CN1544631A - Dehydrin gene BcDh2 and the application of promoter in cultivation of drought resistant plants - Google Patents

Abstract

In accordance with the present invention, a novel dehydrin gene with a length of 402 bp and of Boea crassifolia Hemsl. and a 5'-terminal regulation sequence 1084bp of the gene are cloned. The gene, as a member of the dehydrin family YSK 2 type, is named BcDh2. Since the gene is induced for expression by drought and coldness, its encoded egg albumen dehydrin cooperates with some sugar alcohol type small molecules in cells in drought instance to protect cellular membranes and biomacromolecules and then to help plant cells to fight back drought stress, then the vegetal drought hardiness is improved. The 5'-terminal regulation sequence of the gene contains elements such as drought, coldness, heat stimulation, ABA reaction and the like, is named BcDh2P, can be used as an adverse circumstances stressing induced gene regulation element for stress-resistant genetic engineering breeding. We have constructed said genic plant expression carrier, and have directed said drought-resistant gene into various plants through farming bacilli meso-guiding and gene gun process, to improve drought-resistance and freeze resistance of plants.

Description

The application in cultivating drought-enduring plant of dehydrin gene BcDh2 and promotor thereof

One, Technical field:

The present invention relates to clone a new dehydrin gene BcDh2 and its promotor BcDh2P, and the molecular method that utilizes this gene genetic to transform the drought-enduring cold-resistant transgenic plant of acquisition is provided.This gene is the plain YSK of family of dehydration ₂Type member.

Two, Background technology:

Lea protein is embryogenetic late period, or arid, after low temperature or the exogenous aba treatment, and the main protein of a class of generation.LEA has conservative structural domain, higher wetting ability, and solubility extensively exists in unifacial leaf and the dicotyledons.Etap specificity that they are expressed and the accumulation during the drought stress are pointed out at protection tenuigenin configuration aspects role.According to the difference that amino acid is formed, LEA is divided into five classes, the feature of group I LEA, and the motif that it is made up of 20 amino acid is as wheat Em albumen; Group II LEA is called dehydration plain (dehydrin), be that research is maximum among the LEA, the essential characteristic of the plain structure of dewatering is to have the K-section that is rich in Lys that 2-11 amino acid forms at C-terminal (K-segment EKKGIMDKIKEKIPG), can form the amphoteric alpha-helix.The S-section (S-segment) that contains the Serine composition of a succession of arrangement at the middle part, Serine can be participated in the nuclear transportation by the localized signal peptide of syncaryon by phosphorylation.At the plain N-terminal of dehydration, exist sometimes 1-2 Y-section (Y-segment, T/VDEYGNP), the part nucleotide binding site homology of it and molecular chaperones.Up to the present, although many dehydration element and macromole of studies confirm that, as with nuclear in nucleoprotein complex body and adipose membrane be related, the plain definite function of dehydration is still unintelligible.Infer that the dehydration element is a kind of tensio-active agent, under cell arid and cold condition, can suppress macromolecular polymerization, protection cell integrity (Close, 1996,1997); GroupIII LEA contains the motif that 11 amino acid is formed, and forms alpha-helix, may work between intramolecularly or intermolecular interaction; GroupIV LEA has conservative N-terminal and forms alpha-helix and a changeable C-terminal, has the random coil structure; GroupV LEA contains the more hydrophobic amino acid than other group, may form globosity (Dure et al., 1989, Ingram and Bartels, 1996).

Three, Summary of the invention:

1, cloned new dehydrin gene BcDh2

We isolate a plain similar gene cDNA of new dehydration, called after BcDh2 (the GenBank accession number is AY243045) from the blade of drought-induced boea crassifolia (B.crassifolia).BcDh2 coding region (codingsequence) is 402bp.Polypeptide of forming by 133 amino acid-one of this genes encoding typical YSK ₂The type dehydration is plain, has a Y-section at N-terminal, and the middle part is the S-section that 7 Serines are formed, and C-terminal contains the K-section of two repeated arrangement.According to known plant dehydration plain gene conservative region design primer, adopt the DDRT-PCR method from the total RNA of boea crassifolia, to amplify a 300bp and plant dehydration plain gene homologous sequence.Utilize 5 ' RACE technology to obtain the full-length cDNA (402bp) of a newcomer BcDh2 of plant dehydration plain gene family, and this expression of gene characteristic is analyzed.The Southern hybridization analysis shows that the BcDh2 gene exists with single copy form in the boea crassifolia genome.The Northern hybridization analysis points out that the BcDh2 gene is not expressed in the plant materials of normal growth, but the accumulation under different environment-stress (arid, low temperature, thermal shock) and exogenous induction material (Exogenous ABA, MeJA and SA) existence condition is different.The BcDh2 transcripton is in arid, high salt, gentle thermal shock and induce down strong expression in Exogenous ABA outward, but to low temperature, MeJA and Whitfield's ointment processing have faint expression, these results point out the BcDh2 gene coerce with shock reaction in effect.

2, made up the plant expression vector of BcDh2 gene

Place the regulation and control of CaMV 35S promoter down the BcDh2 gene, made up plant expression vector pBI121BcDh2.Transform soil Agrobacterium LBA4404 by freeze-thaw method, utilize leaf dish method transformation of tobacco to obtain transgenic tobacco plant again.The BcDh2 gene is placed under the Ubiquitin promoter regulation, made up individual character leaf plant expression vector pAHC-BcDh2 and p3ubiBcDh2.Transform turfgrass and herbage by particle gun, obtain transfer-gen plant, and tentatively show drought-enduring cold tolerance raising.

3, cloned the upstream regulatory region of this dehydrin gene, and called after promotor BcDh2P

Method by ligation-mediated PCR, be cloned into the sequence B cDh2P of one section 1084bp of BcDh2 upstream region of gene, it is connected among the medial expression vector pCAMBIA1350 that contains gus reporter gene, to the analysis revealed that GUS in the transgene tobacco expresses, this can make a response BcDh2P to ABA, arid and cold.

4, by particle gun and agrobacterium mediation method turfgrass and herbage are carried out genetic transformation, and obtained drought-enduring transgenic turf grass and herbage

The BcDh2 gene is placed under the Ubi promoters driven that efficiently expresses in the unifacial leaf, method by particle gun import widespread use lawn plant such as annual bluegrass, Festuca Arundinacea, rye grass, red fescue, cut in a gang Ying, jielu grass, Bermuda grass and herbage such as clover, prairie milk vetch, Root or stem of Littleleaf Indianmulberry, Herba Eragrostidis pilosae, the wheatgrass, the drought tolerance of turfgrass and herbage is significantly improved, big and China's water resources contradiction that the situation is tense is significant for solving in the urban afforestation lawn water loss.Obtain transgenic turf grass at present, and tentatively shown the anti-lack of water ability of increase, helped to solve the problem that the turfgrass water loss is big, maintenance is difficult.Therefore this transgenic turf grass is very potential aspect saving urban afforestation water.

What should particularly point out here is, though in following embodiment of the present invention with transgene tobacco, turfgrass (comprises annual bluegrass, Festuca Arundinacea, rye grass, red fescue, cut a gang Ying, jielu grass, Bermuda grass etc.) and herbage (comprise clover, prairie milk vetch, Root or stem of Littleleaf Indianmulberry, Herba Eragrostidis pilosae, wheatgrass etc.) generation and detection have described in further detail the present invention for example, but this plain BcDh2 gene of dehydration and used plant expression vector thereof of meaning that never the present invention prepares only are used to transform and produce the tobacco of expressing the BcDh2 gene coded protein, annual bluegrass, Festuca Arundinacea, rye grass, red fescue, cut a gang Ying, jielu grass, Bermuda grass, clover, prairie milk vetch, Root or stem of Littleleaf Indianmulberry, Herba Eragrostidis pilosae, wheatgrass also comprises other lawn plant and herbage.Because the BcDh2 expression vector that those skilled in the art can utilize this patent to build, the plant genetic transformation method that utilizes this patent to provide transforms other lawn plant and forage grass.

In one embodiment of the invention, the BcDh2 gene places under the regulation and control of composition type expression promoter CaMV35S promotor, has made up to be suitable for dicotyledons plant transformed expression vector pBI121BcDh2.The BcDh2 gene coding region that is connected on pGEM -TEasy carrier is scaled off with Nco I and Sac I, be connected on the prokaryotic expression carrier pET-30a that handled with Nco I and Sac I, the proteic plasmid pET-30aBcDh2 of construction expression BcDh2, transformed into escherichia coli E.coli DH5 α bacterial strain screens correct clone.With Bgl II and Sac I digested plasmid p30aBcDh2, reclaim the BcDh2 fragment, it is connected among the plasmid pBI121 that digested with BamH I and Sac I, form pBI121BcDh2.

According to this embodiment of the present invention, the promotor that drives the BcDh2 gene is except composition type expression promoter CaMV35S, should comprise that also other purpose is in order to drive promotor such as the ubiquitin Ubiqutin promotor that the BcDh2 gene efficiently expresses, actin promotor etc. in plant.

According to this embodiment of the present invention, making up selected primordial plant expression vector is the pBI121 expression vector, and its plant screening mark gene is NPTII, and coding neomycin phosphotransferase albumen has the effect of anti-kantlex.The promotor of NPTII coding region is the CaMV35S promotor, and terminator is CaMV35S polyA.The promotor that drives the BcDh2 gene is the CaMV35S promotor, and terminator is no polyA.

According to this embodiment of the present invention, make up selected primordial plant expression vector except the pBI121 expression vector, can also select pCAMBIA serial carrier or other constructed plant expression vector such as pGPTV series commonly used of those skilled in the art of CAMBIA company for use, pCB series etc.The marker gene of these plant expression vectors is hptII, NPTII and bar.The coded product of HptII gene provides the hygromycin resistance function, and the coded product of NPTII gene provides the kalamycin resistance function, and the coded product of bar gene provides the Herbicid resistant function.

In one embodiment of the invention, the BcDh2 gene places Ubiquitin (5 ' end control region of ubiquitin protein gene, constitutive expression in monocotyledons) under the regulation and control of promotor, made up and be suitable for monocotyledonous plant expression vector pAHC-BcDh2.The BcDh2 gene coding region that is connected on pGEM -T Easy carrier is scaled off with Nco I and Sac I, be connected on the prokaryotic expression carrier pET-30a that handled with Nco I and Sac I, the proteic plasmid pET-30aBcDh2 of construction expression BcDh2, transformed into escherichia coli E.coli DH5 α bacterial strain screens correct clone.With Bgl II and Sac I digested plasmid p30aBcDh2, reclaim the BcDh2 fragment, it is connected among the plasmid pAHC25 that digested with BamH I and Sac I forms pAHC-BcDh2.Therefore this expression vector can not transform plant by agrobacterium mediation method owing to do not have LB (Left Border), RB (RightBorder), and takes the method for particle gun to transform plant.

According to this embodiment of the present invention, the promotor of BcDh2 gene is Ubiquitin, and terminator is Tnos; The selection markers gene is Bar, and the promotor of bar gene also is Ubiquitin, and terminator is Tnos.

In one embodiment of the invention, the BcDh2 gene places under the regulation and control of Ubiquitin promotor, has made up the plant binary expression vector p3ubiBcDh2 that is suitable for Agrobacterium-mediated Transformation.Cut pTRD with Apa I, mend and put down, downcut ubiquitin promotor (2.0kb) with SpeI, subclone obtains plasmid pBRD between pBluescript KS (+) EcoR V and Spe I site; PBRD connects with Xba I and Sac I and gets plasmid pBRDI from BcDh2 (0.7kb) fragment that plasmid pT-BcDh2 downcuts after digesting with Xba I and Sac I; With HindIII and Sac I digestion pBRDI, reclaim ubiquitin promotor and BcDh2 gene Fusion fragment (2.9kb), it is connected with the big fragment that Sac I digestion pCAMBIA3300 reclaims with Hind III, obtains the plant binary expression vector p3ubiBcDh2 of ubiquitin promoters driven BcDh2 gene.

According to this embodiment of the present invention, the promotor of BcDh2 gene is Ubiquitin, and terminator is Tnos; The selection markers gene is Bar, and the promotor of bar gene is 2xCaMV35S, and terminator is Tnos.

According to this embodiment of the present invention, this plant expression vector both can pass through the agrobacterium mediation method genetic transformation plant, can also transform plant by the method for particle gun.

According to this embodiment of the present invention, make up the pCAMBIA3300 expression vector that selected primordial plant expression vector is a CAMBIA company, its plant screening mark gene is Bar, and the coded product of bar gene provides weedicide (careless fourth phosphine) resistance function.

According to this embodiment of the present invention, make up selected primordial plant expression vector except the pCAMBIA3300 expression vector of CAMBIA company, can also select other expression vector or other constructed plant expression vector such as pGPTV series commonly used of those skilled in the art of CAMBIA company for use, pBI series pCB series etc.

In one embodiment of the invention, the method for plant expression vector importing Agrobacterium is a freeze-thaw method.Freeze-thaw method is the technological operation that those skilled in the art are familiar with very much, is not key of the present invention.Detect the male agrobacterium strains by PCR, be used for transformation of tobacco, turfgrass and herbage.

According to this embodiment of the present invention, selected agrobacterium strains is LBA4404.

According to this embodiment of the present invention, selected agrobacterium strains also should comprise other bacterial strain of Agrobacterium except LBA4404.The feature of these bacterial strains is itself to contain Vir toxic protein district, and the T-DNA in the plant expression vector that can help to change over to transfers in the genome of plant.

In one embodiment of the invention, a kind of method of transformation of tobacco, turfgrass and herbage is an agrobacterium-mediated transformation.

According to this embodiment of the present invention, the used microbiotic of foliage filter screening also comprises weedicide except kantlex, specifically selects for use which kind of screening to see and selects the pairing marker gene of plant expression vector for use.As select for use the pBI121BcDh2 carrier then selection markers be kantlex (Km), select for use pAHC-BcDh2 and p3ubiBcDh2 carrier then selection markers be weedicide.

In one embodiment of the invention, the another kind of method of conversion turfgrass and herbage is a particle bombardment.

According to this embodiment of the present invention, the vector plasmid that is used for the particle gun conversion mainly is pAHC-BcDh2 and p3ubiBcDh2.The foliage filter screening mark of these two kinds of carriers is weedicide.

The present invention is used for the actual method for transformation of target plant except agrobacterium-mediated transformation and particle bombardment, can also use various transformation technology well-known to those skilled in the art that recombinant DNA sequence is imported target vegetable cell to be transformed.These methods are including but not limited to agrobacterium-mediated transformation, microprojectile bombardment methods (being particle bombardment), and microinjection, coprecipitation method, electroporation, and ovary injection plant fertilization blastular method etc.Those skilled in the art can be by obtaining details with reference to relevant document.Preferably make in the stable genome that is incorporated into the target vegetable cell of the sequence that transformed, thereby it is not lost in the process that goes down to posterity.In addition, the nucleotide sequence that is used to transform the target plant can be with linearity, and the form of annular or other recombinant vectors such as the form of artificial chromosome exist.

Beneficial effect of the present invention:

The BcDh2 gene is subjected to arid and cold abduction delivering; the dehydration of its proteins encoded plain under the plant arid situation with cell in some glycitols small molecules synergies; protection cytolemma and biomacromolecule, thus vegetable cell opposing drought stress helped, improve the drought tolerance of plant.Behind BcDh2 gene importing turfgrass and forage grass, can effectively improve the drought-enduring water retention capacity of transgenic plant.Transgenic line is compared with the contrast of transgenosis not strain system under isolated condition, and moisture holding capacity improves that moisture holding capacity improves 22～50% after 20～33%, 9 hours after 6 hours.Transgenic line is than not transgenosis contrast water saving 25～40% under the field planting condition.

Four, Brief Description Of Drawings:

Fig. 1 is the diagrammatic sketch that expression plant expression vector pAHC-BcDh2 makes up flow process.

Fig. 2 is the diagrammatic sketch of expression plant expression vector p3ubiBcDh2.

Fig. 3 is that the PCR of BcDh2 gene transformation turfgrass and herbage detects.

The amplified band size is 0.7kb among the figure, and electrophoresis band is from left to right numbered and is followed successively by M, 1,2,3,4.M represents molecule marker Marker, and 1 is negative contrast, and 2 is over against photograph, and 3,4 is different transgenic lines.

Fig. 4 is that the Southern of BcDh2 gene transformation turfgrass and herbage detects.

The bands of a spectrum size is 0.7kb among the figure, and from left to right numbering is followed successively by 1,2,3,4,5.1 is over against photograph, and 5 are negative contrast, and 2,3,4 is different transgenic lines.

Fig. 5 is that the Northern boltting that changes BcDh2 gene turfgrass and herbage detects.

The bands of a spectrum size is 0.7kb among the figure, and from left to right numbering is followed successively by 1,2,3,4.1 is negative contrast, and 4 is over against photograph, and 2,3 is different transgenic lines.

Fig. 6 is the moisture holding capacity curve that changes BcDh2 gene turfgrass and herbage.

X-coordinate is the excised leaf hours, and ordinate zou is a leaf water content per-cent.◆ the contrast of expression non-transgenic, ● ■ ▲ three kinds of different transgenic lines of expression.

Five, Embodiment:

All (Jin Dongyan etc. translate with reference to " molecular cloning: laboratory operation guide " for microbial culture among all embodiment and DNA operation, Science Press, Beijing (1993)) and " fine works molecular biology guide " (Yan Ziying etc. translate, Science Press, Beijing (1998)).Toolenzyme in the molecule manipulation such as restriction enzyme be all available from Promega company, NewEnglandBiolabs company.

The clone of embodiment 1 BcDh2 gene:

Conserved regions EKKGIMD (E) KIKEKLPG that is rich in Methionin according to the plain genoid of dehydration designs degenerated primer, with the anchor primer 43,218 5 of GSP1 and mRNA 3 ' end ' GCG GCC GCT (18) 3 '.Adopt the boea crassifolia (Boea crassifolia Hemsl.) after TRIzol reagent is handled from drought stress to extract the total RNA of blade, add DNaseI digestion and remove remaining DNA, with carrying out the PCR reaction with primer GSP1 and 43128 behind synthetic cDNA first chain of primer 43128 reverse transcriptions.Sample carries out PCR.94 ℃ of 30s according to following parameters then through 94 ℃ of pre-sex change 5min, 53 ℃ of 30s, 72 ℃ of 20s, 30 circulations; 72 ℃ are extended 10min.After agarose gel electrophoresis detected, purifying reclaimed specific fragment, is connected into pGEM -T Easy carrier, send Beijing Bo Ya biotech company to carry out sequencing.

Obtain 5 ' end of BcDh2 gene for method by 5 ' RACE, reference literature (Kimura Y et al, 1996) synthetic upstream primer (46121) 5 ' GGC CCGACGTCGCATG 3 ' and anchor primer (46122) 5 ' GGC CCGACG TCG CAT GAA TTC (12) 3 ', gene specific primer (GSP2) 5 ' TTG GAT TCT CAG TGGCAT GC 3 ' and (43514) 5 ' TAC ACT TCC TCG GTC TTC TTG 3 '.Adopt the boea crassifolia after TRIzol reagent is handled from drought stress to extract the total RNA of blade, add DNaseI digestion and remove remaining DNA, with synthetic total cDNA first chain of primer GSP1 reverse transcription, with phosphotransferase polyA is added to 5 ' end of cDNA chain behind the glass milk purifying, then the cDNA chain with tailing is the template pcr amplification.After agarose gel electrophoresis detected, purifying reclaimed specific fragment, is connected into pGEM -T Easy carrier, send Beijing Bo Ya biotech company to carry out sequencing.

The preparation of bacteria plasmid DNA:

(1) picking list colony inoculation is in containing suitable antibiotic LB liquid nutrient medium, and 37 ℃ of shaking culture are spent the night;

(2) get 1.5ml bacterium liquid in little centrifuge tube, 10, centrifugal 30 seconds of 000rpm;

(3) bacterial sediment is resuspended in the 100ul solution I (50mM sucrose, 20mM Tris.Cl (pH8.0), 10mM EDTA (pH8.0)), and the vibration mixing also left standstill several minutes;

(4) (0.2N NaCl 1%SDS), flicks mixing to the 200ul solution II of the fresh configuration of adding, places on ice 3 minutes;

(5) the 150ul solution III (60ml 5M KAc, 11.5ml glacial acetic acid, 28.5ml sterilized water) of adding precooling is flicked mixing, places on ice 5 minutes;

Centrifugal 5 minutes of (6) 12,000rpm;

(7) get supernatant liquor, add the Virahol of 1 times of volume, placed 10 minutes on ice behind the mixing;

Centrifugal 5 minutes of (8) 12,000rpm dry after the supernatant discarded a little, make it to be dissolved in the 200ul sterilized water;

(9) add the 100u17.5M ammonium acetate, placed 10 minutes on ice behind the mixing gently; In 12, centrifugal 5 minutes of 000rpm;

(10) get supernatant liquor, add the two volumes dehydrated alcohol after, on ice or-20 ℃ placed 20 minutes, 12, centrifugal 15 minutes of 000rpm;

(11) precipitation is cleaned with 70% ethanol, is dissolved in after draining in the TE buffered soln (10mM Tris.Cl (pH8.0), 1mMEDTA (pH8.0)).

The plasmid enzyme restriction condition:

In the 30ul reaction system, add 10 * enzyme cutting buffering liquid 3ul, DNA 1-5ug, restriction enzyme 1ul (10U) adds aseptic double-distilled water and mends to 30ul, and 37 ℃ were reacted 1-2 hour, and agarose gel electrophoresis detects enzyme and cuts the result.

The recovery of dna fragmentation:

(1) downcuts required dna fragmentation (volume does not surpass 100ul) from sepharose and place little centrifuge tube;

(2) add the sol solutions of 3 times of volumes, 60 ℃ of water-baths 5 minutes, the little centrifuge tube of jog makes glue dissolve fully for several times therebetween;

(3) add 10ul glass milk, use the sample injector mixing.Room temperature left standstill 5 minutes;

(4) centrifugal, 3, the 000rpm several seconds, inhale and abandon supernatant;

(5) add 125ul rinsing liquid, mixing.The centrifugal supernatant of abandoning;

(6) repeating the 5th goes on foot twice;

(7) add an amount of sterile distilled water or TE damping fluid, mixing;

(8) 60 ℃ of water-baths 5 minutes;

The centrifugal several seconds of (9) 15,000rpm.The recovery supernatant is standby.Connect:

The insertion fragment and the carrier segments that add 5: 1 proportionals in the 10ul reaction system, 1 T4DNA of unit ligase enzyme was placed about 10 hours for 16 ℃.

The preparation of competent escherichia coli cell:

(1) the single colony inoculation of picking E.coli DH5 α is in the 100ml liquid nutrient medium, and 37 ℃ are cultured to OD600 about 0.4;

(2) ice bath is 10 minutes, be sub-packed in the aseptic centrifuge tube, and 4 ℃, 4, centrifugal 5 minutes collecting cells of 000rpm;

(3) be resuspended in the 0.1M CaCl that 600ul ices precooling ₂In, ice bath 30 minutes;

(4) 4 ℃, 4, centrifugal 10 minutes collecting cells of 000g.0.1M CaCl with the 100ul precooling ₂The re-suspended cell precipitation, stand-by.

The conversion of competent cell:

(1) get the 100ul competent cell and add 5ul connection product, mixing is iced and was put 30 minutes gently;

(2) heat shock 90 seconds in 42 ℃ of water placed rapidly cooled on ice 1-2 minute;

(3) add 200ul LB liquid nutrient medium, 37 ℃ of shaking culture 45 minutes to 1 hour;

(4) evenly coat and contain on the suitable antibiotic LB flat board, be inverted overnight incubation for 37 ℃.

The screening of recombinant plasmid and evaluation:

A. blue hickie screening: for the recombinant plasmid that contains the lacZ gene on the carrier, can utilize x-Gal/IPTG to select substratum to carry out preliminary screening, do not insert the segmental recirculation plasmid of external source bacterium colony for blue, inserting segmental recombinant plasmid transformed of external source is white colony;

B. enzyme is cut evaluation: picking list bacterium colony is in containing suitable antibiotic 3ml LB liquid nutrient medium, and 37 ℃ of overnight incubation are extracted plasmid DNA, carry out enzyme with suitable restriction enzyme and cut to judge whether positive clone;

C.PCR detects: with the plasmid DNA is template, does pcr amplification reaction under proper condition with specific primer, and whether electrophoresis detection has specific band.

The clone of embodiment 2 BcDh2 gene 5 ' end control region BcDh2P promotors:

The total DNA of boea crassifolia cuts with BamH I, Bgl II, Bcl I, Xho I and Sal I enzyme respectively, connect corresponding joint, have only the total DNA of boea crassifolia that handles through Xho I can amplify special segment behind the two-wheeled PCR, this fragment agarose gel electrophoresis recovery is connected on pGEM -T Easy carrier screening positive clone and order-checking.The BcDh2 upstream region of gene regulation and control head of district that chromosome walking method obtains is 1084bp.This promoters driven gus reporter gene is made up plant expression vector,, detect the activity of gus gene, find that this promotor can be subjected to inducing of arid, cold and ABA by different treatment such as arid, cold and ABA induce.

Related plasmid extracts in the operating process, enzyme is cut, reclaim, the enzyme of connection, cell transformation, recombinant plasmid is cut and identified and PCR identifies and all carries out according to embodiment 1 described step.

The structure of embodiment 3 BcDh2P promoters driven gus reporter gene plant expression vectors:

The BcDh2 upstream region of gene regulation and control head of district who obtains by chromosome walking method is 1084bp.This promoters driven gus reporter gene is made up plant expression vector,, detect the activity of gus gene, find that this promotor can be subjected to inducing of arid, cold and ABA by different treatment such as arid, cold and ABA induce.GUS tissue staining demonstration transfer-gen plant is induced following GUS positive reaction (dyeing blueness) at arid, cold and ABA.

The structure of embodiment 4 plant expression vector pBI121BcDh2:

The BcDh2 gene coding region that is connected on pGEM -T Easy carrier is scaled off with Nco I and Sac I, be connected on the prokaryotic expression carrier pET-30a that handled with Nco I and Sac I, the proteic plasmid pET-30aBcDh2 of construction expression BcDh2, transformed into escherichia coli E.coli DH5 α bacterial strain screens correct clone.With Bgl II and Sac I digested plasmid p30aBcDh2, reclaim the BcDh2 fragment, it is connected among the plasmid pBI121 that digested with BamH I and Sac I, form pBI121BcDh2.

Related plasmid extracts in the operating process, enzyme is cut, reclaim, the enzyme of connection, cell transformation, recombinant plasmid is cut and identified and PCR identifies and all carries out according to embodiment 1 described step.

The structure of embodiment 5 plant expression vector pAHC-BcDh2:

The BcDh2 gene coding region that is connected on pGEM -T Easy carrier is scaled off with Nco I and Sac I, be connected on the prokaryotic expression carrier pET-30a that handled with Nco I and Sac I, the proteic plasmid pET-30aBcDh2 of construction expression BcDh2, transformed into escherichia coli E.coli DH5 α bacterial strain screens correct clone.With Bgl II and Sac I digested plasmid p30aBcDh2, reclaim the BcDh2 fragment, it is connected among the plasmid pAHC25 that digested with BamH I and Sac I forms pAHC-BcDh2.

Related plasmid extracts in the operating process, enzyme is cut, reclaim, the enzyme of connection, cell transformation, recombinant plasmid is cut and identified and PCR identifies and all carries out according to embodiment 1 described step.

The structure of embodiment 6 plant expression vector p3ubiBcDh2:

Cut pTRD with Apa I, mend and put down, downcut ubiquitin promotor (2.0kb) with Spe I, subclone obtains plasmid pBRD between pBluescriptKS (+) EcoR V and Spe I site; PBRD connects with XbaI and Sac I and gets plasmid pBRDI from BcDh2 (0.7kb) fragment that plasmid pT-BcDh2 downcuts after digesting with Xba I and Sac I; With Hind III and Sac I digestion pBRDI, reclaim ubiquitin promotor and BcDh2 gene Fusion fragment (2.9kb), it is connected with the big fragment that Sac I digestion pCAMBIA3300 reclaims with HindIII, obtains the plant binary expression vector p3ubiBcDh2 of ubiquitin promoters driven BcDh2 gene.

Related plasmid extracts in the operating process, enzyme is cut, reclaim, the enzyme of connection, cell transformation, recombinant plasmid is cut and identified and PCR identifies and all carries out according to embodiment 1 described step.

The conversion of embodiment 7 soil Agrobacteriums:

The competent preparation of soil Agrobacterium:

(1) soil Agrobacterium bacterial strain LBA4404 is inoculated in contains in the suitable antibiotic YEB liquid nutrient medium, 28 ℃ of shaking culture are to logarithmic phase;

(2) 4 ℃, 8, centrifugal 5 minutes of 000rpm collects thalline in little centrifuge tube;

(3) with the resuspended washed cell of 500mM CaCl2 of 600ul ice precooling;

(4) 4 ℃, 8, centrifugal 5 minutes of 000rpm adds the 500mM CaCl2 that 200ul ices precooling in the cell precipitation, standby behind the mixing (24hr to 48hr uses best);

The conversion of soil Agrobacterium:

(1) add the plant expression carrier plasmid DNA that about 1ug builds respectively, mixing gently, quick-frozen is 5 minutes in liquid nitrogen, and 37 ℃ of incubations are 5 minutes then;

(2) add 600ul YEB liquid nutrient medium, 28 ℃ jog 2-4 hour;

(3) get 200ul bacterium liquid and evenly coat and contain suitable antibiotic YEB and select on the flat board, be inverted for 28 ℃ and cultivated two days.Choose several bacterium colonies and carry out the PCR detection, obtain positive strain.

Genetic transformation and the plant regeneration of embodiment 8 tobaccos:

The genetic transformation of tobacco adopts Ye Panfa.

Leaf dish method transformation of tobacco and plant regeneration

(1) the single bacterium colony of inoculation Agrobacterium was cultivated 1-2 days for 28 ℃ in containing suitable antibiotic 2ml YEB liquid nutrient medium, and switching is gone in the 40ml YEB liquid nutrient medium, 28 ℃ are continued to be cultured to OD600 about 0.5,8, centrifugal 10 minutes of 000g, thalline suspends again with 40ml MS liquid nutrient medium.

(2) get aseptic tobacco leaf and do not contain the stem section of axillalry bud, 25 ℃ of pre-cultivations one day in the MS solid medium.

(3) retrieve material, be cut into small pieces with scissors and put into the Agrobacterium that aseptic MS liquid nutrient medium diluted, soaked 15-20 minute, jog several times therebetween.

(4) remove unnecessary bacterium liquid with the aseptic filter paper suction, 25 ℃ of dark cultivations two days in tobacco substratum [MS+BA (0.5)+NAA (0.1)+Km (5.0)+Cb (500), unit is mg/L].

(5) material is changed in the tobacco substratum [MS+BA (0.5)+NAA (0.1)+Km (5.0), unit is mg/L], 25 ℃ of illumination cultivation are to differentiating callus, until growing bud; Every 14-20 days succeeding transfer culture once;

(6) bud that will grow to 3-5cm changes tobacco root media [1/2MS substratum] over to and goes up root induction;

(7) about 2-3 root system formation after week is transplanted in the soil of sterilization and is cultivated.

PCR detects and Southern detects proof BcDh2 gene integration in the genome of tobacco, Northern boltting detects proof BcDh2 gene normal transcription in transgenic plant, and moisture holding capacity mensuration demonstration transgenic line ratio not transgenosis contrast moisture holding capacity obviously improves.

The genetic transformation of 9 pairs of turfgrasss of embodiment and herbage:

Agrobacterium-mediated transformation:

(1) after mature seed is sterilized with 0.1% mercuric chloride, be connected to earlier on the N6 minimum medium, allow it sprout 3 days, when exposing budlet, to transfer after the embryo rip cutting on the evoked callus substratum, after forming callus (about about 30 days), select color and luster aquatic foods, fast, the hard callus succeeding transfer culture of quality of propagation at every turn.

(2) the single bacterium colony of inoculation Agrobacterium was cultivated 1-2 days for 28 ℃ in containing suitable antibiotic 2ml YEB liquid nutrient medium, and switching is gone in the 40ml YEB liquid nutrient medium, 28 ℃ are continued to be cultured to OD600 about 0.5,8, centrifugal 10 minutes of 000g, thalline suspends again with 40ml MS liquid nutrient medium.

(3) retrieve material, be cut into small pieces with scissors and put into the Agrobacterium that aseptic MS liquid nutrient medium diluted, soaked 15-20 minute, jog several times therebetween.

(4) remove unnecessary bacterium liquid with the aseptic filter paper suction, 25 ℃ of dark cultivations two days in tobacco substratum [N6+BA (0.5)+NAA (0.1)+Km (5.0)+Cb (500), unit is mg/L].

(5) material is changed in the tobacco substratum [N6+BA (0.5)+NAA (0.1)+Km (5.0), unit is mg/L], 25 ℃ of illumination cultivation are to differentiating callus, until growing bud; Every 14-20 days succeeding transfer culture once;

(6) bud that will grow to 3-5cm changes tobacco root media [1/2MS substratum] over to and goes up root induction;

(7) about 2-3 root system formation after week is transplanted in the soil of sterilization and is cultivated.

Particle bombardment:

Conversion process comprises that seed or young fringe (comprise lawn plant such as annual bluegrass, Festuca Arundinacea, rye grass, red fescue, cut a gang Ying, jielu grass, Bermuda grass and herbage such as clover, prairie milk vetch, Root or stem of Littleleaf Indianmulberry, Herba Eragrostidis pilosae, wheatgrass) evoked callus, particle gun bombardment, kanamycin-resistant callus tissue screening, the differentiation of seedling, plant identify.

The step of seed callus induction: after mature seed is sterilized with 0.1% mercuric chloride, be connected to earlier on the MS minimum medium, allow it sprout 3 days, when exposing budlet, to transfer after the embryo rip cutting on the evoked callus substratum, after forming callus (about about 30 days), select color and luster aquatic foods, fast, the hard callus succeeding transfer culture of quality of propagation, the subculture callus can transform for particle gun at every turn;

The step of children's fringe callus induction: get the young fringe that is about about 0.2～1cm, after 70% ethanol surface sterilization, strip out young fringe in super clean bench, be inoculated in and induce on the inducing culture, after the formation callus, per 20 days succeeding transfer culture once transform for particle gun; The conversion of particle gun and the differentiation of seedling: plasmid: the plasmid concentration of extraction is adjusted into 1 μ g/ μ L.The bullet preparation: 30mg bronze or tungsten powder add 1mL 100% ethanol vortex washing 15 minutes, aseptic washing 3 times, and it is standby to add 500 μ L, 50% glycerine.Get above-mentioned tungsten or bronze suspension 50 μ L, add 5 μ L DNA, add 50 μ L 2.5M CaCl2, add 20 μ L 0.1M spermidines, vortex left standstill the centrifugal several seconds on ice 15 minutes, 70% ethanol, 142 μ L wash once, the centrifugal several seconds, 100%140 μ L ethanol are washed once the centrifugal several seconds, add 50 μ L, 100% ethanol, use for 5 rifles.

Film can be split for examination particle gun: PDS-1000/He (Bio Rad Laboratories) particle gun and film can be split with 1350Psi, vacuum tightness 25 InHg, the 6cm shooting distance, every ware is shot a rifle.Callus before the gunslinging was cultivated on the subculture medium that contains 0.4M N.F,USP MANNITOL 4～8 hours, and gunslinging moves into normal subculture medium after 16 hours.Callus after the gunslinging goes to the subculture screening 2～4 that contains weedicide 2-5mg/L and takes turns every the wheel 20 days after one week.The resistant calli that obtains after the screening changes in the substratum that contains 50g sugar, and illumination cultivation 20 days changes over to then and removes 2, seedling differentiation in the division culture medium of 4-D.When seedling length arrived 4-5 sheet leaf, the blade that takes a morsel extracted the total DNA of plant, carried out PCR and detected.Seedling grows to 5～10cm when size, moves into vermiculite: pine soil is that after plastics bag was incubated a week, seedling promptly survived in 1: 1 the soil.

The evaluation and the detection of embodiment 10 transfer-gen plants:

The preparation of plant genome DNA

(1) takes by weighing 0.1g plant leaf or stem tissue, in mortar, grind to powder with liquid nitrogen fast and change in the 1.5ml centrifuge tube, add extraction damping fluid (the 500mM NaCl of 500ul immediately, 50mM Tris-Cl PH8.0,50mM EDTA, 1% (V/V) beta-mercaptoethanol), mixing gently;

(2) be positioned on ice after thawing, add ice-cold 20% storage solution PVP (being stored in-20 ℃) to final concentration be 6%.

(3) add 50ul 20%SDS, gently behind the mixing in 65 ℃ of water-baths 10 minutes;

(4) add 250ul 5M KAc in reacting 30 minutes centrifugal (15000rpm, 10 minutes, 4 ℃) on ice.

(5) get and change a new centrifuge tube mutually over to, add 0.6 times of volume Virahol, mixing is three times gently, places 10 minutes on ice again.Centrifugal (15000rpm, 10 minutes, 4 ℃), supernatant discarded;

(6) throw out vacuumizes or after room temperature dries up, is dissolved in 500ul 1 * TE (pH8.0).Saturated phenol with 1 times of volume: chloroform: primary isoamyl alcohol (25: 24: 1) extracting one to twice, get phase;

(7) centrifugal (12000rpm, 10 minutes, 20 ℃) are got and are changed a new centrifuge tube mutually over to;

(8) add the Virahol (20 ℃, 5 minutes) of 1 times of volume, and will manage and put upside down 5 times at least;

(9) centrifugal (15000rpm, 10 minutes, 4 ℃) with 70% alcohol flushing throw out, vacuumize or dry up, and are dissolved at last among an amount of TE (pH8.0).

The PCR of transgenic turf grass and herbage identifies:

After obtaining antibiotic-screening male transgenic turf grass and herbage (annual bluegrass, Festuca Arundinacea, rye grass, red fescue, cut a gang Ying, jielu grass, Bermuda grass, clover, prairie milk vetch, Root or stem of Littleleaf Indianmulberry, Herba Eragrostidis pilosae, wheatgrass), at early growth period, get rotaring gene plant blade and also carry out the PCR evaluation, with synthetic BcDh2 gene-specific primer with total DNA of SDS method extraction plant

(p1:5 ' AGGATCCATATGGAGCCATACGGGAACCA 3 '; P2:5 ' GGCAG GTATGCTCGGACACA 3 ') carries out pcr amplification, can obtain the band of about 700bp, illustrate that the BcDh2 gene has been integrated into the genome of transfer-gen plant.(see Fig. 5: the PCR of transgenic turf grass and herbage identifies)

The Southern of embodiment 11 transfer-gen plants detects:

Enzyme is cut and electrophoresis

Extract the total DNA of plant, get 10ug and spend the night with digestion with restriction enzyme, whether enzyme cut full electrophoresis detection, with 3V/cm constant voltage electrophoresis 4-6 hour.

Change film

(1) well of gel and the redundance that do not contain sample are cut away, in 0.25M HCl, soaked 10 minutes;

(2) wash slightly with distilled water after, be dipped in the sex change liquid (0.5M NaOH, 1.5M NaCl) the room temperature sex change 2 times, each 15 minutes, jog for several times therebetween;

(3) wash slightly with distilled water after, be dipped in the neutralizer (0.5M Tris.Cl, pH7.4,1.5M NaCl) in room temperature and 2 times, each 15 minutes, jog for several times therebetween;

(4) wash slightly with distilled water after, be dipped in 10 * SSC buffered soln 10 minutes, jog for several times therebetween;

(5) in a container that can seal more greatly, change film;

(6) spread the thieving paper of 4-7cm at this container bottom, spread three layers in the above and dipped in wet Whatman 3MM filter paper slightly by 10 * SSC buffered soln;

(7) gel piece excises one jiao of marking and faces up and be put on the filter paper, catches up with except that bubble;

(8) five Whatman 3MM filter paper that soak into 10 * SSC buffered soln fully in shop above, sealed vessel changeed film about 4 hours;

(9) after the commentaries on classics film finishes nylon membrane is dried in air, carry out crosslinked with UV-crosslinked instrument.

The mark of probe and preparation

In the 50ul reaction system, add 5ul 10 * PCR buffer, each 50pmol primer, 1ul dNTP, 1ul Taq enzyme, 0.1ul DIG-labeled-dUTP, 100pg template DNA.Reaction conditions has change slightly according to different templates.Reaction finishes rear electrophoresis and detects, and the probe behind the mark is bigger than the molecular weight of product that does not have mark.95 ℃ were boiled 5 minutes, moved to rapidly in the frozen water, and-20 ℃ of preservations are standby.

Hybridization and detection

(1) nylon membrane after will shifting places hybridization bag, is put in (10ml/100cm in the prehybridization solution ²Film), catch up with most bubble, 68 ℃ are incubated 4 hours;

(2) discard prehybridization solution, press 2.5ml/100cm ²The amount of film adds hybridization solution, contains the probe (2ulDIG probe/1ml hybridization solution) of DIG mark in the hybridization solution, hybridizes 16 hours for 68 ℃;

(3) (2 * SSC 0.1%SDS) washed film 2 * 5 minutes with 2 * rinsing liquid;

(4) (0.1 * SSC 0.1%SDS) washed film 2 * 15 minutes for 68 ℃ with 0.1 * rinsing liquid;

(5) with film balance 1 minute in Buffer I (0.15M NaCl, 0.1M toxilic acid are transferred pH=7.5);

(6) room temperature jog 30 minutes in Buffer II (among the Buffer I add 1% encapsulant);

(7) get anti-DIG-AP, centrifugal 5 minutes of 13000rpm was diluted among the Buffer II by 1: 2000, got this solution soaking nylon membrane of 20ml, room temperature jog 30 minutes.

(8) washed film 2 * 15 minutes with 20mlBuffer I.

(9) at Buffer III (0.1M Tris-HCl pH9.5,0.1M NaCl, 0.15M MgCl ₂) middle balance 2-5 minute;

(10) be diluted among the Buffer III detecting substrate by 1: 500,, after the expection band manifests, use Buffer I termination reaction immediately film dark place standing and reacting at room temperature.

The moisture holding capacity of embodiment 12 transgenic lines is measured:

Take by weighing 0.2g transgenosis and control sample and place moisture eliminator, (3hr, 6hr 9hr) measured its weight, 24 hours gravimetries again in per 3 hours.

Calculate the moisture holding capacity value: (1-fluid loss/fresh weight) * 100%

Choose have Herbicid resistant, PCR identifies and Southern male transfer-gen plant and not the transgenosis contrast carry out moisture holding capacity and measure.The result shows that the moisture holding capacity under isolated condition of different transgenic lines all is higher than contrast (seeing Table 1), and moisture holding capacity improves moisture holding capacity raising 22～50% after 20～33%, 9 hours after 6 hours.

The water saving ability test of embodiment 13 different transgenic turf grass and herbage strain system:

With different transgenic turf grass and herbage strain system and not the transgenosis contrast all place non-irrigated canopy (to prevent natural rainfall, can be by man-made irrigation control confluent) to test plant, through watering water of foot after 7～10 days the hardening simultaneously, no longer accept natural and artificial rainmaking afterwards, begin to occur moderate up to plant leaf and wilt.Measure the not fate of homophyletic system wilting, water saving per-cent=[(transgenic line wilting fate-contrast strain is the wilting fate)/contrast strain is the wilting fate] * 100%

Add up the water saving per-cent of different transgenic lines, discovery transgenic line ratio not transgenosis contrast can economize on water 25～40%.(seeing Table 2)

Table 1: the strain of different commentaries on classics BcDh2 gene plant ties up to 3,6,9,24 hours moisture holding capacity

3 hours 6 hours 9 hours 24 hours

CK?????????????83％?????58.5％???46％?????20％

Homophyletic is not 93.5% 71.9% 60.1% 24%

Homophyletic is not 98.4% 78.6% 68% 30.4%

Homophyletic is not 90% 65.5% 54% 24%

Table 2: the water saving per-cent of different transgenic lines

The transgenic plant title	Tried strain and be 1 water saving per-cent	Tried strain and be 2 water saving per-cent	Tried strain and be 3 water saving per-cent	Tried strain system average water saving per-cent
					Annual bluegrass	???27.4％	????30.5％	????31.8％	????29.9％
Festuca Arundinacea	???24.5％	????25.2％	????25.3％	????25.0％
					Rye grass	???41.3％	????38.3％	????40.1％	????39.9％
Red fescue	???37.6％	????31.7％	????28.8％	????32.7％
					Cut a gang Ying	???25.7％	????30.1％	????30.0％	????28.6％
Jielu grass	???28.6％	????24.3％	????26.6％	????26.5％
					Bermuda grass	???30.2％	????25.4％	????28.1％	????27.9％
Clover	???35.3％	????29.7％	????34.0％	????33.0％
					Prairie milk vetch	???27.5％	????24.8％	????30.5％	????27.6％
Root or stem of Littleleaf Indianmulberry	???28.7％	????29.4％	????36.1％	????31.4％
					Herba Eragrostidis pilosae	???25.3％	????27.8％	????22.5％	????25.2％
Wheatgrass	???30.2％	????27.3％	????27.7％	????28.4％

Table 3 Agrobacterium YEB culture medium prescription

Every liter of content of composition (gram)

Extractum carnis extract 5.0

Yeast extract 1.0

Peptone 5.0

Sucrose 5.0

MgSO ₄.7H ₂O??????????????0.5

Agar (solid medium is used) 10

Table 4 tobacco tissue culture MS substratum

Every liter of content of composition

(division culture medium)

10x MS macroelement mother liquor 100ml

100x MS trace element mother liquor 10ml

100x mother liquid of iron salt 10ml

100x VITAMIN mother liquor 10ml

1mg/ml 6-benzyladenine 1.0ml

1mg/ml naphthylacetic acid 0.1ml

Agar 9 grams

PH5.8

(root media)

10x MS macroelement mother liquor 100ml

100x MS trace element mother liquor 10ml

100x mother liquid of iron salt 10ml

100x VITAMIN mother liquor 10ml

Agar 9 grams

PH5.8

Table 5 turfgrass and herbage tissue culture N6 substratum

Unit: mg/L (every liter of milligram)

Inorganic salt	KNO 3	?2830	Molysite	Na2·EDTA	37.3
						(NH 4) 2SO 4	?463	FeSO4·7H2O	27.8
	MgSO 4·7H 2O	?185		VITAMIN	Nicotinic acid					0.5
			KH 2PO 4			?400	Gly	2
	CaCl 2·2H 2O	?166			The hydrochloric acid thiamine				1.0
			MnSO 4·4H 2O			?4.4	Pyridoxine hydrochloride	0.5
	ZnSO 4·7H 2O	?1.5			KI				0.8
			H 3BO 3			?1.6	Sucrose			50000

Six, The explanation of patent bacterial classification:

The bacterial classification that this patent relates to is in China Committee for Culture Collection of Microorganisms's common micro-organisms center preservation, Zhong Guan-cun, unit address BeiJing, China, this microorganism classification name is called colon bacillus (Escherichia coli (DH5 α)), the preservation code name is pT-BcDh2, deposit number is CGMCCNO.0838, and preservation date is on November 22nd, 2002.

In a word, the present invention has cloned a new dehydrin gene BcDh2 and its promotor BcDh2P, and utilizes this gene constructed a plurality of plant expression vectors, has obtained drought-enduring water saving transgenic plant by agriculture bacillus mediated and particle bombardment genetic transformation.PCR detects and Southern detects this gene integration of proof in the transfer-gen plant genome, Northern Blotting detects this gene of proof and can efficiently express in plant, moisture holding capacity mensuration and water saving ability test prove that all the transgenic line comparison is according to having significantly improved drought tolerance, significant in lawn and animal husbandry, and can amplify production on a large scale.

＜110〉Lin Zhongping

＜120〉dehydrin gene BcDh2 and promotor thereof the application in cultivating drought-enduring plant

<150>CN02153276.1

<151>2002-11-26

<160>2

<210>1

<211>402

<212>DNA

＜213〉the outstanding capsule lettuce tongue (Boea crassifolia Hemsl.) of thick leaf

<220>

<221>CDS

<222>(1)...(402)

<400>1

atggagccat?acgggaacca?ccaaattggt?gaccaattga?ggaagactga?tgagtatggc?60

aaccccgtcc?accacacgcc?tggaggagaa?tacggcggac?ctcatgttgg?agccgaacat?120

caccatggtg?ctcctatttc?gattcccccc?accaccgatg?tcccccacca?ccgtcgatcc?180

ggcagctcaa?gcagctcgtc?ttctgaggac?gacgggcaag?gtggtaggag?aaagaagggg?240

atcaaggaca?aggtcaagga?gaagctaccc?ggcggccaca?aagacaacca?gccacatcac?300

gaagcgggat?acggcggagg?ctacggcgcg?caaccagaac?ctgagaagaa?ggggatgatg?360

gacaaaatca?aggagaaact?gcctggcggc?caccacaact?aa????????????????????402

<210>2

<211>1084

<212>DNA

＜213〉the outstanding capsule lettuce tongue (Boea crassifolia Hemsl.) of thick leaf

<220>

<221>Promoter

<222>(1)...(1084)

<400>2

ggatccgtat?ggacatttct?atactatgaa?aatccttttg?agtggttcaa?cagatgtcgg?60

atcgagaaaa?agaattttac?tgttgacaac?tgtcgagttt?ggtttgggaa?ccatctcaag?120

ctaaaatatt?tcgaaaagag?tttcaagagt?ttattcacgt?aatttaaatt?ctgaacccga?180

tcctaacagt?gtaagtaaat?tcagtagaag?tttatatact?tcggtgcttg?gttgatgaat?240

aaatttcgtt?gaaaggcaac?tgattaaaca?aacgtagaac?tgaaggtata?ttagacctat?300

atatccacgt?gagtgttcca?tgttaagaga?aacacaatcc?tacacgagtc?atgggcactg?360

ggcagtctgg?aatgggtaga?gttgtaattt?cacaatattt?ccccatcaat?ttgatcgatt?420

ttgagtttta?atctaataaa?ttttcaaaat?tcgattttaa?taaaatattt?ttaattttta?480

tgcattttga?tcaaattatt?aatatgacat?cgataaatat?taaaataaca?acgaaaaata?540

atgatattac?atcgaaaaat?actaatatca?tataaaatat?tgttaagtaa?ttagatatca?600

catcaaataa?gataaataaa?ataaccaaaa?aaaaatttaa?tataccatta?ccaactccaa?660

aattaaacaa?attaataaaa?taaaaatatc?attttccttt?cgctacaaag?aaaggtcaat?720

atccttcttt?cgaaatccag?atacatgttt?gatatattct?attattctat?caagtacacg?780

tgcccttcta?ttcggacaaa?ggccaaagtt?gcaaaagtac?acgtatccta?ataaaactta?840

gctacgtgtc?cacctacttc?gctttcatcc?gacgcttgtc?ctgtccgagc?tcattttcta?900

ttaccacctt?cacactatat?atatccctca?ctagctcgct?ttctatatca?cttgtatcac?960

gcatcactct?atcgaattgg?agctatattc?acttttgaac?atcatttcat?tttgaaacga?1020

gaaggtacga?aggctgatgg?agccatacgg?gaaccaccaa?attggtgacc?aattgaggaa?1080

gaca??????????????????????????????????????????????????????????????1084

Claims (10)

1, from the dehydrin gene BcDh2 that clones the boea crassifolia, its 5 ' end control region PBcDh2, part shown in sequence table nucleotide sequence and homologous sequence and utilize these nucleotide sequences to obtain the method for drought-enduring transgenic plant.

2, nucleotide sequence according to claim 1 is characterized in that: polypeptide of being made up of 133 amino acid of this genes encoding---one typical YSK ₂The type dehydration is plain, has a Y-section at N-terminal, and the middle part is the S-section that 7 Serines are formed, and C-terminal contains the K-section of two repeated arrangement.

3, nucleotide sequence according to claim 1 is characterized in that: this gene 5 ' end control region PBcDh2 has the 1～1084bp sequence shown in the sequence table or its partial sequence.

4, be adapted at expressing in the vegetable cell plant expression vector of dehydrin gene BcDh2.

5, plant expression vector according to claim 4 is comprising the pBI121BcDh2 carrier of mentioning in the specification sheets, pAHC-BcDh2 carrier, p3ubiBcDh2 carrier.

6, according to claim 4 and 5 described plant expression vectors, the pBI121BcDh2 carrier is characterised in that: the promotor that drives the BcDh2 gene is CaMV35S, and terminator is Tnos, and selection markers is the NPTII gene, promotor is CaMV35S, and terminator is CaMV35S polyA.

7, according to claim 4 and 5 described plant expression vectors, the pAHC-BcDh2 carrier is characterised in that: the promotor that drives the BcDh2 gene is Ubiqituin, and terminator is Tnos, and selection markers is the bar gene, promotor is Ubiqittuin, and terminator is Tnos.

8, according to claim 4 and 5 described plant expression vectors, the p3ubiBcDh2 carrier is characterised in that: the promotor that drives the BcDh2 gene is Ubiqituin, terminator is Tnos, selection markers is the bar gene, promotor is Ubiqittuin, and terminator is Tnos, and there is left margin (Left Border goal gene and selection markers gene both sides, LB) and right border sequence (Right Border, RB).

9, method according to claim 1, it is characterized in that: utilize the dehydrin gene BcDh2 or its promotor PBcDh2 that obtain to make up plant expression vector, these plant expression vectors are directly imported vegetable cell by particle bombardment or by agrobacterium-mediated transformation, grow the transfer-gen plant that contains goal gene BcDh2.

10, according to claim 1 and 9 described methods, the plant of indication is meant tobacco, annual bluegrass, Festuca Arundinacea, rye grass, red fescue, cuts a gang Ying, jielu grass, Bermuda grass, clover, prairie milk vetch, Root or stem of Littleleaf Indianmulberry, Herba Eragrostidis pilosae, wheatgrass.

Images