CN115490762A

CN115490762A - Chimonanthus praecox CpCBL8 gene and coded protein and application thereof

Info

Publication number: CN115490762A
Application number: CN202210511305.3A
Authority: CN
Inventors: 李志能; 田明康; 眭顺照; 李先源; 李俊彩
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2022-05-11
Filing date: 2022-05-11
Publication date: 2022-12-20
Anticipated expiration: 2042-05-11
Also published as: CN115490762B

Abstract

The invention relates to the field of plant molecular biology, in particular to a chimonanthus nitens CpCBL8 gene, and a protein coded by the gene and application of the gene. The full length of CDS sequence of CpCBL8 gene obtained from transcriptome sequencing is designed into specific primer, calomelas leaf cDNA is used as template, PCR amplification technology is used to obtain the target fragment, the nucleotide sequence is shown as SEQ ID NO.1, and the amino acid of the encoded protein is shown as SEQ ID NO. 2. CpCBL8 is a positive regulator of salt and drought stress response and is a potential gene for improving salt and drought tolerance of Chimonanthus nitens. The chimonanthus nitens CpCBL8 heterologously expressed Arabidopsis thaliana can enhance the salt tolerance and drought tolerance of the over-expressed Arabidopsis thaliana, but can not tolerate low-temperature stress and has the function of inhibiting flower development.

Description

Chimonanthus praecox CpCBL8 gene and coded protein and application thereof

Technical Field

The invention belongs to the field of plant molecular biology, and particularly relates to a chimonanthus nitens CpCBL8 gene, and a protein coded by the gene and application of the gene.

Background

Chimonanthus praecox (Chimonanthus praecox) is a deciduous shrub of the genus Chimonanthus of the family Chimonadaceae, is known for its fragrant fragrance and color like beeswax, and is called "four friends in snow" together with camellia, narcissus and white plum. The wintersweet is a traditional rare flower and tree in China, has a cultivation history of more than one thousand years, is a rare garden plant flowering in winter, and has extremely high ornamental value and economic value.

The calyx canthus has functions of coloring and aromatizing environment. The unique phenological period enables the wintersweet to bloom in cold winter, adds color and fragrance to the winter, and is an indispensable garden plant for building landscape. Owing to its pleasant fragrance and unique flowering time, wintersweet is widely used as landscaping plant in Japan, europe and America, etc., has high ornamental value, and at the same time, it has strong adsorption action on various toxic and harmful gases, especially chlorine gas and sulfur dioxide, and is an important tree species for beautifying and purifying urban environment.

Volatile terpenoids and benzene compounds can be emitted from honey glands near the axial ends of the flower quilt sheets in the wintersweet buds, and the compounds have strong fragrance, so that the essential oil extracted from the wintersweet flowers is widely used as the main component of perfume and various seasonings, and meanwhile, the wintersweet essential oil is also rich in various bioactive components such as phenols and flavonoids compounds, and is widely used as a cosmetic raw material due to obvious functions of diminishing inflammation, resisting oxidation, preventing aging and the like; the wintersweet flowers also have important medicinal value, and the extract of the wintersweet flowers is a potential source of a natural bactericide, and is also applied to pharmaceutical engineering and mainly used for treating cough, rheumatism and measles; it is worth mentioning that the sesquiterpene compound separated and extracted from the chimonanthus nitens fruits and leaves has cytotoxicity on cancer cells, so that the sesquiterpene compound plays a role in inhibiting the growth of the cancer cells, and provides a new direction and thought for drug research and development.

In 1998, RAPD (Random amplified polymorphic DNA, RAPD) molecular marker technology is adopted by Chenlongqing and the like firstly, genetic diversity and genetic differentiation of a natural population of the Chimonanthus fragrans are analyzed from the DNA level, and important scientific basis is provided for germplasm resource preservation, introduction domestication, genetic improvement and new variety cultivation of the Chimonanthus fragrans; in 2007, ISSR (Inter-simple sequence repeat, ISSR) and RAPD molecular marker technologies are adopted for the first time to report division of wintersweet cultivation areas and genetic variation of wintersweet in different cultivation areas, important data support is provided for optimizing breeding and sampling strategies, and important theoretical basis is provided for improvement, identification and preservation of wintersweet germplasm resources; in 2009, the university of agriculture in china utilizes the AFLP (Amplified fragment length polymorphism) and the ISSR molecular marker technology to construct a first chimonanthus nitens intraspecific genetic linkage map, and the genetic map is used as a framework for QTL (Quantitative trait loci) positioning, so that important genetic information is provided for chimonanthus nitens molecular breeding; in recent years, rapid development of high-throughput sequencing technology and gene mining technology has promoted progress in analyzing differences in gene expression, novel gene mining, and gene function research, and has also promoted development of molecular breeding technology. In 2012, the Spanish row alignment and the like construct the first Chimonanthus praecox cDNA (cDNA) library of the southwest university, and the EST (Expressed sequence tag) technology is utilized to identify 95 genes related to environmental stress and plant defense and 19 genes related to flower development, so that important gene resources are provided for the research of the functional genes of the Chimonanthus praecox; subsequently, liu Daofeng and the like construct transcriptome databases of the wintersweet flowers at different periods of development, li Shi can construct transcriptome databases of the wintersweet flowers which break dormancy of the flowering buds of the wintersweet flowers at low temperature and expand the flowering buds of the wintersweet flowers, and the databases provide important data resources for research on molecular mechanisms of the development of the wintersweet flowers. In 2019 and 2020, the Nanjing forestry university and the Nelumbo academy complete chloroplast genome sequencing of the vegetarian wintersweet (C.praecox var. Contolor) and the Qingkou wintersweet (C.praecox var. Grandiflorus) in sequence, and provide important data reference and selection for genetic breeding, population genetics and research of DNA (deoxyribonucleic acid) barcodes of the wintersweet; in 2020 and 2021, shang Zhong Yao, et al and Shen Gu, et al, respectively completed genome-wide sequencing and chromosome-level assembly of Chimonanthus praecox 'H29' (C.praecox 'Hongyun'), completed the shortage of genome sequence in Chimonanthus praecox molecular biology research, provided brand-new gene reserve and data resource for analyzing the genetic background of Chimonanthus praecox, improving the ornamental character and stress resistance of Chimonanthus praecox, and opened a new chapter of Chimonanthus praecox molecular biology research.

Most of the existing research on CBL families is related to adversity stress, and few reports are made on the research on the flower development regulation of CBL family members. In the early stage of the subject group, transcriptome sequencing is carried out on the chimonanthus nitens, and a transcriptome database which breaks dormancy of chimonanthus nitens flower buds at low temperature and expands the chimonanthus nitens flower buds is constructed. When the expression patterns of all CBL family members in the database at different growth stages of the wintersweet flowers are analyzed, 1 key gene in all transcripts of the CBL is found, and the expression quantity of the key gene is obviously different at different growth stages of the wintersweet flowers, so that the gene is suspected to be possibly involved in flowering phase regulation, and meanwhile, the expression quantity of the key gene is also obviously changed at different stages of cold accumulation required by the wintersweet flower buds, and the key gene is presumed to be possibly induced by low temperature and participate in responding to low-temperature stress.

In order to verify the function of the gene, firstly, screening and identifying the CBL family members of the chimonanthus nitens on the genome level to obtain all CBL family member sequences of the chimonanthus nitens, then, renaming the transcript ID of the CBL in the transcription group database according to the gene identification result to obtain CpCBL8, and finally, performing key research on CpCBL8 to analyze the action and molecular mechanism of the transcript in the growing and developing process of the chimonanthus nitens, thereby providing an important method and strategy for genetic improvement, new variety cultivation and flowering season regulation of the chimonanthus nitens, and being beneficial to better applying chimonanthus nites resources to garden landscaping.

Disclosure of Invention

The invention aims to provide chimonanthus nitens CpCBL8 and a protein coded by the chimonanthus nitens CpCBL8 and application of the chimonanthus nitens CpCBL8.

First, the present invention provides chimonanthus nitens CpCBL8 protein which is:

1) A protein consisting of amino acids represented by SEQ ID No. 2; or

2) Protein derived from 1) by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID No.2 and having equivalent activity.

The invention also provides a gene for coding the chimonanthus nitens CpCBL8 protein.

Preferably, the sequence of the gene is shown as SEQ ID No. 1.

The invention also provides a vector, a host cell and an engineering bacterium containing the gene.

The invention also provides the application of the gene in delaying plant flowering, improving plant drought tolerance, improving plant salt tolerance and/or improving plant sensitivity to low temperature.

In one embodiment of the invention, the gene is transferred into the genome of a plant and overexpressed in a transgenic plant, resulting in delayed flowering, increased drought tolerance, increased salt tolerance and/or increased sensitivity to low temperatures in the plant.

The invention also provides a method for delaying the flowering of plants, which is to transfer the vector containing the gene into the genome of the plants and to perform over-expression in transgenic plants.

The invention also provides a method for improving the drought tolerance, the salt tolerance and/or the low temperature sensitivity of the plant, which is to transfer the vector containing the gene into the genome of the plant and to perform over-expression in a transgenic plant.

The invention has the following beneficial effects:

the present invention clones the full length of CpCBL8 from Chimonanthus praecox. Expression characteristic analysis shows that CpCBL8 has the highest expression level in leaves of Chimonanthus praecox, is next to buds and has the lowest expression level in flowers; the expression level of CpCBL8 was significantly higher in the middle/inner perianth discs than in the outer perianth discs, stamens and pistils at different parts of the flowers. Subcellular localization experiments showed that CpCBL8 was localized to the plasma membrane and nucleus. Compared with WT, 35S shows that the flowering phase of CpCBL 8/Arabidopsis is significantly delayed, the number of rosette leaves is significantly increased, the leaf area is significantly increased, the inflorescence is significantly increased, and the higher the expression level of CpCBL8 is, the more significant the phenotypic change is. The endogenous genes related to floral development are measured, and compared with WT, the expression levels of SOC1, AP1 and LFY of over-expression strains are obviously reduced. Salt and drought stress experiments show that compared with WT, the wilting degree of an over-expression strain is lower, the activity of superoxide dismutase, the relative water content and the contents of chlorophyll and proline are higher, but the stomatal conductance is lower, the malonaldehyde content and active oxygen accumulation are less, the electrolyte leakage rate is lower, and the measurement results of various physiological indexes under low-temperature stress are completely opposite.

In conclusion, cpCBL8 is a positive regulator of salt and drought stress response and is a potential gene for improving salt and drought tolerance of Chimonanthus nitens. The chimonanthus nitens CpCBL8 heterologously expressed Arabidopsis thaliana can enhance the salt tolerance and drought tolerance of the over-expressed Arabidopsis thaliana, but can not tolerate low-temperature stress and has the function of inhibiting flower development.

Drawings

FIG. 1 shows a cloning gel electrophoresis of the CpCBL8 Max ORF sequence. M is DNA molecular weight standard AL2000,1, 2, 3 and 4 are different monoclonals.

FIG. 2 shows the validation of pCAMBIA-1300mCherry-CpCBL8 by double digestion. M is DNA molecular weight standard AL2000,1, 2 and 5 are pCAMBIA-1300mCherry plasmid which is not enzyme-cut, pCAMBIA-1300mCherry plasmid which is enzyme-cut and cl-CpCBL8 plasmid which is enzyme-cut respectively; 3 and 4 are pCAMBIA-1300mCherry-CpCBL8 recombinant vectors after enzyme digestion.

FIG. 3 shows the results of pCBL8 subcellular localization experiments. A. B and C are respectively a positive control, a negative control and a CpCBL8 experimental group; merge, bright, NLS and mCherry are respectively mixed field, bright field, nuclear localization signal and fluorescence signal. The scale bar is 50 μm.

FIG. 4 shows the relative expression levels of CpCBL8 in different organs and tissues of Chimonanthus praecox.

FIG. 5 shows the double restriction enzyme validation of the expression vector pCAMBIA-2301G-CpCBL 8. M is DNA molecular weight standard AL2000,1 is pCAMBIA-232301G carrier which is not cut by enzyme, 2, 3 and 4 are pCAMBIA-232301G, pCAMBIA-2301G-CpCBL8 and tr-CpCBL8 which are cut by enzyme respectively.

FIG. 6 shows T ₁ Detection of generation CpCBL8 overexpression lines. M is DNA molecular standard weight AL2000, N is negative control, T is positive control, 2-33 and WT are different Arabidopsis strains.

FIG. 7 shows the expression levels of different Arabidopsis overexpression lines CpCBL8. Data are mean ± standard error, one-way anova and duncan multiple comparisons, with different letters representing significant differences and P <0.05.

FIG. 8 shows 35S: cpCBL8/Col-0 and WT strain phenotypes. The scale bar is 3 cm.

FIG. 9 shows 35S under salt stress at different concentrations, cpCBL 8/Arabidopsis lines germination (A) and root length (B and C). A and B are mean values. + -. Standard error, multiplex T test, WT is control group, <0.05, < 0.01; the scale of the C diagram is 0.5 cm.

FIG. 10 shows 35S under salt stress CpCBL 8/Arabidopsis line phenotype. The scale bar is 3 cm.

FIG. 11 shows 35S under mannitol stress at different concentrations, cpCBL 8/Arabidopsis lines germination percentage (A) and root length (B and C). A and B are mean values. + -. Standard error, multiplex T test, WT is control group, <0.05, < 0.01; the scale of the C diagram is 0.5 cm.

FIG. 12 shows 35S under drought stress CpCBL 8/Arabidopsis line phenotype. The scale bar is 3 cm.

FIG. 13 shows 35S under cold stress CpCBL 8/Arabidopsis line phenotype. The scale bar is 3 cm.

FIG. 14 shows the 35S after cold stress CpCBL 8/Arabidopsis strain phenotypic chlorophyll fluorescence parameters. The scale of the A picture is 3 cm, and the scale of the E picture is 1 cm.

FIG. 15 shows 35S, the natural water loss rate of isolated leaves of CpCBL 8/Arabidopsis lines. (A) stomatal conductance after different stress treatments (B and C). Data in panels A and B are mean. + -. Standard error, multiple T-test, WT is control, and the same line is represented by the same asterisk and broken line in panel A. * P <0.05, P ≦ 0.01, and the scale bar of graph C is 10 μm.

FIG. 16 shows 35S physiological indicators of CpCBL 8/Arabidopsis overexpressing lines after stress treatment. Graphs a-F data mean ± sd, multiple T-test, WT as control, P <0.05, P < 0.01; the scales of the graphs G and H are 1 cm.

FIG. 17 shows 35S-CpCBL 8/Arabidopsis lines relative expression of endogenous genes. Data are mean ± sd, multiplex T-test, WT is control, P <0.05, P ≦ 0.01.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Example 1 cloning of the Calycanthus praecox CpCBL8 Gene

Taking 'chime mouth' chimonanthus nitens leaves which have good growth vigor and no plant diseases and insect pests in the campus of university in southwest as materials, extracting total RNA, and taking the extracted RNA as a template to synthesize a cDNA first chain.

By using Primer Premier 5 software, taking CpCBL8 sequence screened from a transcriptome database which breaks dormancy of wintersweet flower buds at low temperature and expands the wintersweet flower buds to be opened as a template, carrying out specific amplification Primer design, wherein a PCR product contains an Open Reading Frame (ORF) sequence of a target gene. The designed primer is synthesized by Daohuageno corporation, and the specific primer sequence is shown in Table 1.

TABLE 1 primer List

And performing CpCBL8 full-length PCR amplification by taking CpCBL8-cn-F and CpCBL8-cn-R as primers, and performing gel electrophoresis detection on PCR amplification products of CpCBL8, wherein the results show that the lengths of the products are basically consistent with the length of the predicted PCR product. Ligation of Gene of interest to pMD ^TM And (2) carrying out colony PCR and sequencing after 19-carrying out the vector, wherein the colony PCR result is consistent with the gene cloning PCR result, the cloned CpCBL8 is 893bp (shown in figure 1) in length and contains complete 663bp CDS (complementary deoxyribonucleic acid) according to the sequencing result, the sequence is shown as SEQ ID NO.1 and is consistent with the sequence in a transcriptome database, the amino acid sequence of the encoded protein is shown as SEQ ID NO.2, and the recombinant plasmid in the step is named as cn-CpCBL8.

The pCAMBIA-1300mCherry-CpCBL8 recombinant vector is obtained by utilizing a T4 connection method and a homologous recombination method, and PCR amplification detection is carried out on the recombinant vector, so that the length of a band is correct; sequencing the corresponding sample bacterial liquid, and feeding back a sequencing result without mutation, deletion or insertion site; the result of double enzyme digestion verification of the recombinant vector shows that pCAMBIA-1300mCherry-CpCBL8 can be cut into double bands by restriction endonuclease, and the length of the bands is correct (FIG. 2).

The result of the subcellular localization experiment shows that after the agrobacterium carrying pCAMBIA-1300mCherry no-load infects onion epidermal cells in a control group, fluorescence signals can be found at all positions of the onion epidermal cells (figure 3A), and after the agrobacterium not carrying a carrier infects the onion epidermal cells, only nuclear localization signals emit light (figure 3B), which shows that the experiment materials, the carrier and the strain are all normal, and the experiment result is reliable; transient expression of pCAMBIA-1300mCherry-CpCBL8 detected fluorescence signals in plasma membrane and nucleus (FIG. 3C), indicating that CpCBL8 was localized to the plasma membrane and nucleus.

Example 2 analysis of CpCBL8 expression Properties in different organs and tissues of Calophyllum

The roots, stems, leaves, buds, flowers, young fruits, external/middle/internal flower quilt sheets, stamens and pistils of 'chime mouth' chimonanthus nitens adult plants which have good growth vigor and no plant diseases and insect pests in campus of university in southwest are taken as materials, 3 biological repeats are set for each sample, and the immediately-after-sampling horses are wrapped by tinfoil paper, immersed in liquid nitrogen for freezing and then stored in an ultralow temperature refrigerator at-80 ℃ for total RNA extraction and cDNA first chain synthesis. qRT-PCR was performed using cDNA obtained by reverse transcription as a template, and the expression characteristics of CpCBL8 in different organs and tissues of Chimonanthus praecox were analyzed, with 3 technical replicates per sample. The primer sequences are shown in the table below.

TABLE 2 primer List

Name of primer	Primer sequence (5 '-3')
		CpCBL8-qRT-F1	GCTTGATTGGTTCTCATGTTG
CpCBL8-qRT-R1	TTCACGAACCTCAGACATTG
		CpTublin-F	TAGTGACAAGACAGTAGGTGGAGGT
CpTublin-R	GTAGGTTCCAGTCCTCACTTCATC
		CpActin-F	GTTATGGTTGGGATGGGACAGAAAG
CpActin-R	GGGCTTCAGTAAGGAAACAGGA

In different organs of chimonanthus nitens, the expression level of CpCBL8 in leaves is highest, then buds are arranged, the expression level in flowers is lowest, the expression level of CpCBL8 in leaves is 5.69 times that of flowers, and the expression difference is very significant (figure 4).

Example 3CpCBL8 acquisition of overexpressing Arabidopsis thaliana and characterization of Performance

Columbia ecotype Arabidopsis thaliana (Wild-type/Columbia, WT/Col-0) was used as a genetically transformed plant material, which was planted in a greenhouse (23 ℃,16h day/8 h night) of the research center for floral engineering technology at the university of southwest, with a relative humidity maintained at 60%, and a planting substrate was formulated from peat and vermiculite (1, v/v).

According to the characteristics of pCAMBIA-2301G expression vector and CpCBL8 gene sequence, bamH I and Sac I are selected as vector linearization and vector recombination connection sites. Adding the screened enzyme cutting site sequences to two ends of a CpCBL8 cloning primer, simultaneously adding a protective base, and cloning the CpCBL8 maximum ORF sequence carrying the corresponding enzyme cutting site sequences by taking cn-CpCBL8 as a template. The primer sequences are shown in Table 3.

TABLE 3 primer List

Separating PCR amplification product from reaction product by agarose gel electrophoresis, cutting gel block with correct length for gel recovery, connecting gel recovery product of target gene to pMD ^TM 19-T vector to obtain recombinant plasmid, and finally, the recombinant plasmid is named tr-CpCBL8.

And (3) carrying out double enzyme digestion on the plant binary expression vector pCAMBIA-2301G and the tr-CpCBL8 recombinant plasmid according to the enzyme digestion site designed in the last step to obtain linearized pCAMBIA-2301G and a target gene with the enzyme digestion site. Corresponding fragments are obtained by agarose gel electrophoresis and gel recovery methods, wherein long fragments are recovered from the pCAMBIA-2301G expression vector enzyme digestion products, and short fragments are recovered from tr-CpCBL8 recombinant plasmid enzyme digestion products. And (3) connecting the tr-CpCBL8 short fragment with the pCAMBIA-2301G long fragment by using a T4 connection method to obtain the recombinant vector. The ligation products are transformed into escherichia coli competent cells, and then the transformation products are coated on an LB solid medium plate (containing 50mg/L Kan); placing the culture medium flat plate upside down in a constant temperature incubator, setting the condition at 37 ℃ and culturing for 11-12 h; selecting a plurality of cultured monoclonal colonies to 1000 mu L LB liquid culture medium (containing 50mg/L Kan), then utilizing a constant temperature oscillator to propagate, setting conditions to 37 ℃, culturing at 180rpm for 11-12 h; and detecting the positive strains by using a PCR amplification and agarose gel electrophoresis method after the culture is finished. The positive strains with correct band length detected by gel electrophoresis are sent to Chongke biology company (Chongqing) for sequencing, single colonies with correct sequencing are subjected to propagation expansion and recombinant plasmid extraction, and double enzyme digestion verification is performed on the recombinant plasmids (figure 5). The vector verified to be correct is named as pCAMBIA-2301G-CpCBL8, and the CpCBL8 genetic transformation recombinant vector is obtained.

The recombinant vector pCAMBIA-2301G-CpCBL8 is transferred into Agrobacterium-infected competent cell GV3101 (pSoup) by electrotransformation, and Arabidopsis thaliana is transformed by the floral dip method. Screening over-expression strain with MS culture medium (containing Kan 50 mg/L) to obtain T ₁ Generation-overexpression lines with T ₁ Carrying out positive plant detection by using plant leaves as materials, and obtaining results as shown in the figure6, wherein the negative control is ultrapure water with the same volume, and the positive control is pCAMBIA-2301G-CpCBL8 recombinant vector. The electrophorogram shows that the negative control and WT strains have no band, the lengths of the bands of the over-expression strain and the positive control are consistent, the lanes of strains No. 4, 10, 17, 26, 27 and 28 have no band, and the strains with positive PCR detection are continuously screened to obtain the homozygous over-expression strain.

To select lines with different CpCBL8 expression levels, T ₂ Generation homozygous 35S, cpCBL 8/Arabidopsis seedlings are taken as samples, qRT-PCR is carried out, according to results, three lines with the highest expression quantity are respectively OE13-1, OE3-1 and OE19-2 (figure 7), and the 3 lines respectively correspond to 13, 3 and 19 with clear bands in an electrophoresis picture of positive identification of over-expression lines (figure 6). The CpCBL8 expression level of an OE13-1 strain is remarkably higher than that of OE3-1 and OE19-2, and the CpCBL8 expression level of an OE3-1 strain is also remarkably higher than that of OE19-2; the OE31-11 strain has low expression amount, but the expression amount is also significantly different from that of the WT strain; strains OE8-5, OE13-2, OE15-3, OE30-1 and OE31-5 have substantially no expression, and the expression amount of the strains has no significant difference from that of the WT strain. Through a method combining DNA detection and expression quantity detection, OE13-1, OE3-1 and OE31-11 are finally selected as 35S-CpCBL 8/Col0 high, medium and low expression strains respectively, and the 3 strains are used for subsequent CpCBL8 gene function verification.

For the screened T ₂ Phenotypic observation is carried out on CpCBL 8/Arabidopsis strains, and the bolting time and the rosette leaf number of OE13-1, OE3-1 and OE31-11 plants are found to have obvious difference with WT (figure 8, table 4), the bolting time of over-expressed plants is obviously delayed, the rosette leaf number is obviously increased, meanwhile, the rosette leaf area and the inflorescence height of OE13-1 and OE3-1 plants are also obviously different with WT, the over-expressed Arabidopsis rosette leaves are larger at five weeks of age, and the over-expressed Arabidopsis inflorescence is higher at eight weeks of age.

TABLE 4 35S CpCBL8/Col-0 and WT line phenotype statistics

Phenotype of strain	WT	OE13-1	OE3-1	OE31-11
					Bolting time (d)	28.75±0.22 ^b	31.30±0.33 ^a	30.90±0.39 ^a	30.70±0.35 ^a
Lotus leaf number (piece/piece)	12.05±0.21 ^b	15.25±0.40 ^a	14.45±0.44 ^a	14.45±0.37 ^a
					Lotus leaf length (cm)	1.87±0.04 ^c	2.77±0.05 ^a	2.49±0.03 ^b	1.95±0.04 ^c
Lotus base leaf width (cm)	0.99±0.02 ^c	1.31±0.03 ^a	1.2±0.02 ^b	0.92±0.03 ^c
					Inflorescence height (cm)	24.76±1.19 ^c	35.40±0.26 ^a	32.15±0.22 ^b	26.85±0.54 ^c

Example 4 identification of salt tolerance of overexpressing Arabidopsis thaliana

T with significant difference of CpCBL8 expression level screened out ₂ Generation homozygous 35S seeds of CpCBL 8/Arabidopsis and WT strains are sown on MS culture medium simulating salt stress (0, 10, 20, 50, 100mM NaCl) of different degrees, wherein the expression strains are sown in tissue culture bottles containing Kan 50mg/L in the culture medium, so that the plant root systems have sufficient space to grow vertically. And after 12d, counting the germination rate of each strain under different NaCl concentrations. Scanning roots of each strain under NaCl stress with different concentrations by using a root system scanner, and measuring the root length according to a ruler drawn during scanning. The result shows that the salt tolerance of the CpCBL8 high-expression strain is stronger. Under 10, 20, 50 and 100mM NaCl stress, the germination rates of OE13-1 and OE3-1 strain seeds are both significantly greater than that of WT strains (FIG. 9A), and the germination rates of CpCBL8 low-expression OE31-11 strain seeds are not significantly different from that of WT strains. The root length of seedlings was measured and found to be significantly greater in all lines OE13-1 than WT lines (FIGS. 9B and C) under 10, 20, 50 and 100mM NaCl stress and in OE3-1 under 10mM NaCl stress. The results show that the salt tolerance of over-expression Arabidopsis is obviously enhanced by heterologously expressing CpCBL8.

A part of each line of seedlings (14 d-old) sown on NaCl-free MS medium plates was transplanted into square pots filled with a medium, about 25 seedlings were transplanted per square pot, and after conventional cultivation for 3w, salt stress treatment was performed. Each pot was watered with 100mL of 150mM NaCl solution, each treatment was repeated three times, and photographic recordings were made during the stress period.

For T transplanted into square pot ₂ And (3) generation homozygous 35S, performing salt stress treatment and phenotype observation on CpCBL 8/Arabidopsis, watering each strain sufficiently before treatment to ensure normal growth, and performing pot soaking treatment by using 150mM NaCl solution after 3 days of seedling revival. The experimental results show that when NaCl is irrigated on the 3 rd day, each arabidopsis thaliana strain begins to have a stress phenotype, and rosette leaves begin to wither and yellow (figure 10); on day six, the WT strain had died nearly half, while only individual plants of OE13-1, OE3-1, and OE31-11 began to die; on day 10, the WT strain had essentially died, whereas only part of the CpCBL8 high expressing strain OE13-1 died; on day 13, the survival rate of OE13-1 plants is greater than 50%, the survival rate of OE3-1 line plants is approximately 40%, and the survival rate of OE31-11 is approximately 20%. The results further indicate that the salt tolerance of overexpression of CpCBL8 can be enhanced.

Example 5 overexpression of Arabidopsis thaliana drought tolerance characterization

T with significant difference of CpCBL8 expression level screened out ₂ The generation homozygous 35S is characterized in that CpCBL 8/Arabidopsis and WT strain seeds are sown on MS culture media simulating different degrees of drought (0, 50, 100, 200 and 300mM mannitol), wherein an expression strain is sown in a tissue culture bottle with the culture media containing Kan 50mg/L, so that the root systems of the plants have sufficient space to grow vertically. After 12 days, counting the germination rate of each strain under the stress of mannitol with different concentrations (the germination standard is that two complete green cotyledons grow out of the seedling), scanning the roots of each strain under different mannitol concentrations by using a root system scanner, and measuring the root length according to a ruler drawn during scanning. The results show that CpCBL8 high-expression lines have stronger drought tolerance. Under the mannitol stress of 50mM, 100mM, 200mM and 300mM, the germination rate of OE13-1 seeds is significantly greater than that of WT strains, except for 200mM, the germination rate of OE3-1 seeds is also significantly greater than that of WT strains, and under the mannitol stress of 50mM and 100mM, the germination rate of OE31-11 seeds is also significantly greater than that of WT strains (FIG. 11A). As a result of measuring the root length of seedlings, the root lengths of OE13-1 and OE3-1 are found to be significantly larger than that of WT strains under the stress of 50mM mannitol, 100mM mannitol, 200mM mannitol and 300mM mannitol, and the root length of OE31-1 is also found to be significantly larger than that of WT strains under the stress of 50mM mannitol (FIG. 1)1B and C). The results show that the drought tolerance of over-expression Arabidopsis thaliana is obviously enhanced by heterologously expressing CpCBL8.

Transplanting a part of seedlings (14 d old) of each line sowed on MS medium plates without mannitol into square pots filled with a matrix, transplanting about 25 seedlings in each square pot, performing conventional culture for 3w, and performing drought treatment. Fully absorbing water in soil matrix of each pot before treatment, carrying out drought stress treatment after seedling revival for 24h, carrying out rehydration after about 2 weeks by adopting a natural drought method, repeating each treatment for three times, and carrying out photographing record during the drought period.

For T transplanted into square pot ₂ And (3) generation homozygous 35S, namely performing natural drought treatment on CpCBL 8/Arabidopsis thaliana, observing phenotype, and watering soil matrix with enough water before treatment to ensure that each strain grows normally. The experimental results show that the quality of the square pots becomes obviously lighter on the 6 th day when the watering is stopped, which indicates that the water content in the planting matrix is seriously insufficient, and at the moment, each plant line of arabidopsis begins to have stress phenotype, such as leaf wilting, leaf edge withering and yellowing and leaf base purple (figure 12); on the 10 th day when the watering is stopped, the plant volume of the WT strain is obviously reduced, and the over-expression strains OE13-1, OE3-1 and OE31-11 still have more leaves to grow normally; on the 13 th day of stopping watering, the WT strains have basically no fresh green leaves, and the over-expression strains OE13-1, OE3-1 and OE31-11 still have a small part of fresh green leaves; and (3) restoring water supply to each strain subjected to drought for 13 days, wherein nearly 20% of the WT strains are completely killed, the rest 80% of the WT strains are restored to be normal on the 3 rd day of rehydration, and all the strains of over-expression strains OE13-1, OE3-1 and OE31-11 are basically restored to be normal. The above results further indicate that heterologous expression of CpCBL8 can enhance drought tolerance of over-expressed arabidopsis thaliana.

Example 6 overexpression of Arabidopsis Cold tolerance

Using T after 3w of conventional culture in a square pot ₂ The generation homozygous 35S is characterized in that CpCBL 8/Arabidopsis thaliana and WT strains are taken as materials, 3 pots of each strain are taken, about 25 plants are transplanted in each pot, and low-temperature stress treatment is carried out. Firstly, cold acclimating at 4 deg.C for 9h in artificial climatic chamber, freezing at-4 deg.C in dark for 9h, thawing at 4 deg.C in dark for 9h, and transferring to conventional culture stripAnd (7) recovering after taking the plants down, and taking pictures of the plants in different treatment periods for recording. The experimental results show that after cold acclimation at 4 ℃ for 9h, each strain still grows normally without obvious phenotypic change (figure 13); freezing each strain at-4 deg.C for 9h, and allowing OE13-1 and OE3-1 strains to wither severely, while only part of WT and OE31-11 strains show wilting; putting each frozen strain in dark at 4 ℃ for recovery, wherein after 9h, OE13-1 and OE3-1 strains have no obvious recovery sign, and partial plants of WT and OE31-11 strains are recovered to be normal; after transferring each strain to a greenhouse for 7 days of conventional culture, each strain was found to have recovered to normal, but the plants of OE13-1 and OE3-1 strains died by nearly 50%, whereas the majority of the WT and OE31-11 strains remained normal in growth, especially the WT strain, with essentially no plant death. The above results indicate that heterologous expression of CpCBL8 makes overexpression of Arabidopsis more sensitive to low temperatures.

And (3) carrying out-5 ℃ treatment on the overexpression strains for 1 hour, counting the frostbite degree of each strain, and determining the chlorophyll fluorescence parameters of each strain. Allowing each strain treated at-5 deg.C for 1h to dark adapt for 30min, taking picture with modulated chlorophyll fluorescence imaging system, and determining maximum photochemical efficiency Fv/Fm and electron transfer quantum rate Phi of each strain _PSⅡ At least 3 individuals are tested in each line, and the cold resistance of the transgenic arabidopsis is further determined. The results show that in the untreated control group, each line grew normally, and the maximum photochemical efficiency (Fv/Fm) (FIGS. 14A, B and E) and the electron transfer quantum efficiency (PhiPSII) of the PS II (FIG. 14C) of each line were not significantly different; after freezing treatment, all strains have frostbite, but the frostbite degree of the WT strain is lower, and the normal plant proportion is obviously higher than that of the OE13-1 strain; meanwhile, fv/Fm and phi PS II of each strain are reduced, which shows that PS II is damaged, but Fv/Fm and phi PS II of OE13-1 and OE-31 are both obviously lower than WT, which shows that over-expression strain PS II is damaged to a higher extent. The above results further indicate that heterologous expression of CpCBL8, overexpressing arabidopsis, is more sensitive to low temperatures.

Example 7 overexpression of the Natural Water loss Rate of Arabidopsis isolated leaves and the stomatal conductance under different stresses

To explore the role of CpCBL8 in participating in the water retention capacity of plants, the water loss rate of the leaves ex vivo of the over-expressed lines was determined for 8 hours. The determination result shows that the water loss rate of the WT strain is obviously higher than that of OE13-1 and OE3-1 after being isolated for 1h (FIG. 15A), the water loss rate of the WT strain is obviously higher than that of OE3-1 after being isolated for 2h, and the water loss rate of the WT strain is obviously higher than that of OE13-1 after being isolated for 3 h. In the following time period, there was no significant difference in water loss rate between the strains, but after 8h the WT strain had reached 68% water loss rate, whereas the OE13-1 and OE3-1 strains were 52% and 61%, respectively, with significant difference in water loss rate, while neither the CpCBL8 low-expression strain OE31-11 nor the WT strain had significant difference in water loss rate over the whole period. Therefore, the water retention capacity of over-expressed Arabidopsis thaliana in the early dehydration stage (0-3 h) is presumed to be enhanced by heterologous expression of CpCBL8.

Stomatal movement is of great significance to plants against adversity stress. In order to verify 35S, cpCBL 8/Arabidopsis thaliana is weak in stress resistance, stress treatment is carried out on leaves in vitro of each strain, stomatal conductance change is observed, the length-width ratio of each stomatal is counted, and more than 30 stomata are observed in each strain. From the experimental results, it can be found that there is no significant difference in stomatal conductance of each strain under normal growth conditions (fig. 15B and C); simulated salt (50 mM NaCl) and drought (300 mM mannitol) stress on leaves shows that the stomatal conductance of OE13-1 and OE3-1 is remarkably smaller than WT; under the stress of low temperature (4 ℃), the stomatal conductivities of OE13-1, OE3-1 and OE31-11 are all obviously greater than WT, which indicates that the chimonanthus nitens CpCBL8 is heterologously expressed, and the transpiration effect of the over-expressed arabidopsis thaliana can be reduced through stomatal movement, so that the salt tolerance and drought tolerance are enhanced, but the over-expressed arabidopsis thaliana becomes more sensitive to the low temperature.

Example 8 overexpression of physiological indices after stress treatment in Arabidopsis

CpCBL 8/Arabidopsis 35S was treated with 300mM NaCl, 30% PEG6000 and 4 ℃ low temperature stress, respectively, and then a number of physiological indices were measured. The results show that there was no significant difference in the control experiments except that the chlorophyll content of OE13-1 was significantly higher than WT and the malondialdehyde content was significantly lower than that of the WT strain (FIGS. 16B and E). Under salt and drought stress, the relative water content, chlorophyll and proline content of the OE13-1 strain are significantly higher than that of the WT strain (FIGS. 16A-C), and the electrolyte leakage rate and malonaldehyde content are also significantly lower than those of the WT strain (FIGS. 16A-C)WT strains (FIGS. 16D and E), while the superoxide dismutase activity was significantly higher than that of the WT strain (FIG. 16F), while H ₂ O ₂ (FIG. 16G) and O ^2- (FIG. 16H) also significantly less accumulation than WT lines; under the salt stress, the OE3-1 strain has no obvious difference from the WT strain in the contents of chlorophyll and proline, and the determination results of other physiological indexes show that the OE3-1 strain has stronger salt tolerance than the WT strain; at 30% under conditions where PEG6000 mimics drought stress, other physiological indicators indicate that it has greater drought tolerance than the WT strain, except that the malondialdehyde content is not significantly different from the WT strain; it is noteworthy that, although the above three indicators of the OE3-1 strain were not significantly different from the WT strain under salt and drought stress, the mean values of chlorophyll and proline contents were higher than WT, and the mean value of malondialdehyde content was lower than WT; the above results indicate that OE13-1 and OE3-1 have stronger salt and drought tolerance than WT. On the other hand, the physiological indexes of OE13-1 after low-temperature stress are completely opposite to the measurement results after salt stress and drought stress, which indicates that OE13-1 is damaged more highly under low-temperature stress, meanwhile, the malondialdehyde content of OE3-1 after low-temperature stress is significantly higher than WT, the proline content is significantly lower than WT, and the average values of the relative water content, chlorophyll content and SOD activity are also lower than WT, which indicates that OE3-1 is damaged more highly. The experiment results further prove that the heterologous expression of CpCBL8 can enhance the salt tolerance and drought tolerance of over-expressed Arabidopsis, but makes the over-expressed CpCBL8 more sensitive to low-temperature stress.

Example 9 molecular mechanisms for overexpression of Arabidopsis phenotype and Cold tolerance changes

In order to explore the role of CpCBL8 in plant flowering phase regulation and low temperature stress response molecular mechanisms, expression analysis of Arabidopsis endogenous genes related to flowering phase regulation and low temperature stress response was performed. Actin2 was selected as an internal reference gene, FT (Flowering locus T), SOC1 (super of overexpression of CO 1), LFY (leaf) and AP1 (Apetala 1) were selected as flower development regulatory pathway-related genes, CBF1/2/3 (C-repeat binding factor 1/2/3), COR47/15A/15B (Cold regulated 47/15A/15B), CRPK1 (Cold-responsive protein kinase 1) and 14-3-3 lambda (also called G-box regulation factor 6, GRF6) were selected as low temperature response pathway-related genes, and qRT-PCR experiments were performed to investigate the molecular mechanism of CBL8 functioning in over-expressed Arabidopsis thaliana. The primers required for qRT-PCR are designed by NCBI online primer design tool, and synthesized by engine biology company, and the specific primer sequences are shown in Table 5.

TABLE 5 primer sequences

Since the research is based on the transcriptome data of breaking dormancy of wintersweet flower buds at low temperature and expanding the wintersweet flower buds, mainly relates to low-temperature induction and flower development, the related molecular mechanisms of flower development and low-temperature stress response are intensively researched. The relative expression quantity of genes related to the floral development and cold resistance regulation and control pathway of over-expressed arabidopsis is measured, and qRT-PCR results show that under the normal growth condition, the relative expression quantity of over-expressed strains SOC1, LFY and AP1 is obviously lower than that of WT, and the relative expression quantity of FT is not obviously different from that of WT (figure 17A); in the control group which was not cryogenically treated, the relative expression levels of CPRK1, 14-3-3. Lambda. And OE3-1 strains of the OE13-1 strain were very significantly higher than that of WT (FIG. 17B), the relative expression levels of CBF1/2/3 of the OE13-1 strain, COR15A/15B/47 and COR15A/47 of the OE3-1 strain were very significantly lower than that of WT, and the relative expression level of CBF3 of the OE3-1 strain was significantly lower than that of WT (FIG. 17C); after low-temperature treatment, compared with WT, the relative expression amounts of CBF1/3 of an over-expression strain OE13-1, CBF1 of OE3-1, COR15A/47 of OE13-1/3-1 and COR15B of OE13-1 are all remarkably reduced, the expression amount of COR15B in OE3-1 is remarkably reduced, meanwhile, 14-3-3 lambda of the two over-expression strains is remarkably increased, while the relative expression amount average value of CRPK1 is increased, but the expression amounts are not remarkable.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> university of southwest

<120> chimonanthus nitens CpCBL8 gene and coded protein and application thereof

<160> 44

<170> SIPOSequenceListing 1.0

<210> 1

<211> 663

<212> DNA

<213> Chimonanthus praecox)

<400> 1

atgggctgct tctgcacaaa gcatatcaaa catacaccag gatatgagga gcctactgtt 60

cttgcttctg aaacgacatt tacagtgagt gaagttgaag ctttatatga gctatttaag 120

aaactaagca gttccataat tgatgatgga cttattcaca aggaagagtt tcagcttgct 180

ctattcaata acagcaacaa gcgcaatctt tttgctgaca ggatatttga tttgttcgat 240

gtcaaacgta atggagttat cgagtttggg gaatttgttc gatcattgag cgtttttcat 300

ccaaatgcct cagaatcaga gaaaattgca tttgcattta gattgtatga cttaaggcac 360

actggcttca ttgaacgtga ggagttgaag gaaatggtgt tggccctctt gaacgagtct 420

gacctgcgcc tttcagatga tgtagttgaa acaattgttg acaagacatt cagtgatgca 480

gatttcaatg gagatgggaa aatagattca gaagagtgga aggaatttgt atcaagaaac 540

ccgtctttga tgaagaatat gacccttcca tatttgaagg acataaccat tgcatttcca 600

agctttgttt tgaattctga agttgaagat tcagatatga attgtcaaac tctctcatct 660

tga 663

<210> 2

<211> 220

<212> PRT

<213> Chimonanthus praecox)

<400> 2

Met Gly Cys Phe Cys Thr Lys His Ile Lys His Thr Pro Gly Tyr Glu

1 5 10 15

Glu Pro Thr Val Leu Ala Ser Glu Thr Thr Phe Thr Val Ser Glu Val

20 25 30

Glu Ala Leu Tyr Glu Leu Phe Lys Lys Leu Ser Ser Ser Ile Ile Asp

35 40 45

Asp Gly Leu Ile His Lys Glu Glu Phe Gln Leu Ala Leu Phe Asn Asn

50 55 60

Ser Asn Lys Arg Asn Leu Phe Ala Asp Arg Ile Phe Asp Leu Phe Asp

65 70 75 80

Val Lys Arg Asn Gly Val Ile Glu Phe Gly Glu Phe Val Arg Ser Leu

85 90 95

Ser Val Phe His Pro Asn Ala Ser Glu Ser Glu Lys Ile Ala Phe Ala

100 105 110

Phe Arg Leu Tyr Asp Leu Arg His Thr Gly Phe Ile Glu Arg Glu Glu

115 120 125

Leu Lys Glu Met Val Leu Ala Leu Leu Asn Glu Ser Asp Leu Arg Leu

130 135 140

Ser Asp Asp Val Val Glu Thr Ile Val Asp Lys Thr Phe Ser Asp Ala

145 150 155 160

Asp Phe Asn Gly Asp Gly Lys Ile Asp Ser Glu Glu Trp Lys Glu Phe

165 170 175

Val Ser Arg Asn Pro Ser Leu Met Lys Asn Met Thr Leu Pro Tyr Leu

180 185 190

Lys Asp Ile Thr Ile Ala Phe Pro Ser Phe Val Leu Asn Ser Glu Val

195 200 205

Glu Asp Ser Asp Met Asn Cys Gln Thr Leu Ser Ser

210 215 220

<210> 3

<211> 21

<212> DNA

<213> Chimonanthus praecox)

<400> 3

gcttgattgg ttctcatgtt g 21

<210> 4

<211> 20

<212> DNA

<213> Chimonanthus praecox)

<400> 4

ttcacgaacc tcagacattg 20

<210> 5

<211> 26

<212> DNA

<213> Chimonanthus praecox)

<400> 5

cgagctcatg ggctgcttct gcacaa 26

<210> 6

<211> 31

<212> DNA

<213> Chimonanthus praecox)

<400> 6

cgggatccag atgagagagt ttgacaattc a 31

<210> 7

<211> 21

<212> DNA

<213> Chimonanthus praecox)

<400> 7

gcttgattgg ttctcatgtt g 21

<210> 8

<211> 20

<212> DNA

<213> Chimonanthus praecox)

<400> 8

ttcacgaacc tcagacattg 20

<210> 9

<211> 25

<212> DNA

<213> Chimonanthus praecox)

<400> 9

tagtgacaag acagtaggtg gaggt 25

<210> 10

<211> 24

<212> DNA

<213> Chimonanthus praecox)

<400> 10

gtaggttcca gtcctcactt catc 24

<210> 11

<211> 25

<212> DNA

<213> Chimonanthus praecox)

<400> 11

gttatggttg ggatgggaca gaaag 25

<210> 12

<211> 22

<212> DNA

<213> Chimonanthus praecox)

<400> 12

gggcttcagt aaggaaacag ga 22

<210> 13

<211> 29

<212> DNA

<213> Chimonanthus praecox)

<400> 13

cgggatccat gggctgcttc tgcacaaag 29

<210> 14

<211> 30

<212> DNA

<213> Chimonanthus praecox)

<400> 14

cgagctcgaa ctggttgagg catgtgcagt 30

<210> 15

<211> 23

<212> DNA

<213> Chimonanthus praecox)

<400> 15

aggatatgag gagcctactg ttc 23

<210> 16

<211> 20

<212> DNA

<213> Chimonanthus praecox)

<400> 16

gattgcgctt gttgctgtta 20

<210> 17

<211> 20

<212> DNA

<213> Chimonanthus praecox)

<400> 17

ggaaggatct gtacggtaac 20

<210> 18

<211> 20

<212> DNA

<213> Chimonanthus praecox)

<400> 18

tgtgaacgat tcctggacct 20

<210> 19

<211> 24

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 19

ttccaagtcc tagcaaccct cacc 24

<210> 20

<211> 22

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 20

ttcttcctcc gcagccactc tc 22

<210> 21

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 21

agctgcagaa aacgagaagc 20

<210> 22

<211> 22

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 22

tgaagaacaa ggtaacccaa tg 22

<210> 23

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 23

attggttcaa gcaccacctc 20

<210> 24

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 24

caagaagctc ccaacgaaag 20

<210> 25

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 25

tagggctcaa caggagcagt 20

<210> 26

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 26

cagccaaggt tgcagttgta 20

<210> 27

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 27

gcatgtctca acttcgctga 20

<210> 28

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 28

atcgtctcct ccatgtccag 20

<210> 29

<211> 21

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 29

tgacgtgtcc ttatggagct a 21

<210> 30

<211> 21

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 30

ctgcactcaa aaacatttgc a 21

<210> 31

<211> 22

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 31

gatgacgacg tatcgttatg ga 22

<210> 32

<211> 26

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 32

tacactcgtt tctcagtttt acaaac 26

<210> 33

<211> 26

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 33

gcttcagatt tcgtgacgga taaaac 26

<210> 34

<211> 26

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 34

gcaaaacatt aaagaatgtg acggtg 26

<210> 35

<211> 24

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 35

aaagcagagt ggtgttggta ccgt 24

<210> 36

<211> 24

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 36

tcatcgagga tgttgccgtc actt 24

<210> 37

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 37

cagtgtcgga gagtgtggtg 20

<210> 38

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 38

acagctggtg aatcctctgc 20

<210> 39

<211> 22

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 39

ggttgctcct ggttatcgtg tc 22

<210> 40

<211> 22

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 40

tcatcagtgg cctgacgtat ct 22

<210> 41

<211> 22

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 41

gagcagaagg aagagagtag ga 22

<210> 42

<211> 22

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 42

ggattccaga gcaaacagaa ga 22

<210> 43

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 43

ggaaggatct gtacggtaac 20

<210> 44

<211> 20

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 44

tgtgaacgat tcctggacct 20

Claims

1. Chimonanthus nitens CpCBL8 protein which is:

1) A protein consisting of amino acids represented by SEQ ID No. 2; or

2. A gene encoding the chimonanthus nitens CpCBL8 protein of claim 1.

3. The gene of claim 2, having the sequence shown in SEQ ID No. 1.

4. A vector containing the gene according to claim 2 or 3.

5. A host cell comprising the vector of claim 4.

6. An engineered bacterium comprising the gene of claim 2 or 3.

7. Use of the gene of claim 2 or 3 for delaying flowering, increasing drought tolerance, increasing salt tolerance and/or increasing the sensitivity of a plant to low temperatures.

8. Use according to claim 7, wherein the gene is transferred into the genome of a plant and overexpressed in the transgenic plant, resulting in delayed flowering, increased drought tolerance, increased salt tolerance and/or increased sensitivity to low temperatures in the plant.

9. A method for delaying flowering in a plant, characterized in that a vector containing the gene of claim 2 or 3 is transferred into the genome of the plant and overexpressed in a transgenic plant.

10. A method for improving drought tolerance, salt tolerance and/or susceptibility to low temperatures in plants, characterized in that a vector containing the gene according to claim 2 or 3 is transferred into the genome of the plant and overexpressed in the transgenic plant.