, and b is bonded on a.Determine the number of plies (the thick 0.3mm of every agreement that contracts a film or TV play to an actor or actress) of employed X-ray film according to the dull and stereotyped desired thickness of thin layer; C is a spill silication glass, and steam silicification (Sambrook J.et al., A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, pp.E.1-E.2,1989) is adopted in the silication of glass.With a-b and c superimposed after, with adhesive plaster left and right and bottom are sealed, obtain d.For research substratum thickness is to antibiotic active influence on a thin layer flat board, the spy adopts slant medium, to observe the relation between substratum thickness, antibacterial peptide consumption, this three of antibacterial circle diameter.When making inclined-plane thin layer flat board, the bonding X-ray film in upper end, at 2.5mm, the lower end does not then add X-ray sheet (its thickness is 0.0mm) with its gauge control.
(2) (every 100ml contains MgSO at the D31 substratum 40.02g, citric acid 0.02g, K 2HPO 40.34g, peptone 2g, yeast extract 1g, NaCl2g, glucose 2mg and agarose 1g) in to cultivate e. coli k12 D31 standby.
(3) e. coli k12 D31 is inserted in the 5ml LB liquid nutrient medium 37 ℃ of shaking table 250rpm overnight incubation.Transfer among the fresh LB of 5ml with 1% inoculum size, 4 ℃, the centrifugal 10min of 4000rpm behind 37 ℃ of shaking culture 2.5h collect thalline, and wash once with 10mM phosphate buffered saline buffer (pH7.4).
(4) will be cooled to 42 ℃ through autoclaved D31 substratum, add above-mentioned K12 D31 somatic cells 1-4 * 10 in every 100ml substratum 6CFU (OD 600≌ 0.2) and 100 μ g/ml Streptomycin sulphates, 50 μ l, pour in the thin layer flat plate mold behind the mixing rapidly.Solidify fixed mould lower end, back, silication glass is removed to d direction horizontal sliding shown in Figure 2, the agarose thin layer is flattened on the simple glass a, use the equidistant punching of punch tool (external diameter 4mm) then.
(5) in the hole, click and enter Shiva 1 standard substance 0.1-0.8 μ g, put 37 ℃ of cultivation 10h in the sterile chamber, with vernier caliper measurement inhibition zone size.
Through many groups experimental data is carried out statistical analysis, find square (Y, the mm of antibacterial circle diameter 2), culture medium flat plate thickness (X, mm) and the pass of antibacterial peptide content (Z, μ g) the three area of a room be:
Y＝79.77Log(Z)＋31.32/X＋83.61
The experimental result of present embodiment shows that substratum thickness is very big to the susceptibility influence that detects, and the size of same antibacterial peptide amount inhibition zone when substratum thickness is 0.35mm and 2.17mm differs 2.2-3.8 doubly.If we deduct the area in point sample hole, only peripheral inhibition zone area is compared, its size differs and is about 2.6-9.9 doubly.Use present method can improve the sensitivity and the repeatability of detection greatly, the person that makes the different operating can prepare the flat board of unified thickness.In addition because substratum thickness reduces the also corresponding minimizing of last sample volume.For the lower sample of concentration, can be by to sample concentration, go up sample and enlarge the point sample bore dia and solved repeatedly.
In addition, this method of this experimental applications has been measured antibacterial peptide cecropin BN-17 to bacterial wilt of tomato bacterium (P.solanacearum) QT 5And QT 6Bacterial strain, potato bacterial wilt bacterium (P.solanacearum) BP04, NP11, HP36 and SP32 bacterial strain, potato rot positive germ (Erwinia carotovora pv.carotovora), Cauliflower Bacteria erwinia (E.carotovora pv.carotovora), cabbage black rot bacterium (Xanthomonas campestris pv.campestris) BC01 bacterial strain, rice leaf spot bacteria (X.oryzae pv.oryzae), xanthomonas oryzae pv. oryzicola (X.oryzae pv.oryzicola), bacterial canker of tomato (Clavibacter michiganense pv.michiganense), bacterial ring rot o potato bacterium (C.michiganense pv.sepedonium), the bacteriostatic activity of 15 bacterial strains such as agrobacterium tumefaciens (Agrobacterium tumefaciens) and intestinal bacteria (E.coli) K12.
Above-mentioned bacterial strains all on gravy peptone nutrient agar enlarged culturing standby after 48 hours.
Respectively waiting to try bacterial strain, to be diluted to concentration with aqua sterilisa respectively be 10 8The suspension of CFU/ml is got and is respectively waited to try bacterial strain suspension 600 μ l, respectively the NA substratum that melts with 30ml (yeast extract paste 1g, beef extract 3g, peptone 5g, glucose 5g, agar 15g, distilled water 1000ml pH7.2) mixes, and bacterial concentration is adjusted to 2 * 10 4CFU/ml.Get 12ml and contain bacterium culture medium and pour in the culture dish of diameter 8.65cm, solidify back punching (aperture 2mm), what every hole added different concns respectively waits to try antibacterial peptide sample 4 μ l.Antibacterial peptide is all used 0.1M phosphate buffered saline buffer (pH6.4) dilution, and with same damping fluid as blank.Repeat 5 times, and culture dish is placed on incubation in 28 ℃ of thermostat containers, observe inhibition zone behind the 48h, and record just can suppress the minimum concentration of respectively waiting to try antimicrobial substance that the pathogenetic bacteria bacterium colony forms.
Detected result shows, the bacterium that cecropin BN-17 treats 6 genus of examination all has anti-microbial effect, wherein the anti-microbial effect to erwinia genus (potato and Cauliflower Bacteria erwinia) and wild Bacillaceae (agrobacterium tumefaciens) bacterium is the strongest, and minimum inhibitory concentration is 0.3 μ M; Effect to Xanthomonas and Escherichia is taken second place, and minimum inhibitory concentration is respectively 0.3-3.0 μ M and 1.5 μ M; A little less than the effect to pseudomonas, minimum inhibitory concentration is 126-150 μ M; Effect to Corynebacterium is the most weak, and minimum inhibitory concentration is 162-198 μ M.
Also measured cecropin B in addition in the present embodiment, Shiva 1 (both all in contrast) and cecropin B N-17 of the present invention, cecropin B (CB-M through modifying 2), Shiva A and WHD be to E.coli K12D3l, B.subtdis, S.aureus, the activity of P.valgaris and P.solanacearum, result are as mentioned shown in the table 1.
Six kinds of new antibacterial peptides of table 1 detect the anti-microbial activity of different germs
Minimum external lethal concentration (μ M) antibacterial peptide E.coliK12 D31 B.subtilis S.aureus P.valgaris P.solanacearum cecropin B 0.54 0.67 0.80 1.03 0.50Shiva 1 2.51 1.88 2.71 2.81 2.01BN-17 0.60 0.73 0.71 0.88 0.64CB-M 20.47 0.44 0.69 1.13 0.38Shiva A, 0.51 0.60 0.72 1.00 0.42WHD, 0.41 0.50 0.91 0.83 0.37 embodiment 3: the preparation of the gene of coding cecropin BN end 17
Present embodiment is described the synthetic and clone of design that coding cecropin BN holds the gene of 17 peptides.
ATP, the IPTG, X-gal, the limited restriction endonuclease that use among following each embodiment of the present invention are Boehringer Mannheim company product except that specializing; T4 polynueleotide kinase, T4DNA ligase enzyme are Biolabs company product; The determined dna sequence medicine box is available from USB company; Sac I, Taq archaeal dna polymerase are produced by Promega company, α- 32P-dATP is Beijing Fu Rui company product.BamH I, StuI are GIBCO BRL company product.
Present embodiment adopts codon (Murray E.E.et al, Nucleic AcidsRes., 17:477-498,1989 of plant-preference; Campbell-Anolles G.﹠amp; Gowri G., Plant Physiol., 92:1-11,1990) design cecropin BN holds 17 amino acid whose sign indicating numbers of reading of 17 peptides.Introduce restriction enzyme site BamH I, initiator codon ATG and Ala codon GCG at 5 of Shiva A structure gene ' end, add Gly codon GGC and restriction enzyme site EcoR I at 3 ' end, the length of gained gene construct is 78bp.For making things convenient for the synthetic and splicing of fragment, under being divided into, whole gene shows 6 the fragment C1-C6 of complementary that are overlapping, and synthetic with dna synthesizer respectively.C1：5’GGATCCATGGCGAAGTGGAAGGTCTTCAAGA?3’(31mer) C2：3’CCTAGGTACCGCTTCACCTTCCA?5’(23mer) C3：5’AGATCGAGAAGATGGGCCGCA?3’(21mer) C4：3’GAAGTTCTTCTAGCTCTTCTACCCGGCGTTGTAG?5’(34mer) C5：5’ACATCAGGAACGGCTAGTAAGAATTC?3’(26mer) C6：3’TCCTTGCCGATCATTCTTAAG?5’(21mer)
6 oligonucleotide fragments of synthetic under excessive ATP condition, are added the T4 polynueleotide kinase and make it phosphorylation, and it is pressed equimolar amount mix.After annealing, add the T4 dna ligase and connect.Connect product and separate through 10% polyacrylamide gel electrophoresis, cutting-out contains the segmental gel in the 250bp left and right sides.The chopping back is in 0.1%SDS, 0.5M NH 4Ac, 10mM MgAc 237 ℃ of soaked overnight in the solution.Getting supernatant after centrifugal, as template, is primer with C-1, the C-6 fragment of phosphorylation with sedimentary DNA, carries out pcr amplification.Amplification reaction condition is: 93 ℃ of sex change 45sec, and 36 ℃ of renaturation 46sec, 70 ℃ are extended 90sec, through 3 circulations, carry out 25 circulations by following condition then: 93 ℃ of sex change 45sec, 51 ℃ of renaturation 45sec, 70 ℃ are extended 90sec, amplify required dna fragmentation.Separate the PCR product with 10% polyacrylamide gel, and from the gel electrophoresis band, reclaim the fragment of about 130bp.Behind BamH I/EcoR I double digestion, and be connected through the M13BM21 of corresponding double digestion carrier, and with CaCl 2Method transformed into escherichia coli DH5 α F '.With transformant on the semisolid medium that contains IPTG, X-gal in 37 ° of incubated overnight, the colourless plaque of picking, and extracting single stranded DNA.Use dideoxy method (Sanger F.et al., Proc.Natl.Acad.Sci.74:5463,1977) to measure dna sequence dna then, and the screening clone consistent with design.The nucleotide sequence of cecropin B N-17 gene is shown in sequence numbering in the sequence table 5.Embodiment 4: the cecropin B gene (CB-m of modification 1And CB-m 2) preparation
Present embodiment is described the modification to original design synthetic antibacterial peptide cecropin B (Cecropin B) gene (Xie Yi etc., biotechnology journal 6:311-315,1990).Closely follow the codon of Val, Asn behind the initiator codon ATG of cecropin B gene.If begin to express from initiator codon, then product N end has more Met, Val and three amino-acid residues of Asn than natural cecropin B, and the vigor of antibacterial peptide is had influence; Secondly, behind 3 of cecropin B gene ' end Gly39 Val, Asn codon are also arranged, make its expression product C end in higher eucaryotic cells can't amidation, thereby make the reduction of antibacterial peptide vigor.At both of these case, we utilize round pcr that cecropin B gene has been carried out modifying and transform.The reorganization of gene operation for convenience, partly or entirely changed the restriction enzyme site at gene two ends, and at two ends 5 ' end of all adorned cecropin B gene inserts the ribosome bind site of plant, and behind its initial ATG, change the codon GCT or the CCA of plant-preference into, thereby obtain cecropin B (CB-m through modifying 1And CB-m 2) dna sequence dna.
Encoding sequence for CB-M2, at first extracting contains the M13BM19 phage single-chain DNA of cecropin B gene as template, with synthetic oligonucleotide 5 ' ATGGATCCATGCCAAAATGGAAAGTTTTCAAG 3 ' and 5 ' GAGAATTCTTACTAACCAAGAGCTTTAGCTTCACC 3 ' is that PCR reaction primer carries out sequence amplification, used reaction conditions is: 93 ℃ of sex change 60sec, 40 ℃ of renaturation 60sec, 70 ℃ are extended 60sec, carry out 10 circulations altogether; Press 93 ℃ of sex change 60sec then, 50 ℃ of renaturation 60sec, 70 ℃ of orders of extending 60sec are carried out 25 circulations.Gained PCR product presents single band on 10% polyacrylamide gel electrophoresis.Behind BamH I/EcoR I double digestion, and be connected through the M13BM21 of corresponding double digestion carrier, and with CaCl 2Method transformed into escherichia coli DH5 α F '.With transformant on the semisolid medium that contains IPTG, X-gal in 37 incubated overnight, the colourless plaque of picking, and extracting single stranded DNA.Use dideoxy method (Sanger F.et al., Proc.Natl.Acad.Sci.74:5463,1977) to measure dna sequence dna then, and screen the required modified CB-m that contains 1And CB-m 2The clone of gene.CB-m 1And CB-m 2The nucleotide sequence of gene is shown in sequence numbering in the sequence table 6.Embodiment 5: the design of antibacterial peptide Shiva A gene, synthetic and clone
Present embodiment is described the design of antibacterial peptide Shiva A gene, synthetic and clone.
Present embodiment adopts codon (Murray E.E.et al, Nucleic AcidsRes., 17:477-498,1989 of plant-preference; CampbeH-Anolles G.﹠amp; Gowri G., Plant Physiol., 92:1-11,1990) 38 amino acid whose sign indicating numbers of reading of design Shiva A.Add the Omega sequence (60bp) that the tool enhancing gene is expressed before it, and introduce the required restriction site of genetic manipulation respectively at 3 of 5 of Omega sequence ' end and Shiva A encoding sequence ' end in plant, the length of gained gene construct is 253bp.For making things convenient for the synthetic and splicing of fragment, under being divided into, whole gene shows 16 the fragment S1-S16 of complementary that are overlapping, and synthetic with dna synthesizer respectively.S-1：5’GTCGACGTCTAGAGGATCCCTGCAGTATTTT?3’(31mer)?S-2：3’CAGCTGCAGATCTCCTA?5’(17mer)?S-3：5’TACAACAATTACAAACAACAACAAACAACAAAC?3’(33mer)?S-4：3’GGGACGTCATAAAAATGTTGTTAATGTTT?5’(29mer)?S-5：5’AACATTACAATTACTATTTCAACAACAATGGC3’(32mer)?S-6：3’GTTGTTGTTTGTTGTTTGTTGTAATGTTAATGA?5’(33mer)?S-7：5’TAGGTGGAGGTTGTTCAGAAGGATTGAC?3’(28mer)?S-8：3’TAAAGTTGTTGTTACCGATCCACCTCCAACAA?5’(32mer)?S-9：5’AGGGTTGGTAAGCAGATCAAGCAAGGAATCCTT?3’(33mer)S-10：3’GTCTTCCTAACTGTCCCAACCATTCGTCTAG?5’(31mer)S-11：5’AGAGCTGGACCAGCTATCGCTCTTGTGGG?3’(29mer)S-12：3’TTCGTTCCTTAGGAATCTCGACCTGGTCGA?5’(30mer)S-13：5’AGATGCTAGGGCTGTGGGTTAATAGGGTAC?3’(30mer)S-14：3’TAGCGAGAACACCCTCTACGATCCCGACACCCA?5’(33mer)S-15：5’CGAATTCAGATCTAAGCTT?3’(19mer)S-16：3’ATTATCCCATGGCTTAAGTCTAGATTCGAA?5’(30mer)
16 oligonucleotide fragments of synthetic under excessive ATP condition, are added the T4 polynueleotide kinase and make it phosphorylation, and it is pressed equimolar amount mix.After annealing, add the T4 dna ligase and connect.Connect product and separate through 10% polyacrylamide gel electrophoresis, cutting-out contains the segmental gel in the 250bp left and right sides.The chopping back is in 0.1%SDS, 0.5M NH 4Ac, 10mM MgAc 237 ℃ of soaked overnight in the solution.Getting supernatant after centrifugal, as template, is primer with a, the p fragment of phosphorylation with sedimentary DNA, carries out pcr amplification.Amplification reaction condition is: 93 ℃ of sex change 45sec, and 36 ℃ of renaturation 46sec, 70 ℃ are extended 90sec, through 3 circulations, carry out 37 circulations by following condition then: 93 ℃ of sex change 45 sec, 51 ℃ of renaturation 45sec, 70 ℃ are extended 90sec, amplify required dna fragmentation.Separate the PCR product with 10% polyacrylamide gel, and from the gel electrophoresis band, reclaim the 250bp fragment.
M13BM20 (this research department preserve) carrier is cut with EcoR V enzyme, is mixed, add the T4 dna ligase, and the adding final concentration is that 15% PEG 6000,0.15M NaCl are with raising flush end joint efficiency with the dna fragmentation of above-mentioned recovery gained.Connect product transformed into escherichia coli DH5 α F (this research department preserves) with gained, will be on the semisolid medium that contains IPTG, X-gal by 37 ℃ of overnight incubation of cell transformed (Sambrook J.et al, Molecular cloning:A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, pp.1.76-1.81,1989).The colourless plaque of picking from the substratum.With extractive single stranded phage DNA is template, measures the sequence of gained DNA with Sequenase2.0 order-checking medicine box, and therefrom screens the clone consistent with design.The nucleotide sequence of ShivaA gene is shown in sequence numbering in the sequence table 7.
Express in Yeast system for making Shiva A gene, with the M13 single stranded DNA that contains Shiva A gene is template, react primer with synthetic oligonucleotide 5 ' GAGCTCTAGATAAAAGAATGGCTAGGTGGAGGTTGTTC3 ' and M13 forward sequencing primer as PCR, after amplification, remove the Omega sequence that is connected on the Shiva A encoding sequence, and before gene atg start codon ATG, introduce the recognition sequence of Xba I site and yeast KEX2 processive enzyme, obtain Shiva AY gene (sequence numbering 9).The gained gene is connected with the M13BM20 carrier after with suitable Restriction Enzyme cutting, transforms DH5 α-F ' bacterial strain with connecting product, chooses the spot order-checking contains the ShivaAY gene with screening clone from transform bacterium colony.Embodiment 6: the design of antibacterial peptide WHD gene, synthetic and clone
Present embodiment is described the design of WHD gene, synthetic and clone.Add initiator codon ATG at the N of WHD end, before and after initiator codon, add that respectively ACAACA and Ala codon GCT are to promote its expression in plant.In addition, add that before terminator codon Gly codon GGT is beneficial to the amidation of expression product.The entire structure gene is selected the codon of plant-preference for use.Add suitable restriction endonuclease sites at the gene two ends simultaneously so that operation.Be provided with the MscI/BalI site at the gene front end, so as to splicing Omega sequence.Be provided with the NaeI/NgoMI site in the antibacterial peptide nook, can be convenient to the corresponding fragment assembly of other antibacterial peptide with the research structure functional relationship.Be provided with the StuI site at the gene afterbody, so that the discriminating of this gene.The sequence of whole gene construct is shown in sequence table sequence numbering 8.Show 8 gene fragment W1-W8 under whole gene is divided into, with the dna synthesizer salvage it.Through 15% polyacrylamide sex change gel electrophoresis (Sambrook J.et al, Molecularcloning A Laboratory Manual, 2nd edition, Cold Spring Harbor LaboratoryPress, 1989) and silver staining (Caetano-Anolles G.﹠amp; Gresshoff P.M., PromegaNotes, 45:13-18,1994) identify the nucleotide sequence of institute's synthetic dna fragmentation.W1：5’GATCCACAACAATGGCCAAGTGGAAGTTGTTCAAGAA?3’(37mer)W2：3’GTGTTGTTACCGGTTCACCTTCAACAAGTTCTTTGAACTC?5’(40mer)W3：5’ACTTGAGAAGTTGGGAAGAAACCTTCGTAACGGTTTGC?3’(38mer)W4：3’TTCAACCCTTCTTTGGAAGCATTGCCAAACGAATTCCG?5’(38mer)W5：5’TTAAGGCCGGGCCAGCTATCGCCGTTCTTGGTGAGGCTA?3’(39mer)W6：3’GCCGGGTCGATAGCGGCAAGAACCACTCCGATTCCGGAA?5’(39mer)W7：5’AGGCCTTGGGGTTAATGAAGCTTAGATCTGAGCT?3’(33mer)W8：3’CCCAATTACTTCGAATCTAGAC?5’(22mer)
According to the splicing of the method described in the embodiment 3 fragment W1-W8, obtain the full length sequence of the WHD gene shown in sequence numbering in the sequence table 8.
Cut pGEM-3Zf (+) carrier (Promega) with BamH I and Sac I enzyme respectively, be connected with the gene fragment that salvage and splicing are good, and connect product Transformed E .coliJM109 (Promega) competent cell with gained.The white recon of screening on the IPTG/X-gal flat board, and therefrom carry out enzyme behind the extracting plasmid and cut evaluation.Preparation recon single stranded DNA is also as sequencing template from the M13K07 helper phage, the working instructions of the dna sequencing kit of producing according to USB company are with dideoxy method (the Sanger F.et al. that checks order, Proc.Natl.Acad.Sci.74:5463,1977), therefrom filter out 2 have expected sequence the clone.Embodiment 7: the expression of antibacterial peptide Shiva A gene in prokaryotic organism
Present embodiment illustrates the expression of antibacterial peptide Shiva A gene in the prokaryotic cell prokaryocyte intestinal bacteria.
(the Sambrook J.et al of molecular cloning method at first routinely, Molecular cloning:ALaboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, pp.1.76-1.81,1989), cut by Xba I enzyme that Shiva A is directly linked with pl is after the SD sequence on the expression vector of promotor, to connect product and be converted among the host e. coli E.coli K802, and make it at 30 ℃ of Rich substratum (10g peptones, the 5g yeast extract, 5gNaCl, 2g glucose, 100 μ g penbritins) growth in.Through centrifugal collection bacterium behind 42 ℃ of inducing culture different times.(pH7.4) washes cell with the 10mM phosphate buffered saline buffer, surveys bacterium liquid turbidity at 620nm, and with 0.1 OD 620Bacterial suspension 10 μ l bed boards.30 ℃ of cultivations are observed bacterium colony and are formed quantity.Cultivate and do not see have bacterium colony to form in 2 days yet, prompting is directly expressed has lethal effect to the host bacterium.Supposition may be the inclusion body that Shiva A does not form non-activity, and activated antibacterial peptide may cause the host bacterium to commit suiside in the born of the same parents.
In order to overcome this suicide consequence, made up with the same maltose binding protein of Shiva A (MAL) amalgamation and expression or with the expression vector of the multienzyme joint sequence amalgamation and expression of pUC.Sequence numbering 10 shows Shiva A gene order being connected with fusion expression vector with 11.Before Shiva A encoding gene the Omega sequence being arranged, is ACAACA before the initiation codon, promotes the expression of this gene in plant after these regulating and controlling sequences all will help.Extract plasmid pMAL-Shiva A and pUC21-Shiva A, and carry out BamH I respectively, Hind III enzyme is cut and Hind III, EcoR I and Xba I enzyme cut, identify through polyacrylamide gel electrophoresis (PAGE) then, to prove the exactness of this construct.Transform host e. coli E.coli TB1 and DH5 α F ' with pMAL-Shiva A that makes up as stated above and pUC-Shiva A fusion expression vector respectively, 37 ℃ of cultivations, and induce with IPTG.Thalline with ultrasonic disruption after, 4 ℃ of centrifugal 30min of following 10000rpm, with remove the precipitation and the extracting supernatant in fusion rotein.
With the fusion rotein that the separation and purification of amylose starch affinity chromatography is expressed by pMAL-Shiva A amalgamation and expression system, its operation is as follows:
(1) the 5g amylose starch is dissolved in the 20ml water, puts 50 ℃ of water-baths, and after adding the 5N sodium hydroxide (NaOH) of 30ml, add 15ml Epicholorohydrin (epichlorohydrin) while stirring, make gained solution be solidified into glue behind the placement 10min under the room temperature.Continue to place 45min under the room temperature, after washing, change this jelly in homogenizer homogenate.Then homogenate is suspended in 500ml, 50mM glycine-HCl, 0.5MNaCl (pH2.0) damping fluid.It is inferior to repeat to give a baby a bath on the third day after its birth with above-mentioned damping fluid behind the particles settling, starch granules is suspended in the 150ml post damping fluid (10mM phosphoric acid, 1mMazide, 10mM mercaptoethanol, 1mM EDTA) again, adorn post after bleeding, and wash post with the post damping fluid/0.25%Tween-20 of three times of column volumes.
(2) fusion protein sample is gone up sample with after 5 times of the post damping fluids/0.25%Tween-20 dilution, and washes post with post damping fluid/0.25%Tween-20 and the post damping fluid that contains 1mM maltose successively, and fraction collection it.
With CM-Sepharose ion exchange chromatography separation and purification pUC-Shiva A fusion rotein.Isolated fusion protein is dialysed to phosphate buffered saline buffer (pH7.4) with 70% formic acid and CNBr room temperature cracking 12h.Dialyzed sample is active with aforementioned inhibition zone test and anti-microbial activity electrophoretic method detection of biological, finds no matter be that the polypeptide expressed product all demonstrates corresponding fungicidal activity in the born of the same parents or in the pericentral siphon.This fact shows add the fungicidal activity that Ala (the 2nd) helps keeping antibacterial peptide in expression product, also illustrates simultaneously by recombinant vectors pMAL-Shiva A can avoid host cell suicide phenomenon with the Shiva A of fusion protein form expression.Embodiment 8: the expression of antibacterial peptide in silkworm cultured cell
(Bombyx mori nuclearpolyhedrosis virus BmNPV) as the carrier of expression alien gene, expresses the method for antibacterial peptide Shiva A in silkworm cultured cell with Bombyx mori nuclear polyhydrosis virus in the present embodiment description.
The BmNPV virus strain C-6 that uses in the experiment is provided by Inst. of Silkworm, Chinese Academy of Agricultural Sciences, and bombyx mori cell strain Bm-n is by the Canadian Calgary Doefier of university professor Hui Zeng, and vector plasmid pBM030 is so kind as to give by preceding doctor Tian Jin of Japan.The preparation of viral DNA and cell cultures are according to method (the A Manual of Methods for Baculovirus:Vector and Insect Cell Culture Procedures of Summes M.D. and Smith G.E., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1986) carry out.The extracting of plasmid is pressed people's (Mloecular cloning A Laboratory Manual, 2nd edition, Cold Spring HarborLaboratory Press) such as Sambrook J. a large amount of extraction process of alkalescence and is finished.
For ease of the expression of Shiva A gene in silkworm cultured cell, at first gene has been carried out suitable modification with PCR method.The primer that uses in the PCR reaction is the universal primer 2:5 ' CGACGTTGTAAAAGACGGC3 ' of Oligonucleolide primers 1:5 ' ACATGGTGGTTC 3 ' and band multienzyme joint sequence.Wherein primer 1 is crossed over 5 ' end initiator codon ATG of Shiva A gene.A of deletion deletes GCT behind the ATG before ATG, promptly removes an Ala codon.Singly connecting DNA with the M13BM20 phage that is connected with Shiva A gene in the EcoRV site is template, carries out the polymerase chain reaction.Through the fragment of low melting-point agarose gel electrophoresis about 140bp of separation length from the PCR product,, and cut with EcoR I enzyme and to obtain an end its end-filling with the Klenow enzyme for the tack the other end is the fragment of sticky end, be connected to then on the plasmid vector pUC19.Obtain containing the pUS-1 plasmid of Shiva A gene from the gained recombinant vectors behind the screening positive clone, double-stranded this gene order of order-checking conclusive evidence is correct, thereby finishes the modification (Fig. 3) to Shiva A gene.
The building process of metastasis transplanting physique grain pBM-S1 as shown in Figure 4.At first from pUS-1, downcut the Shiva A gene fragment that two ends are sticky end with EcoR I and BamH I.Carrier pBM030 with behind EcoR I and the Bgl II double digestion, is connected with Shiva A gene through as above cutting, obtains carrying the recombinant vectors of Shiva A gene.Restriction enzyme mapping identify to insert the recombinant clone of Shiva A gene, is built into the pBM-S1 transfer vector, proves the flanking sequence of the polyhedron gene that its Shiva A gene both sides are BmNPV and in the right direction.Make the corresponding sequence among this sequence and the wild-type BmNPV carry out homologous recombination, thereby antibacterial peptide Shiva A gene is imported in the BmNPV genome.With pBM-S1 metastasis transplanting physique grain and wild-type BmNPV cotransfection Bm-n cell, homologous recombination in cell, obtained having the recombinant virus BmNPV-S1 of Shiva A gene.
Use the dna sequence dna of EcoR I and Pst I double digestion wild-type BmNPV and recombinant virus BmNPV-S1 respectively, through polyacrylamide gel electrophoresis and Southern hybridization, the Shiva A gene size that 103bp fragment that is cut out in the demonstration recombinant virus and metastasis transplanting physique grain cut out is identical, and confirms that further Shiva A gene is inserted in the viral genome.
Carry out cotransfection as follows: with 2 * 10 6Individual Bm-n cell inoculation is inhaled behind 37 ℃ of insulation 2h and is removed nutrient solution in the 60mm culture dish, and it is inferior to give a baby a bath on the third day after its birth with the substratum that does not contain foetal calf serum (FBS), and adding 3ml does not have the FBS substratum.Add BmNPVDNA 2 μ g in the Eppendorf pipe successively, recombinant transfer plasmid 1 μ g supplies 50 μ l with the sterilization redistilled water, adds liposome transfection damping fluid 50 μ l again.Behind mixing and the static 15min, above-mentioned mixed solution is splashed into while shaking in the culture dish gently, 27 ℃ are continued to cultivate 4h, add above-mentioned substratum and 600 μ lFBS that 3ml contains FBS at last, and 27 ℃ of constant temperature culture promptly can be observed polyhedron in 4 days.From culture dish, collect supernatant liquor, be used for following plaque select.
The screening of recombinant virus is carried out as follows: inoculate 2 * 10 in the 25mm culture dish 6Individual Bm-n cell.Add the virus (10 that 1ml contains different dilution cotransfections behind the 2h 3PFU) nutrient solution.After continuing insulation 1h, inhale and remove transfection liquid, to wherein adding isopyknic 1% low melting-point agarose gel and 2 * TC100 composition mixed solution 2ml.Cultivate after 3-4 days, under inverted microscope, choose the plaque that contains recombinant virus for 27 ℃.So repeat screening (Chu Ruiyin etc., Acta Biochimica et Biophysica Sinica 22:385-389,1990), obtain the simple polyhedrosis recombinant virus plaque that do not contain through 3-4 wheel.
With 1 * 10 of the purifying that obtains as stated above 7PFU recombinant virus infection 1 * 10 6Individual Bm-n cell is cultivated after 4-5 days for 37 ℃ and is got the 1ml culture, through the centrifugal 10min of 5000rpm, gets the detection that supernatant directly carries out Shiva A expression product.The cell precipitation thing is washed 3 times with PBS (pH7.2), is dissolved in again then among the 50 μ l PBS.Behind the multigelation smudge cells, obtain supernatant liquor (Seyed E.﹠amp with the centrifugal 10min of 15000rpm; Nakhai B., Gene 91:135-138,1990), and detect as stated above.Analyze the intravital antibacterial peptide activity of silkworm cultured cell, cell culture fluid and silkworm (Tu Y.Z.et al., Science in China32:1072-1081,1989) that BmNPV-S1 infects with Mlc liquid phase assay method; And detect its immunocompetence with ECL spot hybridization (referring to the Amersham operational manual).The result detects the expression of Shiva A in silkworm cultured cell, but not as in the silkworm body of living, injecting the expression level of recombinant virus BmNPV-S1.Embodiment 9: carry the recombinant vectors of antibacterial peptide gene and the structure of plant expression vector
Present embodiment is described the structure of the expression vector of antibacterial peptide gene.
The equimolecular clone operations is reclaimed, connected to DNA separation in the present embodiment, purifying, enzymolysis, fragment all by people's such as Sambrook J method (Molecular cloning:A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, 1989) carry out.Intestinal bacteria are cultivated at liquid or agar solidified LB or 2YT (Sambrook J.et al, document is the same) in the substratum, Agrobacterium (Agrobacterium tumefaciens and A.rhizogenes) is cultivated at MG/L substratum (An G, Plant Physiol.81:86-91,1986) in, and the recombinant plasmid that obtains among the embodiment 3-6 is changed in the Agrobacterium with three close method of joining (VanHaute E et al, EMBO J.2:411-417,1983).Wherein utilize and carry plasmid GJ23 (Van Haute E.et al, EMBO J.2:411-417,1983) or the intestinal bacteria of RK2013 or RK2073 (Ditta G et al, Proc.Natl.Acad.Sci.USA 77:7347-7351,1980) as three close bonded supplementary strains.
1. carry the structure of the recombinant vectors of cecropin B gene
(1) structure of integrating vector pBZ863
At first with the rf double-stranded DNA of the two enzymic digestions of restriction enzyme Bgl II and BamH I by the recombinant phage that carries cecropin B of the foregoing description 5 described methods preparations, isolate the dna fragmentation of cecropin B (the being called for short the C gene) gene that is about 243bp, and with its plasmid pBZ742m (Zhu Qun etc. that recombinate, Botany Gazette 31:581-589,1989) in the BamH I site.The pBZ742m plasmid has from 1 of the TR-DNA district mannopine synthetic enzyme of octopine type Ti-plasmids ' and bidirectional promoter of 2 ' gene (being called for short Pmas).The BamH I end that C gene 5 ' end Bgl II sticky end is compatible with Pmas 3 ' end is connected, and gene is under the promoter regulation of 2 ' gene.This recombinant plasmid is named into pBZ8127 (Fig. 5).C gene 3 in pBZ8127 ' place, end BamH I point of contact inserts rouge alkali synthetase gene terminator (be called for short nosT, it is a BamH I fragment that derives from about 300bp of pBZ811 plasmid).Behind Kpn I enzymolysis, select and obtain the correct recombinant plasmid pBZ8128 (Fig. 5) of nosT closure.
Because having the pBZ8128 of chimeric C gene has and pBR322 plasmid homologous replicon, so in carrying out three parent's joint experiments, the uncompatibility plasmid pGJ28 and pR64drd11 (the Van Haute E.et al that utilize intestinal bacteria GJ23 to carry, EMBO J.2:411-417,1983) mobilization and forwarding function, the pBZ8128 plasmid is shifted among the agrobacterium strains C58C1 (pGV3850) (Zambryski P.et al, EMBO J2:2143-2150,1983).By recombinating in the cell, make chimeric C gene integration advance Agrobacterium disappearance the T-DNA district of the Ti-plasmids pGV3850 of oncogene (Zambryski P.et al, EMBO J.2:2143-2150,1983), obtain integrated genophore pBZ863 (Fig. 5).(2) structure of two plasmid gene carrier pBT567
DNA with EcoRI and BamHI double digestion digested plasmid pBZ8127 (Fig. 5), separate the Pmas-C fragment that is about 740bp, mending flat terminal back reorganization with the Klenow enzyme advances through Hind III and the two linear and terminal quilts of enzymic digestion of Bgk II to mend flat pGA643 plasmid (An G.etal. equally, Plant Molecular Biology Manual, pp.A3/1-A3/19, Kluwer AcademicPublishers, Dordrecht, 1991) in, obtain carrier pBT567 (Fig. 6).Cecropin B gene is under the regulation and control of CaMV 35S RNA promotor (being called for short P35S) and Pmas in this carrier.And gene 3 ' end has connected from Agrobacterium Ti-plasmids 7 ' terminator opposite with the both direction of 5 ' gene and (has been called for short 7 ' 5 ' T).Engage by three parents, plasmid pBT567 is shifted among the Agrobacterium LBA4404 (Ooms G.et al, Plant Mol.Biol.1:265-276,1982) and EHA101 (Hood E.E.et al, J.Bact.168:1291-1301,1986) that has into lacked T-DNA.(3) carry the carrier pBS221d of cecropin B gene of two polyphone copies and the structure of pBS229d
Extracting carries the RF type DNA of the phage M13mp19 of the C gene copy that the synthetic total length is 270bp two polyphones (being called for short 2C).With BamH I and Bgl II double digestion, therefrom separate the 2C gene and the plasmid pBZ742m that recombinates in the BamHI site in 2 ' promotor downstream of Pmas, obtain recombinant plasmid pBS22c (Fig. 7).
Plasmid pBS22c with EcoR I digestion as above makes will cut with BamH I enzyme behind the end-filling, to reclaim the Pmas-2C fragment.Intermediate carrier pROK2 (Jefferson R.A., Plant Mol.Biol.Rep.5:387-405,1987) be have one can substituted P35S promotor and be connected on plant expression vector pBIN19 (the Bevan M of the nosT terminator in downstream, Nucl.Acids Res.12:8711-8721,1984).Cut pROK2 with Hind III enzyme, will cut with BamH I enzyme again behind the end-filling, remove cut P35S fragment.Replace the P35S fragment that is cut off with the Pmas-2C fragment, obtain recombinant vectors pBS221d (Fig. 7).And it is changed in the Agrobacterium LBA4404 bacterial strain.
With Hpa I and Bgl II digested vector pGA643, obtain an end and be sticking terminal linear carrier for the tack the other end.With this linear carrier and above-mentioned recovery also be an end for the tack the other end for sticking terminal Pmas-2C fragment is connected, obtain recombinant plasmid pBS 229d (Fig. 7).At last pBS229d is changed among Agrobacterium strain EHA101 and the ASE-1 (Hood E.E.et al, J.Bact.168:1291-1301,1986).2. the structure of antibacterial peptide Shiva A genophore
The long 186bp of being of synthetic ShivaA gene (being called for short Sh), it comprises that the DNA chain of 38 amino acid whose codons of a coding and the leader sequence of the 60bp of the tobacco mosaic virus (TMV) that is positioned at the encoding sequence upstream are the rrna binding sequence of Ω sequence and 6bp, and the terminator codon of two polyphones is arranged at its 3 ' end.With the complete gene recombination that so obtains in phage M13BM21.At first use the replicative DNA of the two above-mentioned phages of enzymic digestion of BamH I and EcoR I, therefrom separate Shiva A gene, then it is cloned among the escherichia coli vector pBluescript SK, obtain recombinant plasmid pBSSK-Shiva A (Fig. 8).
(1) structure of carrier pTYB1
From the pBSSK-Shiva A plasmid that obtains as stated above, cut the BamH I-Hind III fragment that contains Shiva A gene, among the pBZ742m that recombinates then, Shiva A gene is connected with 2 ' promotor of Pmas.The plasmid that is obtained is named into pMPSh (Fig. 8).Plasmid pGIT (the Bai Yongyan etc. that contain the terminator (being called for short 35ST) of a CaMV 35S RNA with Kpn I and the two enzymic digestions of HindIII, do not deliver), separate obtaining the 35ST of 0.35kb, and be inserted into the corresponding restriction enzyme site of pMPSh, obtain naming recombinant plasmid (Fig. 8) into pTB30.With the two plasmid expression vector pGA471 of the two enzymic digestions of EcoR I and Hind III (An G.et al, EMBO J.4:277-284,1985), obtain two dna fragmentations of 6kb and 10kb, and therefrom reclaim the 10kb fragment.With this fragment with behind same two enzymic digestion pTB30, separate the about 1kb Shiva A gene that obtains and be connected, obtain carrier pTYB1 (Fig. 8).PTYB1 engages through three parents and is changed over to agrobacterium strains A208SE (Roger S.G.et al, Methods in Enzymology, Vol 153:253-277,1987), LBA9402 (Hanischten Cate C.H et al., Plant Mol.Biol.14:735-741,1990) and among the EHA101.
The bacillus coli DH 5 alpha of the above-mentioned pTYBl of containing recombinant plasmid is by the regulation that is used for patented procedure microbial preservation budapest treaty, be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center January 10 nineteen ninety-five, preserving number is CGMCC No.0249.
(2) structure of carrier pTBM20
Digest above-mentioned pMPSh plasmid with EcoR I, and mend the sticky end of flat gained digestion product with the Klenow enzyme.Use Kpn I enzymolysis then, separate the dna fragmentation of about 0.7kb, and recombinate to and use in the pGA643 plasmid of Hpa I and Kpn I double enzymolysis, obtain plasmid pTBM20 (Fig. 8).At last pTBM20 is mobilized and transfer among agrobacterium strains ASE1, LBA9402 and the A4CRS.
(3) structure of carrier pBC174
The inventor had once made up an intermediate carrier pBC2 who has the CaMV 35S promoter (being called for short P2e35S) and the nosT terminator of two enhansers and contain multiple clone site in the centre in the past.Earlier with Xba I enzymolysis pBC2, use Bgl II enzymolysis again after mending flat end, obtain an end and be sticking terminal linear carrier for the flat terminal the other end.Cut aforementioned plasmid pBSSK-Shiva A with EcoR I enzyme, cut with BamH I enzyme again after mending flat end, the Shiva A gene fragment that obtains is connected with ready carrier segments, obtain to have the recombinant plasmid pBC21 (Fig. 9) of chimeric Shiva A gene.Use the two enzymic digestion pBC21 of EcoR I and Hind III then, obtain the chimeric Shiva A gene of 1.2kb, and,, obtain plasmid pBC174 (Fig. 9) to replace 6kb fragment wherein with among its carrier pGA471 that recombinates.The characteristics of this recombinant plasmid are that used 35S promoter has the enhanser that doubles.Through three parent's combinations plasmid pBC174 is changed among agrobacterium strains A208 SE and the A4CRS.
(4) carrier pTYB3, the structure of pTYB3A and pTYB3B
Present embodiment has further made up two cecropin gene C B-m through modifying 1And CB-m 2Expression vector.Both difference are CB-m 2Codon ATG after by CB-m 1-GCT-changes into-CCA-.The carrier of these two genes that we make up has similar structure, (Pmas and P35S fusion form, and see Comai L.et al, PlantMol.Biol.15:373-381 all to utilize a very strong promoter, fusion Pmac, 1990), to improve the level of genetic expression.
From having CB-m 1Phage M13BM 21 in isolate the BamH I-EcoR I fragment of about 150bp, with its into corresponding restriction enzyme site of plasmid pUC19 of recombinating, obtain plasmid pUC-mC.Use the two enzymic digestion pUC-CB-m of restriction enzyme Pst I and EcoR I again 1Cut out CB-m 1Gene, and,, obtain recombinant plasmid pTYB88 (Figure 10) to replace original 1.9kb fragment with among its plasmid pKIWI10 that recombinates (Comai L.et al, Plant Mol.Biol.15:373-381,1990).With Xho I enzymolysis pTYB88, obtain by Pmac promotor, CB-m 1Gene and the mosaic gene of forming from the terminator (ocsT) of the octopine synthase gene of Ti-plasmids (3.5kb).This gene integration is entered the Sal I point of contact of carrier pBIN19, obtain plasmid pTYB3 (Figure 10).At last the pTYB3 carrier is transferred among the agrobacterium strains EHA105 (Li X.Q.et al, Plant Mol.Biol.20:1037-1048,1992).
With CB-m 2Gene changes from phage is cloned into the pUC19 plasmid, obtains pUC-CB-m 2Use Sal I and EcoR I double enzymolysis pUC-CB-m again 2, and the CB-m that will therefrom cut out 2Insert in pKIWI 101 plasmids,, obtain recombinant plasmid pTYB818 (Figure 11) to replace the Sal I-EcoR I fragment of original 1.9kb.Behind Xho I digested plasmid pTYB818, isolate the mosaic gene of 3.5kb, and be integrated in the pBIN400 carrier, obtain gene integration direction opposite two plasmid vector pTYB 3A and pTYB 3B (Figure 11) at last and transfer among the Agrobacterium strain A208SE.3. bivalent gene carrier pTYB2, the structure of pTYB4A and pTYB4B
Preliminary study result shows, two assortments of genes of antibacterial peptide cecropin B and Shiva A are in the same place, and might further improve the ability that transgenic plant are resisted germ.For this reason, the present invention has made up three expression vector pTYB2, pTYB4A and pTYB4B that carry two valency antibacterial peptide genes.Common ground between them is that a Shiva A gene is all arranged, and different be that the pTYB2 carrier has the C gene, pTYB4A and pTYB4B carrier then carry CB-m 2Gene.Both differences of back are wherein CB-m 2The integration direction of gene is opposite.
(1) structure of carrier pTYB2
From plasmid pBZ8127, separate 760bp and contain the EcoR I-BamH I fragment of Pmas-C,, obtain plasmid pTMC1 this fragment into pTZ18R that recombinates.With BamH I and the two enzymic digestion plasmid pTRA151 (Zheng Z.W.et al, Plant Physiol.97:832-835,1991) of Hind III, separate the terminator tmlT that obtains from the tml gene of Ti-plasmids.Downstream with tml T splicing C gene in pTMC1 is built into complete mosaic gene, and the gained plasmid is named into pMCL (Figure 12).Isolate a 1kb fragment that comprises complete C mosaic gene with EcoRI enzymolysis pMCL.This fragment is recombined to the EcoR I site of carrier pTYB1.From more than 100 recon of being identified, select pTYB2 carrier (Figure 12), change among agrobacterium strains A208SE, LBA4404, EHA101 and the R1240 (White F.F.et al, J.Bacteriol.164:33-44,1985).
(2) structure of carrier pTYB4A and pTYB4B
PTYB818 obtains CB-m from plasmid 2The XhoI fragment of gene with recombinating behind its end-filling on the EcoR I site with same restriction enzyme digestion pTYB1 and the flat end of benefit, obtains CB-m 2Two valency carrier pTYB4A and pTYB4B (Figure 13) with positive and negative both direction integration.At last they are changed among the Agrobacterium A208SE.4. the structure of the antibacterial peptide gene expression vector of adjunction α-Dian Fenmei signal peptide sequence
Potato bacterial wilt is a kind of vascular bundle diseases, and thalline is by wound invaded plants tissue back a large amount of breedings and obstruction vascular bundle in vascular bundle, and the secretion toxic substance finally causes the sudden death of plant.The purpose of this research is to make one outer derived antimicrobial peptide be able to excretory signal peptide sequence and antibacterial peptide CB-m 2Gene or Shiva A gene connect into mosaic gene, to promote the secretion of antibacterial peptide, stop Ralstonia solanacearum to be bred in vascular bundle, in the hope of reaching the ability that improves the potato resistance to bacterial wilt.
(1) carries CB-m 2The structure of the expression vector pSMC of gene and αDian Fenmei signal peptide sequence (SP)
With having CB-m 2The M13 phage transfection Escherichia coli XL1-blue of gene therefrom extracts double-stranded DNA, reclaims CB-m with EcoR I and BamH I double digestion rear electrophoresis 2Gene fragment, and be cloned on the pUC19, plasmid pCE (Figure 14) obtained.
The pSR1-3 plasmid (being provided by the Dr.Klaus During of Hamburg, Germany university) of αDian Fenmei signal peptide sequence is provided in extraction, cut the gained plasmid DNA with Nco I enzyme, behind phenol-chloroform extracting, ethanol sedimentation, dry and flat terminal in the Eppendorf pipe with Klenow enzyme benefit, and then phenol-chloroform extracting, ethanol sedimentation, with BamH I enzyme cut spend the night after, electrophoresis reclaims αDian Fenmei signal peptide sequence wherein.
With Hinc II and the above-mentioned C-m that carries of BamHI double digestion 2The pCE of encoding sequence is connected the back with connecting product transformed into escherichia coli XL1-blue with the αDian Fenmei signal peptide sequence that reclaims.From by the single clone of picking the transformant, and after extracting plasmid, enzyme is cut and is checked the screening recon, and with its called after pSC (Figure 14).
PT Ω 4A (being provided by the Guo Sandui researcher of Biological Technology Research Center, Chinese Academy of Agricultural Sciences) contains two CaMV 35S enhansers, a 35S promoter, Ω sequence, Ploy A, nosT and a polyclone restriction enzyme site.The clone there is SP-CB-m 2PSC cut with EcoR I enzyme, cut with Pst I enzyme again behind the end-filling, electrophoresis reclaims SP-CB-m 2Fragment also is cloned into it between Pst I and Hpa I site of pT Ω 4A, obtains pTSC.Also incite somebody to action the not CB-m of band signal peptide sequence simultaneously 2Be cloned on the pT Ω 4A, obtain pTC (in contrast).Use EcoR I and Hind III double digestion pTSC and pTC respectively, be cloned between the EcoR I and Hind III site of plant expression vector pBI121, obtain pSMC and pMC (Figure 14) respectively, and change in the agrobacterium tumefaciens lba4404 with freeze-thaw method.
(2) have the structure of Shiva A expression carrier pSSA
For ease of being connected of Shiva A gene and αDian Fenmei signal peptide sequence, PCR primer 1:5 ' GAGGATCCATGGCTAGGTGGAGGTTGTTCAG 3 ' and primer 2: 5 ' GCCAGGGTTTTTCCCAGTCACGA 3 ' have been synthesized in design, being BamH I site with 5 of Shiva A gene ' terminal modified.The PCR reaction conditions is 94 ℃, 1min; 53 ℃, 1min; 72 ℃, 1min carries out 35 circulations altogether.Through electrophoresis detection, the clip size of amplification is correct.With reactant with phenol-chloroform extracting, behind the ethanol sedimentation, with EcoR I and BamH I double digestion, and with gained EcoR I/BamH I fragment cloning to the pUC19 carrier, then and carry out sequencing.With Pst I and BamH I double digestion pSC, gained Pst I/BamH I fragment is connected to the upstream of Shiva A gene, obtain pSS.The pSS that the clone is had a SP-ShivaA cuts, mends flat terminal with the EcoRI enzyme, cut with Pst I enzyme again, cuts the product recovery SP-Shiva A fragment and is cloned between the PstI and Hpa I site of pT Ω 4A from enzyme, obtains pTSS (Figure 14).With EcoR I and Hind III double digestion pTSS, and with gained EcoR I/Hird III fragment cloning to equally between the EcoR I and Hind III site of the plant expression vector pBI121 that cuts of enzyme, obtain pSSA (Figure 14), this recombinant plasmid is changed in the agrobacterium tumefaciens lba4404 with freeze-thaw method.Embodiment 10: the importing of potato genetic transformation and antibacterial peptide gene
Present embodiment is described the foundation of potato genetic conversion system and antibacterial peptide gene is imported method in the potato.
(1) preparation of vegetable material and Agrobacterium
Be used for that the potato kind of genetic transformation or strain comprise that rice draws, rich No. 1 of capital, No. 9, dam potato, river taro 56,802-552,74-6-9 and Favorita.Adopt about 4 the week age potato set blade as genetically modified parent material.During the aseptic seedling successive propagation, cut terminal bud and the sections that has an axillalry bud, every month (Murashige T.﹠amp of the MS at no hormone; Skoog F., Physiol.Plant.15:473-497,1962) the last subculture of solid medium (MSO) is once.The sections that cuts is seeded in the 100ml triangular flask, puts illumination box (LH-200-RDSCT, Nippon Medical ﹠amp; ChemicalInstruments Co., Ltd) the interior cultivation, light intensity 8000-10000lux, the dark 10h of illumination 14h/, culture temperature is 25/20 ± 1 ℃.Blade is grown up during 4 weeks, used as converting material.Use shown in the more following tabulation 2 of agrobacterium strains, plasmid and substratum thereof (pH7.0) in this experiment:
The bacterial strain that uses in table 2 potato transformation, plasmid and culture medium bacterial strain plasmid culture medium antibiotic (mn/L) A208SE pBT567 LB Kan10+Tc12.5A208SE pBC174 AgMN Kan25+Ch150+Tc12.5A208SE pTBM20 LB Kan25+Tc25+Chl25A208SE pTYB1 LB Kan30+Tc10A208SE pTYB2 LB Kan30+Tc10A208SE pTYB4A LB Kan50+Ch125+Tc10A208SE pTYB4B LB Kan50+Chl25+Tc10AgMN thereof: the minimum nutrient medium of Agrobacterium; Kan:kantlex; Tc:tsiklomitsin; Chl:paraxin
With 28 ℃ of agrobacterium tumefaciens or Agrobacterium rhizogenes of cultivating 2-3 days on the LB solid plate, suspend with the MSO liquid nutrient medium (pH5.5) that does not add hormone, make OD 600Reach about 0.2.Or with containing corresponding antibiotic LB liquid nutrient medium (pH7.0), 28 ℃, 250rpm shaking culture spend the night, the centrifugal 5min of 4000rpm, and the LB dilution with pH5.5 continues shaking culture 3-4h, to induce the activation of vir gene on the Agrobacterium Ti-plasmids.With the centrifugal 5min of 4000rpm, thalline is resuspended to OD with the MSO liquid nutrient medium of pH5.5 then 600≌ 0.2, is used to infect stem tuber sheet or leaf dish explant.
(2) explant is inoculated the common cultivation that reaches with Agrobacterium
Stem tuber is dipped in 10sec in 70% ethanol, takes out the back with chlorine bleach liquor's (containing reactive chlorine 0.8%) surface sterilization 20min of 1: 5, aseptic water washing 3-4 time is cut into the thin slice of thick 0.5 * 0.5 * 0.2cm of being of length and width.As leaf explant, cut a cutter with the 3-4 sheet true leaf at aseptic seedling top respectively at the petiole place and in the middle of the blade.The stem tuber sheet or the leaf dish that cut are dropped in the preprepared Agrobacterium bacterium liquid, shake frequently under the room temperature, make explant fully contact 3min with Agrobacterium.Take out explant and put on the filter paper and blot, change over to then on the MSO solid medium that the surface is covered with 1～2 metafiltration paper, in illumination box, cultivated altogether 4 days, the dark 10h of illumination every day 14h/, light intensity 3000lux, temperature is respectively 25 ℃/20 ℃ ± 1 ℃.
(3) cultivation of explant, selection and plant regeneration
Select to cultivate explant by the culturing step segmentation in the table 3, until forming Kan through cultivating 4 days altogether RRegeneration plant.
The cultivation of table 3 explant, selection and plant regeneration culturing step substratum * and microbiotic and Agrobacterium rhizogenes are cultivated MSO altogether
The leaf piece is induced hair-like MSO Kan 50 Cef200
Root segment evoked callus RCI Kan 50 Cef200
Callus differentiation bud D4 Kan 50 Cef200
Regeneration bud root induction MSO Kan 100 Cef200 and agrobacterium tumefaciens are cultivated MSO altogether
Leaf piece evoked callus D3 Kan 50 Cef 200
Callus differentiation bud D4 Kan 50 Cef 200
Regeneration bud root induction MSO Kan 100 Cef200*MSO:MS do not have hormone solid medium RCI:MS+2,4-D 0.12 mg/L+ZT 2mg/L+ sucrose 20g/L; D3:MS+GA 310mg/L+BA 2.25mg/L+NAA 0.2mg/l+ sucrose 30g/L; D4:MS+GA 310mg/L+BA 2.25mg/L+ sucrose 30g/L; Ceif: Reflin (Cefotaxime); Kan: kantlex (Kanamycin)
(4) importing of the optimization of potato genetic conversion system and antibacterial peptide gene
The stem tuber sheet or the leaf dish that draw with potato main breed rice are explant, after cultivating 2,4,6,8 days altogether respectively with the different strains of agrobacterium tumefaciens (A.tumefaciens) or Agrobacterium rhizogenes (A.rhizogenes) such as nopaline (Nopaline), octopine (Octopjne) and agropine (Agropine) type bacterial strain, 10 explants are got in each processing, make tissue slice in the wound infection position, the tissue chemical analysis that carries out GUS (beta-glucuronidase) then also adds up the area percentage (PATT%) of transient expression frequency (TTF%) and transforming tissue respectively.TTF% accounts for the percentage calculation of the explant sum that is detected by the explant number that has GUS to express, and PATT% calculates by the average percent that the transformant area accounts for the tissue slice total area.Determine best incubation time and agrobacterium strains altogether according to TTF and PATT value.
The method that antibacterial peptide gene imports potato is same as above substantially identical, and the different Agrobacteriums that are to use are carried antibacterial peptide gene.The comparative experiments result shows that the different agrobacterium tumefaciens bacterial strains of employing infect its transformation efficiency difference of leaf of potato piece gained, and wherein A208SE obviously is better than LAB4404.In addition, even use identical Agrobacterium, if but entrained plasmid is different or gene constructed method difference (forward or backwards), and its transformation frequency also has very big-difference.The transformation efficiency of gained is 14-34% in the present embodiment.(5) evaluation of transformant
Present embodiment is with Kan RDetection, GUS detect and Molecular Detection three class methods are identified the transgenic Rhizoma Solani tuber osi that aforesaid method obtains.
Carry out Kan RDuring detection, cut the leaf piece of transgenic potato plant, be placed on and cultivate 2-3 on the MS0 that contains Kan (100mg/L) or the D3 substratum after week, resistance leaf piece can or form callus at otch director root, and non-resistance leaf piece then can not long root or formed callus.
With histochemical method (Jefferson R.et al, EMBO J.6:3901-3907,1987) to Kan RPlant further carries out the detection that gus gene is expressed.Get root, stem, leaf and the stem tuber of resistant plant and thinly slice, 37 ℃ of incubated overnight in GUS enzyme substrates 5-bromo-4-chloro-3 indole glucosides (X-Gluc).Then material is taken out, fixedly more than the 1h, decolour step by step with 70%, 90%, 95% and 100% ethanol successively again with FAA solution (every 100ml stationary liquid contains 50% ethanol 85ml, Glacial acetic acid 5ml and formaldehyde 10ml).Section after the decolouring is changed in the distilled water, and microscopically is observed, and records stronger gus gene and expresses.The result shows that meristematic tissue and fibrovascular system express the strongest.
Carry out the active detection of GUS at R0 for the Kan resistant plant that 42 strains is changeed GUS/ cecropin B gene, 15 strains as a result are the GUS positive, account for Kan R35.7% of strain.Detect the R of results 1And R 2The stem tuber in generation, result and R 0In generation, is in full accord, shows that gus gene can stably be passed to the offspring by nourishing and generating.
The molecular detecting method of antibacterial peptide transgenic plant will elaborate among the embodiment 11 and 12 hereinafter.Embodiment 11: the Molecular Detection of transgenic Rhizoma Solani tuber osi
Present embodiment is described the molecular detecting method of transfer-gen plant in detail.Employed molecular assay method comprises DNA dot blot, Southern hybridization, PCR-order-checking, Northern hybridization and ECL dot blot.
Use the overall length antibacterial peptide gene as probe in DNA dot blot and the Southern hybrid method, press ordinary method (the Sambrook J.et al of molecular cloning, Molecular Cloning:ALaboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press) detect.
The method that application PCR-order-checking combines detects the synergy of external source antibacterial peptide gene of the present invention in transgenic Rhizoma Solani tuber osi.With identify through sick garden disease resisting effect preferably rice draw the transgenic line MC-20-6-7 of kind as experiment material.Get the total DNA of potato leaf extracting.With the total DNA of blade is template, and with synthetic oligonucleotide P1:5 ' GAAGCTTGGTTAACAAATGGAAAG-3 ', and P2:5 '-GGGATCCAGCTTTAGCTTCACCGACAG-3 ' is as primer, pcr amplification cecropin B gene.Amplification condition is 93 ℃, 90sec; 55 ℃, 45sec; 72 ℃, 75sec carries out 25 circulations altogether.
Separate the PCR reaction product through 2% agarose gel electrophoresis, behind electrophoresis, contain the segmental band of about 120bp from the gel cutting-out, change one in advance at bottom Zha Dong and be covered with in the 0.5ml Eppendorf pipe of bacterium filter membrane (aperture 0.3 μ m), put in the liquid nitrogen behind the quick-frozen 1min, in 4 ℃ with 12, the centrifugal 10min of 000rpm.Sample adds 2 times of volume dehydrated alcohols with deposit D NA after using phenol and chloroform purifying.
The single colony inoculation of XL-1 Blue is contained in the LB substratum of tsiklomitsin (10 μ g/ml) in 5ml, 37 ℃ of incubated overnight, again by dilution in 1: 100, enlarged culturing is to logarithmic phase, and presses MandelM.﹠amp; The described method CaCl of Higa A. (J.Mol.Biol.53:159-167,1970) 2Processing is with the preparation competent cell.
Reclaim PCR product and M13 mp18 carrier with BamH I and Hind III double digestion, add dna ligase, and, connect mixture transformed into escherichia coli XL-1 Blue competent cell with gained then in 21 ℃ of incubated overnight.With the bacterial cell and X-gal and the common bed board of IPTG that transform, 37 ℃ of incubated overnight are chosen colourless plaque and are extracted double-stranded DNA, carry out restriction endonuclease analysis, therefrom select two positive colonies.
With enzyme cut be accredited as male phage supernatant ehec infection XL-1 Blue and cultivate after, press the described method of people such as Sanger (J.Mol.Biol.162:129-138,1982) and extract single-stranded template DNA, measure its dna sequence dna with dideoxy method.The result shows two, and to cut the dna sequence dna and the intrinsic structural gene sequence that are accredited as male clone through enzyme in full accord, and confirm that further antibacterial peptide cecropin B gene has been incorporated in the genome of transgenic Rhizoma Solani tuber osi.Rice draws the transgenic line MC-20-6-7 of kind to nourish and generate for two generations, thereby institute's transgenosis energy stable delivery is described to the offspring, and finds no the rearrangement or the jumping phenomenon of gene order.
Northern detects and carries out as follows.
Be taken at top each 2g of 2-4 sheet leaf that eight transgenic Rhizoma Solani tuber osi strains such as MS1-1102-20-1, MS1-1120-14-3 that do very well, that be positive and MS1-X4 are and non-transgenic rice in contrast draws strain to be in the disease resistance evaluation of the sick garden in greenhouse and field in the PCR-dot hybridization, with micro-hot phenol method (Verwoerd T.C.et al, Nucleic Acids Res.17:2362,1989) therefrom extract total RNA, and carry out quantitatively with ultraviolet spectrophotometer.
RNA after the sex change (10 μ g) is added in electrophoresis on 2% sepharose that contains formaldehyde (2.2mM).After electrophoresis finishes, RNA is gone on the NC film from sepharose, dry NC film and prehybridization after, add probe through sex change, 42 ℃ of hybridization are spent the night.After hybridization is finished, under room temperature, wash film 3 times with 2 * SSC and 0.1%SDS, use 0.1 * SSC and 0.1%SDS to wash film 2 times again in 37 ℃, film is added intensifying screen in-70 ℃ of compressing tablet 48h (Sambrook J.et a1 after air-dry, Molecular Cloning:A Laboratory Manual, 2nd edition, Co1d Spring HarborLaboratory Press, 1989).The probe that uses is the plasmid EcoR I+BamH I double digestion that will contain cecropin B and Shiva A gene, carries out the probe of mark behind electrophoresis recovery, the purifying by Prime-a-genesystem.
In 8 strain systems of all detections, there are 6 strain systems to be positive.Wherein (MS1-1102-20-1 MS1-X4), illustrates that antibacterial peptide gene not only has been incorporated in the potato gene group, and has obtained expression at transcriptional level the signal of two strain systems by force.
On protein level to the detection of transfer-gen plant as described in the embodiment 12 hereinafter.Embodiment 12: behind screening method-SDS-urea boiling water bath of the transgenic plant of high sensitivity
The ECL dot blotting
Present embodiment is described the high responsive method that is used to screen transgenic plant, i.e. ECL dot blotting behind the SDS-urea boiling water bath for example.ECL (Enhanced chemiluminescence) method detects protein, more responsive more than normally used isotope detection method, but, thereby be not widely used in containing the detection of HRP plant sample as yet because ECL produces fluorescence-causing substance based on horseradish peroxidase (HRP) catalysis.The present invention replaces normally used sodium azide (NaN with sodium laurylsulfonate (SDS) and urea boiling water bath 3), so that the HRP inactivation.This method is highly sensitive, and can reduce the proteasome degradation in the plant sample preparation, can also the long period preserve sample.This ECL spot hybridization has also that amount of samples is few, the point sample number is many, does not need concentrated and purified processing and advantage such as quick and convenient, so can be widely used in the screening of various transgenic plant.
The method of test sample and the detection method of other protein level are basic identical.Get the homogenate buffer that the 5g plant sample adds 4 ℃ of 7ml (250mM sodium ascorbate, 1mM phenylmethylsulfonyl fluoride, 20mM EDTA, 20mM EGTA, pH7.0) in, under low temperature environment, grind fast with liquid nitrogen quartz sand.To get supernatant behind 12000rpm, 4 ℃ of centrifugal 5min, add 800 μ l sample-loading buffers (20%SDS, 8M urea, 0.01% bromjophenol blue), boiling water bath 15min cools off in ice-water bath then, and centrifugal with 12000rpm under 4 ℃.It is standby that centrifugal back collection supernatant is put-20 ℃ of preservations.
0.2 μ m nitrocellulose filter is put Towbin ' s damping fluid (25mM Tris, the 192mM glycine, 20% methyl alcohol, 0.01% sodium laurylsulfonate, pH7.6) soak 30min in, under the state of bleeding, put people's testing sample successively, put into 4 ℃ of insulations of the container 12-24h that is covered with the moistening paper of Towbin ' s, then film is placed capacity TBST (20mMTris, 150mM NaCl, 0.3%Tween20, pH7.6) clean rapidly in 3 times (each 1min), after adding sealing damping fluid (TBST that contains 5% skim-milk) jog 2h, inhale the deblocking damping fluid.Wash once with TBST then and [rabbit anti-antibacterial peptide Shiva A or cecropin B antibody (1: 250 dilution) are dissolved in 1% skim-milk and 0.02%NaN being added with first antibody 3] TBST solution in jog 1 hour.Wash film 5 times (each 5min) with TBST, in the TBS that does not contain tween, wash 5min again after the adding second antibody [second antibody of HRP mark (dilution in 1: 1000) is dissolved in the TBST solution that contains 1% skim-milk].
Isopyknic ECL detection reagent 1 and 2 (Amersham company) is mixed, mixed solution is added on the nitrocellulose filter and with solution covers it, absorb the ECL detection reagent behind the 60sec, and put film in preservative film, make point sample face the X-ray film exposure, develop then and photographic fixing.
The characteristics of this method that the present invention sets up are that it does not use NaN 3Get final product so that the HRP complete deactivation of plant itself can make proteolytic enzyme inactivation in the sample through the SDS boiling water bath simultaneously etc. toxic agent, and sample can be-20 ℃ of preservations of following long periods and by proteasome degradation.Use this detection method to the detected result that 52 transgenic Rhizoma Solani tuber osi strain systems carry out, show that wherein 12 show as the ECL positive.Embodiment 13: the bacterial wilt resistance of cad gene gene potato strain system is identified
Present embodiment is described the bacterial wilt resistance of the potato strain system of cad gene gene for example and is identified.In the evaluation, with indoor seedling stage potted plant appraising datum for referencial use, and become strain phase sick garden appraising datum to be as the criterion with the field.
The transgenic Rhizoma Solani tuber osi strain system that present embodiment is identified comprises that the rice of susceptible bacterial wilt draws, river taro 56, rich No. 1 of capital, No. 9, dam potato, 802-552,74-6-9 and Favorita be as initial kind (being), has wherein imported unit price gene and cecropin B/Shiva A bivalent genes such as cecropin B, Shiva A respectively.Potato piece with the normal size that obtains after breeding through routine carries out the disease resistance evaluation of the sick garden in greenhouse or field.
The Ralstonia solanacearum bacterial strain that uses in the test is H6, P041, P044, P053 and P068, and the potato bacterial wilt diseased plant from Huaihua area, Hunan Province, Pengxian County, Sichuan Province, Beijing and Xiamen City, Fujian Province separates acquisition respectively.These pathogenic strainss are physiological strain No. 3, biochemical type II, and have strong virulence.
The inoculation before with test strain respectively at substratum (yeast extract paste 1g, beef extract 3g, peptone 10g, glucose 5g, agar 15g, distilled water 1000ml, pH7.2) cultivate 48h for last 28 ℃, then with sterilized water suspension pathogenetic bacteria to required inoculum density, and be used for inoculation immediately.1. indoor artificial inoculation on seedling is identified
Potted plant growing seedlings in the insect protected greenhouse, used soil, fertilizer be all through high pressure steam sterilization, inoculates evaluation in that artificial culture is indoor.The seedling number of each potato strain system is decided according to potato piece amount, triplicate, at least 7 strains at every turn usually.Except that initial kind and transgenic line, also set up the purple bar of disease-resistant contrast MS-42.3 and susceptible check variety.Inoculating strain is P041, and concentration is 10 5CFU/ml.Room temperature is controlled at 28-30 ℃, the about 5000Lux of intensity of illumination, inoculation back continuous illumination 24h, later illumination every day 14h.With axil intubation (He L.Y.et al, Plant Disease 67:1357-1361,1983), hinder the root method, be stained with root method (Fang Zhongda, plant the disease organon, Fang Zhongda chief editor, agriculture press, Beijing, the 359-360 page or leaf, 1979), injection and leaf-cutting method are inoculated, and have been carried out first three especially and planted the comparison test of inoculation method.No matter use which kind of method inoculation, all handle in contrast with aqua sterilisa.We find, are stained with the root method and relatively are suitable for identifying indoor seedling stage, hinder the root rule and are more suitable for the sick garden evaluation in the field.The concrete operations of each inoculation method are as follows:
(1) axil intubation: when potted plant seedling grows to 6-7 sheet leaf, draw bacterium liquid 30 μ l with kapillary, in plant top the 3rd or the axil place oblique cutting of the 4th leaf go into stem, treat to extract it after bacterium liquid flows in the stem fully.
(2) hinder root and irritate the bacterium method: the inoculation seedling age is with the axil intubation.From cutting vertically downward from plants stems one side 3-4cm, about deeply 6-7cm pours into about 10ml bacterium liquid to hinder root from incision during inoculation.
(3) be stained with the root method: when the about 5-6cm of seedling height, directly root is soaked 5min in bacterium liquid, implant soil then again, and the bacterium liquid of remainder is watered equably at rhizosphere, the about 30ml of average every strain inoculation bacterium liquid.Artificial sick garden, 2 fields becomes the strain phase to identify
During the 1993-1994 (spring and autumn), artificial sick garden, field is located in the institute of agricultural sciences of Huaihua area, Hunan Province, and identifies in the artificial sick garden at southern china potato center, enshi simultaneously.Nineteen ninety-five is identified in the institute of agricultural sciences of Xiamen City, Fujian Province.Each about one mu of sick garden area.These areas are potato bacterial wilt grave illness district, and infect for No. 3 based on physiological strain.Spring nineteen ninety-five is set up minor illness garden, field again in the Chinese Academy of Agricultural Sciences Institute of Plant Protection (Beijing).Irritate the inoculation of bacterium method with hindering root, promptly when plant grow to 7-9 sheet leaf, when temperature on average reaches 20 ℃, the side at distance plant 5cm place, the about deeply 10cm of usefulness injury from sharp utensil root pours into concentration along the every strain of joint-cutting immediately and is about 3 * 10 8(minor illness garden, Beijing is because of dense planting, and the inoculation bacterial concentration is 10 for the bacterium liquid 100ml of CFU/ml 7CFU/ml).The sick garden inoculation of Huaihua P053 bacterial strain, the sick garden inoculation in Xiamen P068 bacterial strain, minor illness garden, Beijing inoculation P044 bacterial strain is established three repetitions, and each is more than repeated inoculation 10 strains.The disease of bestowing favour garden is the unique permanent venereal disease garden of China, Ralstonia solanacearum concentration height, is evenly distributed no longer artificial inoculation.The investigation of 3 state of an illness
Indoor pot artificial inoculation on seedling test was investigated after inoculation on the the 4th, 7,11,15 and 21 day, when sick garden, field becomes strain artificial inoculation pilot survey then from the first meeting diseased plant, approximately once every investigation in 7 days, until results.
Plant degree of being in a bad way is divided into 6 grades, and asymptomatic is 0 grade, and 1 leaf withering is decided to be 1 grade, and 2-3 sheet leaf withering is decided to be 2 grades, and the 1/2-3/4 blade is wilted and is decided to be 3 grades, and above wilting of 3/4 blade is decided to be 4 grades, and all blade wilting or plant death are decided to be 5 grades.Disease index (DI) is calculated as follows: Seedling stage is identified that the sick level of each kind is calculated as follows in the greenhouse:
Figure A9610037600462
Seedling stage is identified that each varietal resistance rank standard is in the greenhouse:
Disease-resistant (R): sick level 0.1-2
In anti-(MR): sick level 2.1-3
Middle sense (MS): sick level 3.1-4
Susceptible (S): sick garden, sick level 4.1-5 field identifies that disease index (DI) relative value (%) calculation formula is:
Figure A9610037600463
The varietal resistance rank standard that identify in sick garden, field is as follows: disease-resistant (R): DI relative value 〉=70%, be that resistance improves anti-(MR) in 3 ranks: 70%＞DI relative value 〉=40%, be that resistance improves sense (MS) in 2-2.9 the rank: 40%＞DI relative value 〉=20%, be that resistance improves 1-1.9 rank susceptible (S): DI relative value＜20%, promptly resistance does not have obvious raising
Present embodiment ties up under the condition of the sick garden in greenhouse and field the potato strain of 230 cad gene genes altogether and identifies, wherein 75 strain systems have been carried out repetitive identified, and filter out three resistance to bacterial wilt transgenic Rhizoma Solani tuber osi strains such as MS1-X4, MS1-1102-20-1, MS1-1102-14-3 system, their disease resistance has improved the 1-3 level compared with the beginning kind, and is anti-to anti-level in reaching.Embodiment 14: antibacterial peptide is to the inhibition activity of tumour cell
Present embodiment illustrates new antibacterial peptide of the present invention to suppressing and killing activity in the external and body of tumour cell.
The external target tumour cell that presses down use in the knurl experiment is a human medullary leukemia cell K562 cell.Use known antitumorigenic substance tricuspid sugi gum alkali as positive control, and use the RPMI substratum as negative control.
(1) antibacterial peptide is to K562 cells in vitro killing activity.With known MTT (Thiazolyl blue) method to cecropin B-17 of the present invention, Shiva A, CB-M 2, WHD and in the past we disclosed ABP3 carry out the external knurl test that presses down.Briefly, with the RPMI1640 substratum eugonic K562 cell concn is adjusted to 1.8 * 10 5Individual cell/ml (survival rate 95.1%).In 96 porocyte culture plates, add respectively above-mentioned suspension cell (135 μ l) and various antibacterial peptide (each 15 μ l, 1mM) and control sample.Add again behind 37 ℃ of insulation 1h and contain 1mg/ml MTT (Fluka company) and continue insulation 4h.In each hole, add 100 μ l acid isopropyl alcohol, and vibration 10min, the absorbance value with blank RPMI substratum is decided to be 0 then, surveys the 570nm absorbance value in each hole on DG3022A type enzyme-linked immunosorbent assay instrument.Calculate cytotoxicity by following formula:
Figure A9610037600471
The result shows, is 67% as the cytotoxicity of the tricuspid sugi gum alkali of positive control; Cecropin BN-17 of the present invention, Shiva A, CB-M2 and WHD are respectively 48%, 50%, 60% and 57%, and the cytotoxicity of ABP3 is 43%; Negative control (RPMI1640) is 0.
(2) synthetic antibacterial peptide cecropin B-17 is to suppressing active in the body of mouse metastatic tumor.Use 5-fluorine pyrimidine as positive control in the experiment, use physiological saline as negative control.Extract ascites from inoculating 9 days kunming mice intraperitoneal of S180 sarcoma and V14 cervical cancer cell respectively, and dilute with physiological saline with 1: 3 ratio.Every tested mouse hypodermic inoculation 0.2ml concentration about 10 5-10 6The above-mentioned abdominal cavity oncocyte of/ml.After the mouse random packet, second day begins abdominal injection Shiva A every day (0.1ml, about 10 μ g) and injected continuously 8 days.Negative control group animal injecting normal saline every day 0.2ml, positive control abdominal injection every day concentration is the 5-fluorine pyrimidine (general pharmaceutical factory, sea, Shanghai) of 0.8mg/ml.The 9th day disconnected neck handling dead animal, the separation tumor tissues is also weighed.Calculate inhibition rate of tumor growth by following formula: inhibiting rate (%)=(the average knurl of the average knurl weight-experimental group of control group is heavy)/average knurl of control group is heavy
Shown in result's following tabulation 4 of difference and the table 5.
The synthetic cecropin BN-17 of table 4 to heavy (g) inhibiting rate (%) experimental group of restraining effect group mouse body weight (g) knurl 30.43 1.05 ± 0.28 35.58 positive controls 29.50 0.74 ± 0.52 54.60 negative control group 32.71 1.63 ± 0.30 of mouse S180 transplanted tumor-
The synthetic cecropin B N-17 of table 5 to heavy (g) inhibiting rate (%) experimental group of restraining effect group mouse body weight (g) knurl 28.2 0.83 ± 0.20 39.1 positive controls 26.0 0.61 ± 0.52 55.2 negative control group 29.4 1.36 ± 0.32 of mouse U14 transplanted tumor-
In addition, also to having carried out Ultrastructural observation through K562 cell with the antibacterial peptide Shiva A extracorporeal treatment of recombinant production of the present invention.After pressing preceding method and handling L562 cell 1,6,12 and 24h with Shiva A, centrifugal collection tumour cell is fixed with 4% glutaraldehyde and 1% Z 250 in succession, and after dewatering with acetone is conventional with cutting into slices after the Epon 812 epoxy resin in situ embeddings.Behind uranyl acetate and lead citrate double staining, observation of cell form under transmission electron microscope.The result as seen, the organoid structural integrity of the K562 cell of handling without antibacterial peptide, the big and out-of-shape of nucleus, plastosome, golgi body are not seen destruction in the kytoplasm.After the cecropin BN-17 of synthetic handled 1～6h, cell fine hair was elongated and crosslinked, the cytolemma local dissolution.Behind the effect 24h, cellularstructure generation considerable change has entocyte to release outside the born of the same parents, and vacuolation appears in plastosome, and ridge comes off even disappears, and as seen secondary lysosome is arranged.
The foregoing description is intended to illustrate rather than limit the present invention.Under the situation of basic technical features of the present invention, to methods described herein any parallel substitute, change and functional equivalent give birth to modification and all should be included in the present invention and await the reply within the scope of claim.
Sequence table (1) physical data: (i) applicant: Biological Technology Research Center, Chinese Academy of Agricultural Sciences is the invention exercise question (ii): antibacterial peptide and production method thereof and use (iii) sequence number: 11 (iv) contact addresses;
(A) contact person: Jia Shirong, Tang Yixiong
(B) street: No. 30, Baishiqiao Lu, Haidian District
(C) city: Beijing
(D) country: the People's Republic of China (PRC)
(E) postcode: 100081 (v) telecommunication data:
(A) phone: 86-10-2172803
(B) fax: 86-10-2172803 (2) sequence numbering 1 data: (i) sequence signature:
(A) title: cecropin N holds 17 peptides (Cecropin B N-17)
(A) length: 17 amino acid
(B) type: amino acid
(C) chain: strand
(D) topological framework: line style, (ii) molecule type: protein, (iii) suppose: non-, (iv) antisense: non-, (v) clip types N-end, (xi) sequence description: sequence numbering 1:1 5 10 15Lys Trp Lys Val Phe Lys Lys Ile Glu Lys Met Gly Arg Asn IleArg Asn, (2) sequence numbering 2 data:, (i) sequence signature:
(A) title: Cecropin B-M 2
(B) length: 38 amino acid
(C) type: amino acid
(D) chain: strand
(E) topological framework: line style is molecule type (ii): protein is (iii) supposed: non-(iv) antisense: non-(v) clip types: N-end (xi) sequence description: sequence numbering 2:1 5 10 15Met Pro Lys Trp Lys Val Phe Lys Lys Ile Glu Lys Met Gly Arg
20 25 30Asn?Ile?Arg?Asn?Gly?Ile?Val?Lys?Ala?Gly?Pro?Ala?Ile?Ala?Val
35Leu Gly Glu Ala Lys Ala Leu Gly (2) sequence numbering 3 data: (i) sequence signature:
(A) title: ShivaA
(B) length: 38 amino acid
(C) type: amino acid
(D) chain: strand
(E) topological framework: line style is molecule type (ii): protein is (iii) supposed: non-(iv) antisense: non-(v) clip types: N-end (xi) sequence description: sequence numbering 3:1 5 10 15Met Ala Arg Trp Arg Leu Phe Arg Arg Ile Asp Arg Val Gly Lys
20 25 30Gln?Ile?Lys?Gln?Gly?Ile?Leu?Arg?Ala?Gly?Pro?Ala?Ile?Ala?Leu
35Val Gly Asp Ala Arg Ala Val Gly (2) sequence numbering 4 data: (i) sequence signature:
(A) title: WHD
(B) length: 37 amino acid
(C) type: amino acid
(D) chain: strand
(E) topological framework: line style is molecule type (ii): protein is (iii) supposed: non-(iv) antisense: non-(v) clip types: N-end (xi) sequence description: sequence numbering 4:1 5 10 15Met Lys Trp Lys Leu Phe Lys Lys Leu Glu Lys Leu Gly Arg Asn
20 25 30Leu?Arg?Asn?Gly?Leu?Leu?Lys?Ala?Gly?Pro?Ala?Ile?Ala?Val?Leu
35Gly Glu Ala Lys Ala Leu Gly (2) sequence numbering 5 data: (i) sequence signature:
(A) gene title: antibacterial peptide cecropin B N-17 gene
(B) length: 78 base pairs
(C) type: nucleic acid
(D) chain: two strands
(E) topological framework: line style is molecule type (ii): the dna sequence dna of encoding antimicrobial peptide cecropin B N-17 gene
And regulating and controlling sequence, (iii) suppose: non-, (iv) antisense: non-, (xi) sequence description: sequence numbering 5:5 ' GGATCC ATG GCG AAG TGG AAG GTC TTC AAG AAG ATC GAG AAG3 ' CCTAGG TAC CGC TTC ACC TTC CAG AAG TTC TTC TAG CTC TTC BamHIATG GGC CGC AAC ATC AGG AAC GGC TAG TAA GAATTC 3 ' TAC CCG GCG TTG TAG TCC TTG CCG ATC ATT CTTAAG 5 '
EcoRI (2) sequence numbering 6 data: (i) sequence signature:
(A) gene title: antibacterial peptide CB-m 2Gene
(B) length: 132 base pairs
(C) type: nucleic acid
(D) chain: two strands
(E) topological framework: line style is molecule type (ii): encoding antimicrobial peptide CB-M 2Dna sequence dna and regulating and controlling sequence (iii) supposition thereof: non-(iv) antisense: non-(xi) sequence description: sequence numbering 6:5 ' GGATCC ATG CCA AAA TGG AAA GTT TTC AAG AAA ATC GAG AAG ATG3 ' CCTAGG TAC GGT TTT ACC TTT CAA AAG TTC TTT TAG CTC TTC TAC BamHIGGT CGT AAC ATC AGG AAC GGT ATC GTG AAA GCC GGT CCA GCT ATCCCA GCA TTG TAG TCC TTG CCA TAG CAC TTT CGG CCA GGT CGA TAGGCT GTC CTG GGT GAA GCT AAA GCT CTT GGT TAG TAA GAATTC 3 ' CGA CAG GAC CCA CTT CGA TTT CGA GAA CCA ATC ATT CTTAAG 5 '
EcoRI (2) sequence numbering 7 data: (i) sequence signature:
(A) gene title: antibacterial peptide Shiva A gene
(B) length: 235 base pairs
(C) type: nucleic acid
(D) chain: two strands
( E ) ： ( ii ) ：Shiva ADNA ( iii ) ： ( iv ) ： ( xi ) ：7：5′GTCGACGTCTAGA GGATCC CTGCAG TATTTTTACAACAATTACAAACAACAACAAACAAC3′CAGCTGCAGATCT CCTAGG GACGTC ATAAAAATGTTGTTAATGTTTGTTGTTGTTTGTTG SalI XbaI BamHI PstIAAACAACATTACAATTACTATTTCAACAACA ATG GCT AGG TGG AGG TTG TTC AGA AGGTTTGTTGTAATGTTAATGATAAAGTTGTTGT TAC CGA TCC ACC TCC AAC AAG TCT TCCATT GAC AGG GTT GGT AAG CAG ATC AAG CAA GGA ATC CTT AGA GCT GGATAA CTG TCC CAA CCA TTC GTC TAG TTC GTT CCT TAG GAA TCT CGA CCTCCA GCT ATC GCT CTT GTG GGA GAT GCT AGG GCT GTG GGT TAATAGGGT CGA TAG CGA GAA CAC CCT CTA CGA TCC CGA CAC CCA ATTATCGGTACC GAATTC AGATCT AAGCTT 3′CCATGG CTTAAG TCTAGA TTCGAA 5′ KpnI EcoRI BglII HindIII ( 2 ) 8： ( i ) ：
(A) gene title: antibacterial peptide WHD gene
(B) length: 143 base pairs
(C) type: nucleic acid
(D) chain: two strands
(E) topological framework: line style is molecule type (ii): the dna sequence dna of encoding antimicrobial peptide WHD and regulating and controlling sequence thereof are (iii) supposed: non-(iv) antisense: non-(xi) sequence description: sequence numbering 8:5 ' GATCCACAACA ATG GCC AAG TGG AAG TTG TTC AAG AAA CTT GAG
3 ' GTGTTGT TAC CGG TTC ACC TTC AAC AAG TTC TTT GAA CTC BamH I Msc I/Bal IAAG TTG GGA AGA AAC CTT CGT AAC GGT TTG CTT AAG GCC GGC CCATTC AAC CCT TCT TTG GAA GCA TTG CCA AAC GAA TTC CGG CCG GGTGCT ATC GCC GTT CTT GGT GAG GCT AAG GCC TTG GGT TAATGCGA TAG CGG CAA GAA CCA CTC CGA TTC CGG AAC CCA ATTACAAGCTT AGATCT GAGCT 3 ' TTCGAA TCTAGA C 5 ' Hind III Bgl II Sac I (2) sequence numbering, 9 data: (i) sequence signature:
(A) gene title: Shiva AY gene
(B) length: 161 base pairs
(C) type: nucleic acid
(D) chain: two strands
(E) topological framework: line style is molecule type (ii): the nucleotide sequence of Shiva AY gene and regulating and controlling sequence thereof are (iii) supposed: non-(iv) antisense: non-(xi) sequence description: sequence numbering 9:5 ' GAGCTCTAGAT AAA AGA ATG GCT AGG TGG AGG TTG TTC AGA AGG ATT3 ' CTCGAGATCTA TTT TCT TAC CGA TCC ACC TCC AAC AAG TCT TCC TAA
XbaI ↑
KEX2GAC AGG GTT GGT AAG CAG ATC AAG CAA GGA ATC CTT AGA GCT GGACTG TCC CAA CCA TTC GTC TAG TTC GTT CCT TAG GAA TCT CGA CCTCCA GCT ATC GCT CTT GTG GGA GAT GCT AGG GCT GTG GGT TAATAGGGT CGA TAG CGA GAA CAC CCT CTA CGA TCC CGA CAC CCA ATTATCGGTACC GAATTC AGATCT AAGCTT 3 ' CCATGG CTTAAG TCTAGA TTCGAA 5 ' KpnI EcoRI BglII HindIII (2) sequence numbering 10 data: (i) sequence signature:
(A) gene title: Shiva A-pMAL
(B) length: 243 base pairs
(C) type: nucleic acid
(D) chain: two strands
(E) topological framework: line style is molecule type (ii): Shiva A and (iii) suppose with the nucleotide sequence of pMAL connecting zone: non-(iv) antisense: non-(xi) sequence description: sequence numbering 10:
Omega sequence 5 '-malE-TCGAGCTC GGTACC CGGCCGGGGATCCCTGCAGTATTTTTACAACAATTA
SacI KpnI BamHI
Shiva?A＝＝＞CAAACAACAACAAACAACAAACAACATTACAATTACTATTTCAACAACA?ATG?GCT?AGGTGG?AGG?TTG?TTC?AGA?AGG?ATT?GAC?AGG?GTT?GGT?AAG?CAG?ATC?AAG?CAAGAA?ATC?CTT?AGA?GCT?GGA?CCA?GCT?ATC?GCT?CTT?GTG?GGA?GAT?GCTAGG?GCT?GTG?GGT?TAA?TAG?GGTACCGAATTC?AGATCTAAGCTT-LacZ?α-3′
Stop Stop EcoRI HindIII (2) sequence numbering 11 data: (i) sequence signature:
(A) gene title: Shiva A-pUC Polylinker
(B) length: 212 base pairs
(C) type: nucleic acid
(D) chain: two strands
(E) topological framework: line style is molecule type (ii): Shiva A and with the Nucleotide of the connecting zone of pUC Polylinker
Sequence and regulating and controlling sequence thereof are (iii) supposed: non-(iv) antisense: non-(xi) sequence description: sequence numbering 11:
Translation?start5′pUC21-GAAACAGCTATGACCATGATTACGCCAAGCTTCCATGGGATATC?GCATGC
HindIII EcoRV SphI
Shiva?A?gene?＝＝＞CTGCAGAGCTCTAGATAAAAGA?ATG?GCT?AGG?TGG?AGG?TTG?TTC?AGA?AGG
XbaIATT?GAC?AGG?GTT?GGT?AAG?CAG?ATC?AAG?CAA?GAA?ATC?CTT?AGA?GCTGGA?CCA?GCT?ATC?GCT?CTT?GTG?GGA?GAT?GCT?AGG?GCT?GTG?GGTTAA?TAG?GGTACCGAATTCACTGGCCG-pUC21?3′Stop?Stop EcoRI

Claims (42)

1. the feature of the new peptide sequence with anti-microbial activity is that said polypeptide has the sterilization/bacteriostatic activity stronger than natural antibacterial peptide to vegetative bacteria and fungoid disease substance, does not then have injury effect to the eukaryotic cell that comprises vegetable cell.
2. according to the polypeptide of claim 1, wherein said polypeptide has the aminoacid sequence of any length of natural cecropin B amino acid sequence number 1 to 12 and 33.
3. according to the polypeptide of claim 2, wherein said polypeptide has the aminoacid sequence shown in sequence numbering in the sequence table 1 or the function equivalent or the varient of its brachymemma.
4. according to the polypeptide of claim 1, said polypeptide has the aminoacid sequence shown in the sequence numbering 2 or its function equivalent or varient in the sequence table.
5. according to the polypeptide of claim 1, said polypeptide has the aminoacid sequence shown in the sequence numbering 3 or its function equivalent or varient in the sequence table.
6. according to the polypeptide of claim 1, said polypeptide has the aminoacid sequence shown in the sequence numbering 4 or its function equivalent or varient in the sequence table.
7. according to any one polypeptide in the claim 1 to 6, wherein said polypeptide obtains suitably modifying based on the known amino acid sequence of natural antibacterial peptide.
8. according to the polypeptide of claim 7, wherein said modification is to realize by the one or more amino acid that begin to delete the natural antibacterial peptide molecule from C-terminal.
9. according to the polypeptide of claim 7, wherein said modification is by changing the one or more amino acid in the said natural antibacterial peptide molecule, realizing to increase its α helicity.
10. according to the polypeptide of claim 7, wherein said modification is by realizing with the hydrophobic amino acid of the amphiphilic on the said natural antibacterial peptide peptide chain of suitable amino-acid substitution.
11. according to any one polypeptide in the claim 1 to 6, wherein said polypeptide produces with the solid state chemistry synthetic method.
12. according to any one polypeptide in the claim 1 to 6, wherein said polypeptide is the dna sequence dna that utilizes these polypeptide of coding, produces with the DNA recombinant technology.
13. according to any one polypeptide in the claim 1 to 6, wherein said polypeptide can be made fusogenic peptide and the non-fusogenic peptide that comprises bridge joint sequence or non-bridge joint sequence with any array mode.
14. according to the polypeptide of claim 1, wherein said plant is any monocotyledons or dicotyledons, comprises vegetable cell, callus, whole strain plant and part thereof.
15. according to the polypeptide of claim 1, wherein said phytopathogen comprises plant pathogenic Gram-negative and positive bacteria or fungi or nematode.
16. according to the polypeptide of claim 15, wherein said plant pathogenic Gram-negative and positive bacteria are selected from potato bacterial wilt bacterium, bacterial wilt of tomato bacterium, potato rot positive germ, Cauliflower Bacteria erwinia, cabbage black rot bacterium, rice leaf spot bacteria, xanthomonas oryzae pv. oryzicola, bacterial canker of tomato, bacterial ring rot o potato bacterium, agrobacterium tumefaciens, reach colibacillary bacterial strain.
17. coding is as dna sequence dna or its function equivalent or the varient of the new peptide sequence with anti-microbial activity of any one qualification in the claim 1 to 13.
18. according to the dna sequence dna of claim 17, said dna sequence dna has the nucleotide sequence shown in the sequence numbering 5 or its function equivalent or varient in the sequence table.
19. according to the dna sequence dna of claim 17, said dna sequence dna has the nucleotide sequence shown in the sequence numbering 6 or its function equivalent or varient in the sequence table.
20. according to the dna sequence dna of claim 17, said dna sequence dna has the nucleotide sequence shown in the sequence numbering 7 or its function equivalent or varient in the sequence table.
21. according to the dna sequence dna of claim 17, said dna sequence dna has the nucleotide sequence shown in the sequence numbering 8 or its function equivalent or varient in the sequence table.
22. according to any one dna sequence dna in the claim 18 to 21, said sequence is molecular by vegetable cell preferences password basically.
23. according to the dna sequence dna of claim 18-21, said sequence is a synthetic chemically.
24. dna sequence dna according to claim 18-21, wherein said dna sequence dna or its function equivalent or varient obtain through one or more Nucleotide of replacing, add, repeat or lacking said dna sequence dna, thereby further improved the expression efficiency of these dna sequence dnas in vegetable cell, and and then improved by the sterilization and/or the bacteriostatic activity of antibacterial peptide of coding.
25. carry recombinant expression vector according to the dna sequence dna of any one in the claim 18 to 21, at 5 ' end of the dna sequence dna of encoding antimicrobial peptide be operably connected enhancer sequence, Ω sequence and the secretory signal sequence of the promoter sequence of one or more restriction enzyme sites, one or more different sourcess, one or more different sourcess, 3 ' end of the dna sequence dna of said encoding antimicrobial peptide then has the terminator sequence that the amidated amino acid whose nucleotide sequence of coding, multienzyme are cut site and one or more different sourcess in the said recombinant expression vector.
26. according to the recombinant expression vector of claim 25, wherein said promoter sequence is selected from the 35S promoter that the promotor and the 35S promoter of cauliflower mosaic virus of 35S promoter, the sweet dew synthase gene of promotor, the cauliflower mosaic virus of mannopine synthetic gene merge the promotor that forms mutually and have the cauliflower mosaic virus of two enhancement sequences.
27. according to the recombinant expression vector of claim 25, wherein said terminator is selected from the two-way terminator of T-DNA7 ' 5 ', octopine synthase gene terminator, cauliflower mosaic virus 35S RNA terminator and the T-DNA tml gene terminator of plasmid pTiA6.
28. according to the recombinant expression vector of claim 25, wherein said secretion signal peptide sequence is selected from the secretion signal peptide sequence of plant, animal or insect genes.
29. according to the recombinant expression vector of claim 28, the secretion signal peptide sequence that wherein said secretion signal peptide sequence is the Alpha-starch gene.
30. according to the recombinant expression vector of claim 25, the structural gene sequence of said encoding antimicrobial peptide and its 5 ' and 3 ' distolateral wing controlling element sequence synthetic or make chemically wherein with the DNA recombinant technology.
31. according to the recombinant expression vector of claim 25, said recombinant expression vector is selected from pBZ863, pBT567, pTYB1, pTBM20, pBC174, pTYB3, pTYB3A, pTYB3B, pTYB2, pTYB4A, pTYB4B, pSMC, pMC and pSSA.
32. by according to any one recombinant expression vector plant transformed cell or its callus in the claim 25 to 31.
33. by according to claim 32 by the plant of cell transformed or callus regeneration.
34. with the method that the DNA recombinant technology is produced antibacterial peptide, this method comprises the following steps:
(1) obtain encoding nucleotide sequence or its functional equivalent varient of antibacterial peptide with sequence numbering 1 in the sequence table or 2 or 3 or 4;
(2) nucleotide sequence that obtains in the step (1) is operatively coupled on suitable controlling element and suitable expression, obtains being suitable for the recombinant expression vector of in protokaryon or eukaryotic cell, expressing;
(3) recombinant expression vector that obtains in the step (2) is transformed in the host cell of selection, and screening is by cell transformed;
(4) being suitable for expressing under the condition of said antibacterial peptide, cultivate said by cell transformed;
(5) directly obtain or the required antibacterial peptide of separation and purification therefrom from above-mentioned cell culture.
35. produce the method for the transgenic plant with anti-plant pathogenetic bacteria and/or fungi ability, this method may further comprise the steps:
(1) provide coding to have nucleotide sequence or its functional equivalent varient of the encoding antimicrobial peptide shown in sequence numbering in the sequence table 1 or 2 or 3 or 4;
(2) resulting nucleotide sequence in the step (1) is operatively coupled on suitable controlling element sequence and suitable expression, obtains the recombinant vectors that is suitable in cell or tissue, expressing;
(3) with the recombinant expression vector transformed host cell that obtains in the step (2), and screening is by the plant transformed cell or tissue;
(4) express under the condition of said antibacterial peptide being suitable for, cultivate and breed said by the plant transformed cell or tissue.
(5) regeneration of transgenic plant from the culture of above-mentioned cell or tissue.
36. according to the method for claim 34 or 35, wherein said cell is prokaryotic cell prokaryocyte or eukaryotic cell.
37. according to the method for claim 34 or 35, wherein said cell is selected from Bacillus coli cells, yeast cell, vegetable cell, insect cell and mammalian cell.
38. according to the method for claim 34 or 35, wherein said carrier is selected from plasmid, virus and phage.
39. with the bioactive method of antibacterial peptide in the diffusion process detection by quantitative sample of thin layer agarose plate hole.Its improvement comprises bed board gauge control with the thin layer agarose plate between 0.3 to 0.7mm, and based on the antibacterial peptide content in the mathematical relation calculation sample between antibacterial circle diameter and substratum thickness.
40. screen the method for transgenic plant in enormous quantities.This method is based on that known enhancing chemiluminescence method (ECL) realizes, the improvement of being done comprises handling with deactivation with SDS-urea boiling water bath and is present in horseradish peroxidase in the plant sample material, thus the susceptibility of raising detection method.
41. be used to resist the bacterium of animal or plant or the agricultural chemicals or the feed interpolation composition of fungal pathogens infection.Said composition is activeconstituents with one or more according to the antibacterial peptide of any one in the claim 1 to 6, and is mixed with acceptable carrier and additive on a kind of and Multiple Pesticides or the fodder additives.
42. be used to resist human or animal's the bacterium or the pharmaceutical composition of fungi infestation or neoplastic disease, said composition is activeconstituents with one or more according to the antibacterial peptide of any one in the claim 1 to 6, and is mixed with one or more pharmaceutically acceptable carrier and additives.
CN96100376A 1996-01-16 1996-01-16 Antibiotic peptide and production method and application thereof Expired - Fee Related CN1073117C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN96100376A CN1073117C (en) 1996-01-16 1996-01-16 Antibiotic peptide and production method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN96100376A CN1073117C (en) 1996-01-16 1996-01-16 Antibiotic peptide and production method and application thereof

Publications (2)

Publication Number Publication Date
CN1154970A true CN1154970A (en) 1997-07-23
CN1073117C CN1073117C (en) 2001-10-17

Family

ID=5116575

Family Applications (1)

Application Number Title Priority Date Filing Date
CN96100376A Expired - Fee Related CN1073117C (en) 1996-01-16 1996-01-16 Antibiotic peptide and production method and application thereof

Country Status (1)

Country Link
CN (1) CN1073117C (en)

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100371443C (en) * 2002-11-06 2008-02-27 奥本大学 Compositions and methods for enhancing disease resistance in fish
CN101851276A (en) * 2010-04-28 2010-10-06 东北农业大学 Preparation method and activity detection for antibacterial peptides
CN101648993B (en) * 2009-09-17 2011-08-10 山东大学 Small peptide A with antibacterial and antitumor functions and applications thereof
CN103285371A (en) * 2013-01-29 2013-09-11 广州格拉姆生物科技有限公司 Antibacterial peptide stable preparation and preparation method thereof
CN104774842A (en) * 2015-03-27 2015-07-15 青岛科技大学 Polypeptide Pt5e having antibacterial activity
CN104945484A (en) * 2015-07-10 2015-09-30 湖南傲农生物科技有限公司 Antibacterial peptide and preparation method and application thereof
CN105001308A (en) * 2015-08-21 2015-10-28 漳州傲农牧业科技有限公司 Antibacterial peptide PD22 and application thereof
CN105061573A (en) * 2015-07-20 2015-11-18 苏州大学张家港工业技术研究院 Natural anti-inflammatory polypeptide cecropin-TY1 extracted from Tabancus yao and application of natural anti-inflammatory polypeptide cecropin-TY1
CN106333936A (en) * 2016-08-23 2017-01-18 浙江大学 Antimicrobial peptide gene-loaded drug delivery system and construction and application thereof
CN110078806A (en) * 2019-04-26 2019-08-02 华中农业大学 A kind of Triticum tauschii cecropin A tR100 and its application
CN110257314A (en) * 2019-07-02 2019-09-20 华中农业大学 A kind of recombined bacillus subtilis, construction method and its application producing antibacterial peptide Cecropin B
CN114686491A (en) * 2020-12-29 2022-07-01 湖南中烟工业有限责任公司 Preparation and application of tobacco NtPEEP 1 gene coded polypeptide bacterial wilt-resistant preparation

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1309824C (en) * 2004-08-27 2007-04-11 广州维观生物科技有限公司 Antibiotic peptide gene converted viscons bacillus engineering bacterium and its preparing method and use
CN100482683C (en) * 2005-06-09 2009-04-29 中国人民解放军军事医学科学院放射与辐射医学研究所 Active fragment of human glycine-rich protein and use thereof
CN101280333B (en) * 2008-02-15 2010-12-22 山东大学 Method for preparing penicillium antibacterial peptide from grey rose penicillium

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN100371443C (en) * 2002-11-06 2008-02-27 奥本大学 Compositions and methods for enhancing disease resistance in fish
CN101648993B (en) * 2009-09-17 2011-08-10 山东大学 Small peptide A with antibacterial and antitumor functions and applications thereof
CN101851276A (en) * 2010-04-28 2010-10-06 东北农业大学 Preparation method and activity detection for antibacterial peptides
CN101851276B (en) * 2010-04-28 2012-02-29 东北农业大学 Preparation method and activity detection for antibacterial peptides
CN103285371A (en) * 2013-01-29 2013-09-11 广州格拉姆生物科技有限公司 Antibacterial peptide stable preparation and preparation method thereof
CN104774842A (en) * 2015-03-27 2015-07-15 青岛科技大学 Polypeptide Pt5e having antibacterial activity
CN104945484A (en) * 2015-07-10 2015-09-30 湖南傲农生物科技有限公司 Antibacterial peptide and preparation method and application thereof
CN104945484B (en) * 2015-07-10 2018-03-06 湖南傲农生物科技有限公司 A kind of antibacterial peptide and preparation method and application
CN105061573A (en) * 2015-07-20 2015-11-18 苏州大学张家港工业技术研究院 Natural anti-inflammatory polypeptide cecropin-TY1 extracted from Tabancus yao and application of natural anti-inflammatory polypeptide cecropin-TY1
CN105061573B (en) * 2015-07-20 2018-08-21 苏州大学 The natural anti-inflammatory polypeptide cecropin-TY1 of Yao horsefly and its application
CN105001308A (en) * 2015-08-21 2015-10-28 漳州傲农牧业科技有限公司 Antibacterial peptide PD22 and application thereof
CN105001308B (en) * 2015-08-21 2018-07-06 江苏傲农生物科技有限公司 A kind of antibacterial peptide PD22 and application thereof
CN106333936A (en) * 2016-08-23 2017-01-18 浙江大学 Antimicrobial peptide gene-loaded drug delivery system and construction and application thereof
CN106333936B (en) * 2016-08-23 2019-04-05 浙江大学 A kind of drug delivery system of antimicrobial peptide gene and building and application
CN110078806A (en) * 2019-04-26 2019-08-02 华中农业大学 A kind of Triticum tauschii cecropin A tR100 and its application
CN110078806B (en) * 2019-04-26 2021-03-16 华中农业大学 Arthropoda-japonica antibacterial peptide AtR100 and application thereof
CN110257314A (en) * 2019-07-02 2019-09-20 华中农业大学 A kind of recombined bacillus subtilis, construction method and its application producing antibacterial peptide Cecropin B
CN114686491A (en) * 2020-12-29 2022-07-01 湖南中烟工业有限责任公司 Preparation and application of tobacco NtPEEP 1 gene coded polypeptide bacterial wilt-resistant preparation
CN114686491B (en) * 2020-12-29 2023-10-20 湖南中烟工业有限责任公司 Preparation and application of tobacco NtPEP1 gene encoding polypeptide bacterial wilt resistance preparation

Also Published As

Publication number Publication date
CN1073117C (en) 2001-10-17

Similar Documents

Publication Publication Date Title
CN1073117C (en) Antibiotic peptide and production method and application thereof
CN1176577C (en) Modified bacillus thuringiensis gene for lepidopteran control in plants
CN1024021C (en) Herbicid resistance plant consisting glutathione S-transferase
CN1145695C (en) Antifungal protein
CN1334874A (en) Improved expression of Cry 3B insecticidal protein in plant
CN1220700A (en) Antifungal polypeptide and methods for controlling plant pathogenic fungi
CN1375009A (en) Insect-resistant rice plants
CN1430674A (en) Production of silk-like proteins in plants
CN1191357C (en) Orally immunogenic bacterial enterotoxins expressed in transgenic plants
CN1250727C (en) Pesticidal fusions
CN1037924A (en) Improve the method for efficacy of insect toxins
CN1037913C (en) Expressive carrier with coded insect-killing protein fusion gene, and transfer gene plant
CN1190433A (en) PAP mutants that exhibit anti-viral and/or anti-fungal acitivity in plants
CN1887903A (en) Nitrate transport protein of diatom and its coding gene and application
CN1143978A (en) Antimicrobial proteins from aralia and impatiens
CN1772764A (en) Rice DREB transcription factor and its coding gene and application
CN1772902A (en) One coding gene of rotavirus VP6 protein and its application
CN1544631A (en) Dehydrin gene BcDh2 and the application of promoter in cultivation of drought resistant plants
CN1195063C (en) Proteinase inhibitor fusion proteins
CN1650018A (en) Insect resistant plants and methods for making same
CN1083884C (en) Two kinds of encoding insecticidal protein gene and bivalent fused expression carrier and their application
CN1297666C (en) Plant transcriptional repressor, proteic nuclear factors binding thereto, and uses thereof
CN1496367A (en) Materials and methods for producing tomato yellow leaf curl virus resistance in plants
CN1526817A (en) Anhydrant gene BcDh1 and the application of its promoter in raising drought-enduring plant
CN1119027A (en) Method of controlling insects in plants

Legal Events

Date Code Title Description
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C06 Publication
PB01 Publication
C14 Grant of patent or utility model
GR01 Patent grant
C19 Lapse of patent right due to non-payment of the annual fee
CF01 Termination of patent right due to non-payment of annual fee