CN115466799A - Primer probe composition, kit and method for detecting novel coronavirus - Google Patents

Abstract

The invention relates to a primer probe composition, a kit and a method for detecting novel coronavirus. The invention designs a detection primer probe composition aiming at the novel coronavirus S gene and the novel coronavirus N gene in the same detection system based on double detection targets, provides a novel coronavirus detection kit containing the primer probe composition and a detection method for non-disease diagnosis, and has the advantages of high sensitivity, good repeatability, strong specificity, high detection speed, objective result, high throughput and the like. The kit and the detection method for non-disease diagnosis provided by the invention can realize qualitative detection, can perform objective and quantitative detection on the nucleic acid concentration of a sample to be detected, can accurately judge the virus content of the detected sample, and have good application prospect.

Description

Primer probe composition, kit and method for detecting novel coronavirus

Technical Field

The invention belongs to the technical field of gene detection, and particularly relates to a primer probe composition, a kit and a method for detecting novel coronavirus.

Background

A novel coronavirus (SARS-CoV-2) belongs to the family of coronavirus, the beta-type coronavirus is an enveloped, non-segmented single-stranded RNA virus with linear genome. The virus particle is spherical, the diameter is 120-160nm, and the genome is about 30kb in total length. The whole genome sequence determination of several strains of new coronavirus (SARS-CoV-2) has been completed, and the similarity between SARS-CoV-2 and SARS genome is about 80%.

The general symptoms of human infection with the novel coronavirus (SARS-CoV-2) are fever, hypodynamia and dry cough, and some serious clinical symptoms comprise acute respiratory distress syndrome, septic shock, metabolic acidosis which is difficult to correct, blood coagulation dysfunction and the like. Therefore, the rapid and reliable detection of SARS-CoV-2 is important, and the rapid detection of SARS-CoV-2 is not only essential for the prevention and control of SARS-CoV-2, but also essential for the differential diagnosis of respiratory diseases such as SARS and MERS similar to the clinical symptoms thereof.

At present, there are polymerase chain reaction, isothermal amplification chip method, colloidal gold method antibody detection and the like for the detection method of the novel coronavirus (SARS-CoV-2). The constant temperature amplification chip method and the colloidal gold method have low sensitivity and low specificity of antibody detection. Polymerase Chain Reaction (PCR) is a rapid method for detecting SARS-CoV-2, and is particularly suitable for screening samples with unrecoverable virus which are of poor quality or degraded. The PCR technology can complete the diagnosis of SARS-CoV-2 within several hours after sample collection, and shorten the diagnosis time. The PCR method for detecting the novel coronavirus (SARS-CoV-2) has the characteristics of specificity, sensitivity and rapidness, but has the characteristics of time consumption, easy pollution, electrophoretic detection after amplification, small number of samples for each detection and the like.

The existing SARS-CoV-2 nucleic acid detection reagent kit is mostly based on RT-qPCR detection technology, and the detection primer probes are all designed aiming at a single target gene. However, the frequency of single base mutations in the virus is about 10 ^-6 The degree of variation of the nucleic acid sequence is high, and false negative detection results caused by mutation are easy to generate. The current detection technology has the problem of low sensitivity, so that the sensitivity needs to be improved to eliminate false negative results. Therefore, there is a need to develop a new method for detecting a novel coronavirus (SARS-CoV-2) with high efficiency and accuracy, which can be used for detecting the nucleic acid of SARS-CoV-2 in suspected cases and cases to be diagnosed.

Disclosure of Invention

The invention aims to provide a primer probe composition for detecting novel coronavirus so as to solve the technical problem that the existing detection technology is poor in reliability and sensitivity.

The second purpose of the invention is to provide a novel coronavirus qualitative detection kit containing the primer probe composition.

The third purpose of the invention is to provide a novel coronavirus quantitative detection kit containing the primer probe composition.

It is a fourth object of the present invention to provide a novel method for qualitative detection of coronavirus for non-diagnostic purposes.

The fifth object of the present invention is to provide a novel quantitative coronavirus detection method for non-diagnostic purposes.

The research aims at establishing a single-step multiple reverse transcription real-time quantitative PCR detection method which is more sensitive, more reliable, lower in cost and higher in speed, utilizes hypervariable regions in a spike protein (S) gene and a nucleoprotein (N) gene, and the primers are used for distinguishing SARS-CoV-2 virus from influenza virus and other coronaviruses and designing primers for detecting a fluorescent probe closed tube. The incorporation of the probe allows the specificity of the PCR product to be recognized and allows the reaction to be read automatically.

In order to achieve the purpose, the invention adopts the following technical scheme:

a primer probe composition for detecting a novel coronavirus, comprising a first primer probe targeting an S gene and a second primer probe targeting an N gene; the first primer probe comprises the nucleotide sequence shown as SEQ ID NO:5, and the upstream primer shown as SEQ ID NO:6 and an S gene detection probe, wherein the nucleotide sequence of the S gene detection probe is shown as SEQ ID NO:3, a fluorescence reporter group FAM is marked at the 5 'end, and a fluorescence quenching group MGB is marked at the 3' end; the second primer probe comprises a probe sequence as set forth in SEQ ID NO:7, and the upstream primer shown as SEQ ID NO:8 and an N gene detection probe, wherein the nucleotide sequence of the N gene detection probe is shown as SEQ ID NO:4, a fluorescence reporter group VIC is marked at the 5 'end, and a fluorescence quenching group MGB is marked at the 3' end.

The novel qualitative detection kit for the coronavirus comprises RT-qPCR reaction mixed liquor, wherein the RT-qPCR reaction mixed liquor comprises the primer probe composition.

The novel quantitative detection kit for the coronavirus comprises RT-qPCR reaction mixed liquor, wherein the RT-qPCR reaction mixed liquor comprises the primer probe composition and a novel coronavirus SARS-CoV-2RNA standard product, and the sequence of the RNA standard product is shown as SEQ ID NO:10, to claim.

Preferably, each 20. Mu.L of RT-qPCR reaction mixture comprises the following components: 250nM is as shown in SEQ ID NO: 0.5. Mu.L of each of the two molecular probes shown in 3 and 4; 900nM is as shown in SEQ ID NO:5 and 7, 0.5 mu L of each upstream primer; 900nM is as shown in SEQ ID NO:6 and 8 respectively in a quantity of 0.5 mu L;4 XTTaqPath ^TM 1-Step Multiplex Master Mix 12.5μL；Nuclease-free water 3μL。

Preferably, the qualitative or quantitative detection kit further comprises a positive control, wherein the positive control is a nucleic acid sequence comprising the nucleotide sequence shown in SEQ ID NO:9, and a plasmid positive for the nucleotide sequence shown in figure 9.

Preferably, the qualitative or quantitative detection kit further comprises a negative control, wherein the negative control is nucleic-free water.

A novel qualitative detection method of coronaviruses for non-diagnostic purposes, characterized in that it comprises the following steps:

1) Extracting RNA of a sample to be detected;

2) Performing RT-qPCR reaction by using RNA of a sample to be detected as a template and adopting the qualitative or quantitative detection kit;

3) And (4) judging a result: if the Ct values of the two targets detected by the RT-qPCR are both greater than 30, the sample to be detected is negative; if the Ct values of the two targets detected by the RT-qPCR are both less than 30, the sample to be detected is positive; in other cases, the sample to be detected is a suspected sample and needs to be detected again.

Preferably, the Trizol method is adopted to extract the RNA of the sample to be detected.

Preferably, the reaction procedure of RT-qPCR is: 1 cycle at 25 ℃ for 2min,53 ℃ for 10min,1 cycle at 95 ℃ for 2min,40 cycles at 95 ℃ for 3second, and 60 ℃ for 30second.

A novel quantitative detection method for coronavirus which is not used for diagnosis, and is characterized by comprising the following steps:

1) Taking a quantitative sample of a novel coronavirus SARS-CoV-2RNA standard substance to carry out multiple dilution;

2) Extracting RNA of a sample to be detected;

3) Performing RT-qPCR reaction by using RNA standard and RNA of a sample to be detected as templates and adopting the quantitative detection kit;

4) Calculating the copy number of the nucleic acid corresponding to each dilution according to the known concentration of the standard substance;

5) Taking the logarithm value of the nucleic acid copy number of the quantitative RNA standard product as a Y axis, and taking the Ct value detected by RT-qPCR as an X axis to prepare a standard curve;

6) And substituting the Ct value of the sample to be detected into a linear regression equation of the standard curve to calculate the nucleic acid copy number of the sample to be detected, so as to obtain the nucleic acid concentration of the sample to be detected.

Preferably, the Trizol method is adopted to extract the RNA of the sample to be detected.

Preferably, the reaction procedure of RT-qPCR is: 1 cycle at 25 ℃ for 2min,53 ℃ for 10min,1 cycle at 95 ℃ for 2min,40 cycles at 95 ℃ for 3second, and 60 ℃ for 30second.

The invention has the following beneficial effects:

1. the invention is based on double detection targets, designs a detection primer probe composition aiming at a novel coronavirus S gene and a novel coronavirus N gene in the same detection system, and provides a novel coronavirus detection kit containing the primer probe composition and a detection method aiming at non-disease diagnosis.

2. The invention can directly detect PCR amplification products by using the fluorescent signal of the MGB molecular probe, avoids pollution without uncovering, is more rapid, realizes pollution-free and high-flux detection, and has higher sensitivity of the MGB probe than the traditional TaqMan probe.

3. The novel coronavirus detection kit and the detection method provided by the invention definitely define the critical value of positive result and negative result with Ct value of 30.00, can realize qualitative detection, can also carry out quantitative and objective detection on the nucleic acid concentration of a sample to be detected, and can accurately judge the virus content of the detected sample.

4. The method has high sensitivity, and can accurately detect samples of low-content novel coronavirus and samples of recessive infection or continuously toxic hosts.

5. The method of the invention effectively improves the reliability and the usability of the PCR technology for detecting the novel coronavirus, can be used for detecting large-batch samples of the separated virus, and is beneficial to application and popularization.

Drawings

FIG. 1 is a standard graph of RT-qPCR S and N targets;

in the figure, (a) is a novel coronavirus S protein amplification standard curve detected by single fluorescent quantitative RT-qPCR, (b) is an amplification standard curve detected by multiple fluorescent quantitative PCR, (c) is a novel coronavirus N protein amplification standard curve detected by single fluorescent quantitative PCR, and (d) is a novel coronavirus N protein amplification standard curve detected by multiple fluorescent quantitative PCR.

FIG. 2 is the agarose gel electrophoresis picture of RT-qPCR product;

in the figure, (a) is a novel coronavirus N protein amplification product, (b) is an S protein amplification product, and (c) is a double-gene amplification product.

FIG. 3 is a graph showing RT-qPCR sensitivity evaluation;

in the figure, (a) is the sensitivity of the novel coronavirus S gene detected by the single fluorescent quantitative RT-qPCR, (b) is the sensitivity of the novel coronavirus N gene detected by the single fluorescent quantitative RT-qPCR, (c) is the sensitivity of the novel coronavirus S and N genes detected by the double fluorescent quantitative RT-qPCR, (d) is the sensitivity of the novel coronavirus N gene detected by the single fluorescent quantitative RT-qPCR recommended by CDC, and (e) is the sensitivity of the novel coronavirus ORF1ab gene detected by the single fluorescent quantitative RT-qPCR recommended by CDC.

FIG. 4 is a diagram showing the evaluation of RT-qPCR specificity.

Detailed Description

The present invention will be further described with reference to specific embodiments, but the scope of the present invention is not limited thereto; the instruments and equipment used in the examples and the test examples are conventional instruments and equipment unless otherwise specified; the related reagents are all conventional reagents in the market, if not specifically indicated; the test methods involved are conventional methods unless otherwise specified.

Example 1 molecular Probe design for the detection of novel Coronaviridae

Comparing and analyzing the S gene and the N gene of the novel coronavirus in GeneBank, and screening out conserved sequences with the sizes of 102bp and 59bp in the S gene and the N gene respectively, wherein the conserved sequences are shown as follows:

s gene:

TCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAA CTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCT(SEQ ID NO：1)

n gene:

TACGTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTG GGG(SEQ ID NO：2)

taking the conserved sequence as a target gene, comprehensively considering various factors and combining practical experience, and designing 2 molecular probes as follows:

S：5'-FAM-TGCCAATAGGTATTAACAATC-3'-MGB(SEQ ID NO：3)

N：5'-VIC-TCAACTGGCAGTAACCA-3'-MGB(SEQ ID NO：4)

example 2 specific primer design for detection of novel coronaviruses

Taking the conserved sequences shown in SEQ ID NO.1 and SEQ ID NO. 2 as target genes, comprehensively considering various factors and combining practical experience, and designing two pairs of specific primers as follows:

S-For：5’-TCGGCTTTAGAACCATTGGTAGAT-3’(SEQ ID NO：5)

S-Back:5’-AGAATCACCAGGAGTCAAATAACTTCTAT-3’(SEQ ID NO：6)

N-For：5’-TACGTTTGGTGGACCCTCAGA-3’(SEQ ID NO：7)

N-Back：5’-CCCCACTGCGTTCTCCATT-3’(SEQ ID NO：8)

EXAMPLE 3 RT-qPCR reaction mixture

The embodiment provides a formula of RT-qPCR reaction mixed liquor for detecting novel coronavirus, wherein each 20 mu L of RT-qPCR reaction mixed liquor comprises the following components:

250nM is as shown in SEQ ID NO: 0.5. Mu.L of each of the two molecular probes shown in 3 and 4;

900nM is as shown in SEQ ID NO:5 and 7, 0.5 mu L of each upstream primer;

900nM is as shown in SEQ ID NO:6 and 8 respectively in a quantity of 0.5 mu L;

4×TaqPath ^TM 1-Step Multiplex Master Mix 12.5μL；

Nuclease-free water 3μL。

EXAMPLE 4 preparation of novel coronavirus (SARS-CoV-2) RNA standard

The RNA standard is used as a template for simulating the RNA of the novel coronavirus, so that the detection method can be used for detecting the novel coronavirus in a one-step method. This example provides a method for preparing a novel coronavirus (SARS-CoV-2) RNA standard, comprising the steps of:

plasmids pUC57-S and pUC57-N (synthesized by general biosystems, inc., anhui, china) were extracted using a TIANPrep Rapid mini plasmid kit (Tiangen, beijing, china). The nucleotide sequence of the plasmid pUC57-S is inserted between EcoRI cleavage sites and BamHI cleavage sites and is shown in SEQ ID NO:11, plasmid pUC57-N, having inserted between EcoRI and BamHI cleavage sites a nucleotide sequence shown in SEQ ID NO:12, or a fragment of the N gene shown in fig.

PCR-amplifying the target genes of S and N from pUC57-S and pUC57-N using transcription primers in the kit, and recovering the PCR product as T7 RiboMAX using a TIANGel Mini purification kit (TIANGEN, china, beijing) ^TM Template for Express largecale RNA system (Promega, USA). The transcription reaction mixture (20. Mu.l) contained 10. Mu.l RiboMAX ^TM Express T7 Xbuffer, 1-8. Mu.l of linear DNA template (1. Mu.g), 2. Mu.l of enzyme premix, transcription primers and nucleo-free water were incubated for 1h at 37 ℃. The DNA template is reacted for 30 minutes at 37 ℃ under the action of DNase, and finally, the transcribed RNA utilizes nucleic-free nucleoway ^TM Spin Columns purification. After being amplified by the conventional PCR primer, the cDNA is identified by 2 percent agarose gel electrophoresis. The concentration of standard RNA template is determined by NanoDrop ^TM The One Micro volume UV-Vis spectrophotometer was measured and adjusted to the concentration required for the subsequent experiment.

EXAMPLE 5 Positive control

This example provides a positive control for a one-step reverse transcription real-time fluorescent quantitative detection kit, which is a positive plasmid comprising the following nucleotide sequence (SEQ ID NO: 9):

TTGCTGCTGCTTGACAGATTCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGT TTTTAAACGGGTTTGCGGTGTACTCCAGGCAGCAGTATCGGCTTTAGAACCATTGGTAGA TTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTAT TTGACTCCTGGTGATTCTCGTGCTACAACTTCTACGTTTGGTGGACCCTCAGATTCAACT GGCAGTAACCAGAATGGAGAACGCAGTGGGGGTAA(SEQ ID NO：9)

EXAMPLE 6 novel qualitative assay kit for coronavirus

This example provides a novel qualitative assay kit for coronavirus, which comprises RT-qPCR reaction mixture (see example 3), positive control (see example 5), and negative control (nucleic-free water).

Example 7 novel quantitative detection kit for coronavirus

This example provides a novel quantitative detection kit for coronavirus, which comprises RT-qPCR reaction mixture (see example 3), a novel coronavirus (SARS-CoV-2) RNA standard (see example 4), a positive control (see example 5), and a negative control (nucleic-free water).

Example 8 Trizol method for extracting novel coronavirus Total RNA

The Trizol method is adopted to extract the RNA of a sample to be detected, and comprises the following steps:

(1) Lysis was performed by adding 1ml Trizol directly to 200. Mu.L of serum samples or PBS soaked with pharyngeal/nasal swabs. Blow and beat for several times by a sampler, shake and mix evenly.

(2) The homogenate sample was left at 15-30 ℃ for 5min to allow complete separation of the nucleic acid-protein complex.

(3) 0.2ml of chloroform was added to 1ml of Trizol, the tube was covered, shaken on a vortex shaker for 15 seconds, and left at room temperature for 3min. If the vortex mixing can not be carried out, the mixing can be manually reversed for 2 min.

(4) Centrifugation at 12 000rpm for 10-15min at 4 ℃ will separate the sample into three layers: the red organic phase, the middle layer and the upper colorless aqueous phase, with RNA predominantly in the aqueous phase, were transferred to a new tube (about 600ul, about 60% of Trizol reagent used). (e.g., to separate protein and DNA, a yellow organic phase may remain).

(5) Adding equal volume (500 ul) of isopropanol into the obtained aqueous phase solution, mixing by turning upside down, and standing at-20 deg.C for 20-30min.

(6) Centrifugation was carried out at 12 000rpm for 10min at 4 ℃ to remove the supernatant. (RNA pellet is often invisible before centrifugation, and a gelatinous pellet forms on the tube side and bottom after centrifugation.)

(7) The precipitate was washed by adding 1ml of 75% ethanol (made up of DEPC water treated water). After the addition, the tube was knocked down to try to float the RNA pellet, and at least 1ml of ethanol was added to each 1ml of Trizol. Sometimes, this step can be omitted to avoid washing the RNA away, and after washing the ethanol can be air dried or oven dried, but not too dry or not too soluble.

(8) Centrifuging at 4 ℃ and 12 000rpm for 5min, and discarding the supernatant; briefly, centrifuge rapidly, carefully aspirate the supernatant with a pipette, taking care not to aspirate the pellet.

(9) And (4) placing at room temperature for airing (not airing too dry, but the RNA is difficult to dissolve after being completely dried, and airing for about 2-3 min). Adding appropriate amount of DEPC water (30-100 ul water according to experiment requirement) or 0.5% SDS, sucking with a gun head for several times, and dissolving RNA sufficiently. The temperature is kept at 50 ℃ for 1 hour. For example, RNA is used for the cleavage reaction, and SDS solution is not used. RNA can also be with 100% deionized formamide. Dissolution and preservation at-70 ℃. Can be stored separately, can prevent pollution,

(10) 1ul of Buffer is used for electrophoresis detection of RNA integrity, diluted by a certain multiple, and purity and concentration are measured by a spectrophotometer.

Example 9 qualitative detection of novel coronavirus

This example provides a method for qualitatively detecting a novel coronavirus using the novel coronavirus detection kit provided in example 6, comprising the steps of:

(1) Extracting RNA of a sample to be detected;

(2) Preparing a RT-qPCR reaction mixture (see example 3);

(3) Adding 5 mu L of sample RNA into 20 mu L of reaction mixed solution to carry out RT-qPCR reaction; meanwhile, 5 μ L of positive plasmid is taken as a positive control, and 5 μ L of nucleic-free water is taken as a negative control;

(4) And (4) judging a result: if the Ct values of the two targets detected by the RT-qPCR are both greater than 30, the sample to be detected is negative; if the Ct values of the two targets detected by RT-qPCR are both less than 30, the sample to be detected is positive; otherwise, the detection is suspected to be needed again.

Preferably, the reaction procedure of RT-qPCR is: 1 cycle at 25 ℃ for 2min,53 ℃ for 10min,1 cycle at 95 ℃ for 2min,40 cycles at 95 ℃ for 3second, and 60 ℃ for 30second.

Example 9 method for quantitative detection of novel coronavirus

This example provides a method for quantitative detection of a novel coronavirus using the novel coronavirus detection kit provided in example 7, comprising the steps of:

(1) Taking a quantitative RNA standard product for dilution by times;

(2) Extracting RNA of a sample to be detected (see example 7);

(3) Taking RT-qPCR reaction mixed liquor;

(4) Diluting the standard at a 5 μ L multiple ratio (initial concentration of 10) ⁹ copies) and 5 mul of RNA of a sample to be detected are added into 20 mul of reaction solution or diluted reaction solution for RT-qPCR reaction;

(5) Calculating the copy number of the nucleic acid corresponding to each dilution according to the concentration of the known standard substance; the calculation formula is as follows: n (ml) = [ C (g/ml)/MW (g/mol)]×6.02×10 ²³ (copies/mol), wherein N is the copy number, C is the plasmid concentration, MW molecular weight, MW = number of bases (B) × 2 × 330 (g/mol) — B is the sum of the number of insert bases and the number of vector bases;

(6) Taking the logarithm value of the nucleic acid copy number of the quantitative standard substance as a Y axis, and taking the Ct value detected by RT-qPCR as an X axis to prepare a standard curve;

(7) And substituting the Ct value of the sample to be detected into a linear regression equation of the standard curve to calculate the nucleic acid copy number of the sample to be detected, thus obtaining the nucleic acid concentration of the sample to be detected.

Preferably, the reaction procedure of RT-qPCR is as follows: 1 cycle at 25 ℃ for 2min,53 ℃ for 10min,1 cycle at 95 ℃ for 2min,40 cycles at 95 ℃ for 3second, and 60 ℃ for 30second.

EXAMPLE 10 kit reproducibility, sensitivity and specificity evaluation

This example tests the reproducibility, sensitivity and specificity of the novel coronavirus detection kit provided in example 7, and the detection method is described in example 9.

(1) Drawing of Standard Curve

Will be 1 × 10 ¹⁰ The RNA standard substance gradient of copies/mu L is diluted 10 times to 1X 100 copies/mu L, 3 replicates of each concentration gradient are subjected to the fluorescent quantitative PCR test, and the fluorescent quantitative PCR test is carried out by ABI 7500The PCR instrument automatically generates a standard curve. And subjected to nucleic acid electrophoresis using 1.5% by volume of agarose gel to identify amplified fragments.

As shown in FIGS. 1 and 2, in FIG. 1, the logarithm of the plasmid concentration is the abscissa, the Ct value is the ordinate, and it can be seen from FIG. 1 that the slope of the S gene standard curve is-3.053, the intercept is 34.702, and the correlation coefficient is 0.994, and the equation of the standard curve is obtained as: y = -3.053X +34.702; the slope of the N gene standard curve is 3.159, the intercept is 35.657, the correlation coefficient is 0.997, and the obtained standard curve equation is as follows: y =3.159X +35.657; after nucleic acid electrophoresis on a 1.5% agarose gel, two specific bands of sizes of about 102bp and 59bp were observed (FIG. 2), consistent with the expected results.

(2) Evaluation of reproducibility

By 1X 10 ¹ ～1×10 ¹⁰ Replicate experiments were performed in 3 replicates per concentration gradient of RNA standards at copies/. Mu.L and coefficient of variation CV was calculated from the Ct values obtained.

The results of the repeatability tests are shown in tables 1 and 2:

TABLE 1 coefficient of variation of Ct value for each concentration gradient of S gene

TABLE 2 coefficient of variation of Ct value for each concentration gradient of N gene

Table 1 shows that the method has good repeatability, the coefficient of variation Cv of each concentration gradient of S gene is less than 3.66%, and the coefficient of variation Cv of each concentration gradient of N gene is less than 2.82%, which indicates that the real-time one-step reverse transcription fluorescence quantitative PCR detection method has good stability.

(3) Evaluation of sensitivity

By 1X 10 ⁰ ～1×10 ¹⁰ The lowest detection concentration of the method was determined by performing a sensitivity test in 3 replicates per concentration gradient of RNA standards per copy/. Mu.L.

The results are shown in FIG. 3. FIG. 3a is a sensitivity measurement amplification curve for the S gene, FIG. 3b is a sensitivity measurement amplification curve for the N gene, FIG. 3c is a sensitivity measurement curve for simultaneous amplification of the S gene and the N gene, FIG. 3d is a sensitivity measurement curve for amplification using primers and probes for the N gene recommended by CDC, and FIG. 3e is a sensitivity measurement curve for amplification using primers and probes for the ORF1ab gene recommended by CDC. As can be seen from FIG. 3, the kit provided by the present invention can detect RNA standard substance of 1X 100 copies/. Mu.L at the lowest for S gene, and can detect RNA standard substance of 1000 copies/. Mu.L at the lowest for N gene, and the lowest for N gene can detect 10 for CDC recommended ⁴ copies/. Mu.L, minimal detectable ORF1ab Gene 10 ⁷ The copies/. Mu.L shows that the kit provided by the invention has extremely high sensitivity.

(4) Evaluation of specificity

The amplification curve is observed by performing fluorescent quantitative PCR reaction by using SARS virus cDNA (SARS), middle east respiratory syndrome virus cDNA (MERS), cDNA of Bat SARS-like viruses (PEDV) and transcription RNA of novel coronavirus (SARS-CoV-2) as templates.

The results are shown in FIG. 4, and it can be seen from FIG. 4 that: only the transcribed RNA of the novel coronavirus shows an amplification curve, and the cDNA of the other viruses have no amplification curve, so that the method has good specificity.

<110> Henan Zhongze bioengineering, inc

<120> primer probe composition, kit and method for detecting novel coronavirus

<160> 12

<170> PatentIn version 3.5

<210> 1

<211> 105

<212> DNA

<213> Artificial sequence

<221> S Gene target sequence

<400> 1

tcggctttag aaccattggt agatttgcca ataggtatta acatcactag gtttcaaact 60

ttacttgctt tacatagaag ttatttgact cctggtgatt cttct 105

<210> 2

<211> 59

<212> DNA

<213> Artificial sequence

<221> N Gene target sequence

<400> 2

tacgtttggt ggaccctcag attcaactgg cagtaaccag aatggagaac gcagtgggg 59

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<221> S Gene detection Probe

<400> 3

tgccaatagg tattaacaat c 21

<210> 4

<211> 17

<212> DNA

<213> Artificial sequence

<221> N Gene detection Probe

<400> 4

tcaactggca gtaacca 17

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<221> S-For

<400> 5

tcggctttag aaccattggt agat 24

<210> 6

<211> 29

<212> DNA

<213> Artificial sequence

<221> S-Back

<400> 6

agaatcacca ggagtcaaat aacttctat 29

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence

<221> N-For

<400> 7

tacgtttggt ggaccctcag a 21

<210> 8

<211> 19

<212> DNA

<213> Artificial sequence

<221> N-Back

<400> 8

ccccactgcg ttctccatt 19

<210> 9

<211> 273

<212> DNA

<213> Artificial sequence

<221> Positive plasmid

<400> 9

ttgctgctgc ttgacagatt cgcgaaccca tgcttcagtc agctgatgca caatcgtttt 60

taaacgggtt tgcggtgtac tccaggcagc agtatcggct ttagaaccat tggtagattt 120

gccaataggt attaacatca ctaggtttca aactttactt gctttacata gaagttattt 180

gactcctggt gattctcgtg ctacaacttc tacgtttggt ggaccctcag attcaactgg 240

cagtaaccag aatggagaac gcagtggggg taa 273

<210> 10

<211> 273

<212> RNA

<213> Artificial sequence

<221> RNA Standard

<400> 10

uugcugcugc uugacagauu cgcgaaccca ugcuucaguc agcugaugca caaucguuuu 60

Uaaacggguu ugcgguguac uccaggcagc aguaucggcu uuagaaccau ugguagauuu 120

Gccaauaggu auuaacauca cuagguuuca aacuuuacuu gcuuuacaua gaaguuauuu 180

Gacuccuggu gauucucgug cuacaacuuc uacguuuggu ggacccucag auucaacugg 240

Caguaaccag aauggagaac gcaguggggg uaa 273

<210> 11

<211> 3822

<212> DNA

<213> Artificial sequence

<221> pUC57-S plasmid S Gene fragment

<400> 11

atgtttgttt ttcttgtttt attgccacta gtctctagtc agtgtgttaa tcttacaacc 60

agaactcaat taccccctgc atacactaat tctttcacac gtggtgttta ttaccctgac 120

aaagttttca gatcctcagt tttacattca actcaggact tgttcttacc tttcttttcc 180

aatgttactt ggttccatgc tatacatgtc tctgggacca atggtactaa gaggtttgat 240

aaccctgtcc taccatttaa tgatggtgtt tattttgctt ccactgagaa gtctaacata 300

ataagaggct ggatttttgg tactacttta gattcgaaga cccagtccct acttattgtt 360

aataacgcta ctaatgttgt tattaaagtc tgtgaatttc aattttgtaa tgatccattt 420

ttgggtgttt attaccacaa aaacaacaaa agttggatgg aaagtgagtt cagagtttat 480

tctagtgcga ataattgcac ttttgaatat gtctctcagc cttttcttat ggaccttgaa 540

ggaaaacagg gtaatttcaa aaatcttagg gaatttgtgt ttaagaatat tgatggttat 600

tttaaaatat attctaagca cacgcctatt aatttagtgc gtgatctccc tcagggtttt 660

tcggctttag aaccattggt agatttgcca ataggtatta acatcactag gtttcaaact 720

ttacttgctt tacatagaag ttatttgact cctggtgatt cttcttcagg ttggacagct 780

ggtgctgcag cttattatgt gggttatctt caacctagga cttttctatt aaaatataat 840

gaaaatggaa ccattacaga tgctgtagac tgtgcacttg accctctctc agaaacaaag 900

tgtacgttga aatccttcac tgtagaaaaa ggaatctatc aaacttctaa ctttagagtc 960

caaccaacag aatctattgt tagatttcct aatattacaa acttgtgccc ttttggtgaa 1020

gtttttaacg ccaccagatt tgcatctgtt tatgcttgga acaggaagag aatcagcaac 1080

tgtgttgctg attattctgt cctatataat tccgcatcat tttccacttt taagtgttat 1140

ggagtgtctc ctactaaatt aaatgatctc tgctttacta atgtctatgc agattcattt 1200

gtaattagag gtgatgaagt cagacaaatc gctccagggc aaactggaaa gattgctgat 1260

tataattata aattaccaga tgattttaca ggctgcgtta tagcttggaa ttctaacaat 1320

cttgattcta aggttggtgg taattataat tacctgtata gattgtttag gaagtctaat 1380

ctcaaacctt ttgagagaga tatttcaact gaaatctatc aggccggtag cacaccttgt 1440

aatggtgttg aaggttttaa ttgttacttt cctttacaat catatggttt ccaacccact 1500

aatggtgttg gttaccaacc atacagagta gtagtacttt cttttgaact tctacatgca 1560

ccagcaactg tttgtggacc taaaaagtct actaatttgg ttaaaaacaa atgtgtcaat 1620

ttcaacttca atggtttaac aggcacaggt gttcttactg agtctaacaa aaagtttctg 1680

cctttccaac aatttggcag agacattgct gacactactg atgctgtccg tgatccacag 1740

acacttgaga ttcttgacat tacaccatgt tcttttggtg gtgtcagtgt tataacacca 1800

ggaacaaata cttctaacca ggttgctgtt ctttatcagg atgttaactg cacagaagtc 1860

cctgttgcta ttcatgcaga tcaacttact cctacttggc gtgtttattc tacaggttct 1920

aatgtttttc aaacacgtgc aggctgttta ataggggctg aacatgtcaa caactcatat 1980

gagtgtgaca tacccattgg tgcaggtata tgcgctagtt atcagactca gactaattct 2040

cctcggcggg cacgtagtgt agctagtcaa tccatcattg cctacactat gtcacttggt 2100

gcagaaaatt cagttgctta ctctaataac tctattgcca tacccacaaa ttttactatt 2160

agtgttacca cagaaattct accagtgtct atgaccaaga catcagtaga ttgtacaatg 2220

tacatttgtg gtgattcaac tgaatgcagc aatcttttgt tgcaatatgg cagtttttgt 2280

acacaattaa accgtgcttt aactggaata gctgttgaac aagacaaaaa cacccaagaa 2340

gtttttgcac aagtcaaaca aatttacaaa acaccaccaa ttaaagattt tggtggtttt 2400

aatttttcac aaatattacc agatccatca aaaccaagca agaggtcatt tattgaagat 2460

ctacttttca acaaagtgac acttgcagat gctggcttca tcaaacaata tggtgattgc 2520

cttggtgata ttgctgctag agacctcatt tgtgcacaaa agtttaacgg ccttactgtt 2580

ttgccacctt tgctcacaga tgaaatgatt gctcaataca cttctgcact gttagcgggt 2640

acaatcactt ctggttggac ctttggtgca ggtgctgcat tacaaatacc atttgctatg 2700

caaatggctt ataggtttaa tggtattgga gttacacaga atgttctcta tgagaaccaa 2760

aaattgattg ccaaccaatt taatagtgct attggcaaaa ttcaagactc actttcttcc 2820

acagcaagtg cacttggaaa acttcaagat gtggtcaacc aaaatgcaca agctttaaac 2880

acgcttgtta aacaacttag ctccaatttt ggtgcaattt caagtgtttt aaatgatatc 2940

ctttcacgtc ttgacaaagt tgaggctgaa gtgcaaattg ataggttgat cacaggcaga 3000

cttcaaagtt tgcagacata tgtgactcaa caattaatta gagctgcaga aatcagagct 3060

tctgctaatc ttgctgctac taaaatgtca gagtgtgtac ttggacaatc aaaaagagtt 3120

gatttttgtg gaaagggcta tcatcttatg tccttccctc agtcagcacc tcatggtgta 3180

gtcttcttgc atgtgactta tgtccctgca caagaaaaga acttcacaac tgctcctgcc 3240

atttgtcatg atggaaaagc acactttcct cgtgaaggtg tctttgtttc aaatggcaca 3300

cactggtttg taacacaaag gaatttttat gaaccacaaa tcattactac agacaacaca 3360

tttgtgtctg gtaactgtga tgttgtaata ggaattgtca acaacacagt ttatgatcct 3420

ttgcaacctg aattagactc attcaaggag gagttagata aatattttaa gaatcataca 3480

tcaccagatg ttgatttagg tgacatctct ggcattaatg cttcagttgt aaacattcaa 3540

aaagaaattg accgcctcaa tgaggttgcc aagaatttaa atgaatctct catcgatctc 3600

caagaacttg gaaagtatga gcagtatata aaatggccat ggtacatttg gctaggtttt 3660

atagctggct tgattgccat agtaatggtg acaattatgc tttgctgtat gaccagttgc 3720

tgtagttgtc tcaagggctg ttgttcttgt ggatcctgct gcaaatttga tgaagacgac 3780

tctgagccag tgctcaaagg agtcaaatta cattacacat aa 3822

<210> 12

<211> 1260

<212> DNA

<213> Artificial sequence

<221> pUC57-N plasmid N Gene fragment

<400> 12

atgtctgata atggacccca aaatcagcga aatgcacccc gcattacgtt tggtggaccc 60

tcagattcaa ctggcagtaa ccagaatgga gaacgcagtg gggcgcgatc aaaacaacgt 120

cggccccaag gtttacccaa taatactgcg tcttggttca ccgctctcac tcaacatggc 180

aaggaagacc ttaaattccc tcgaggacaa ggcgttccaa ttaacaccaa tagcagtcca 240

gatgaccaaa ttggctacta ccgaagagct accagacgaa ttcgtggtgg tgacggtaaa 300

atgaaagatc tcagtccaag atggtatttc tactacctag gaactgggcc agaagctgga 360

cttccctatg gtgctaacaa agacggcatc atatgggttg caactgaggg agccttgaat 420

acaccaaaag atcacattgg cacccgcaat cctgctaaca atgctgcaat cgtgctacaa 480

cttcctcaag gaacaacatt gccaaaaggc ttctacgcag aagggagcag aggcggcagt 540

caagcctctt ctcgttcctc atcacgtagt cgcaacagtt caagaaattc aactccaggc 600

agcagtaggg gaacttctcc tgctagaatg gctggcaatg gcggtgatgc tgctcttgct 660

ttgctgctgc ttgacagatt gaaccagctt gagagcaaaa tgtctggtaa aggccaacaa 720

caacaaggcc aaactgtcac taagaaatct gctgctgagg cttctaagaa gcctcggcaa 780

aaacgtactg ccactaaagc atacaatgta acacaagctt tcggcagacg tggtccagaa 840

caaacccaag gaaattttgg ggaccaggaa ctaatcagac aaggaactga ttacaaacat 900

tggccgcaaa ttgcacaatt tgcccccagc gcttcagcgt tcttcggaat gtcgcgcatt 960

ggcatggaag tcacaccttc gggaacgtgg ttgacctaca caggtgccat caaattggat 1020

gacaaagatc caaatttcaa agatcaagtc attttgctga ataagcatat tgacgcatac 1080

aaaacattcc caccaacaga gcctaaaaag gacaaaaaga agaaggctga tgaaactcaa 1140

gccttaccgc agagacagaa gaaacagcaa actgtgactc ttcttcctgc tgcagatttg 1200

gatgatttct ccaaacaatt gcaacaatcc atgagcagtg ctgactcaac tcaggcctaa 1260

Claims (10)

1. The primer probe composition for detecting the novel coronavirus is characterized by comprising a first primer probe taking an S gene as a target and a second primer probe taking an N gene as a target; the first primer probe comprises a probe sequence as set forth in SEQ ID NO:5, and the upstream primer shown as SEQ ID NO:6 and an S gene detection probe, wherein the nucleotide sequence of the S gene detection probe is shown as SEQ ID NO:3, a fluorescence reporter group FAM is marked at the 5 'end, and a fluorescence quenching group MGB is marked at the 3' end; the second primer probe comprises the nucleotide sequence shown as SEQ ID NO:7, and the upstream primer shown as SEQ ID NO:8 and an N gene detection probe, wherein the nucleotide sequence of the N gene detection probe is shown as SEQ ID NO:4, a fluorescence reporter group VIC is marked at the 5 'end, and a fluorescence quenching group MGB is marked at the 3' end.

2. A novel qualitative detection kit for coronavirus, characterized by comprising RT-qPCR reaction mixed liquor, wherein the RT-qPCR reaction mixed liquor comprises the primer probe composition of claim 1.

3. The novel quantitative detection kit for coronavirus is characterized by comprising RT-qPCR reaction mixed liquor, wherein the RT-qPCR reaction mixed liquor comprises the primer probe composition as claimed in claim 1, and further comprising a novel coronavirus SARS-CoV-2RNA standard product, wherein the sequence of the RNA standard product is shown as SEQ ID NO: shown at 10.

4. The kit according to claim 2 or 3, wherein each 20 μ L of RT-qPCR reaction mixture comprises the following components: 250nM is as shown in SEQ ID NO: 0.5. Mu.L of each of the two molecular probes shown in 3 and 4; 900nM is as shown in SEQ ID NO:5 and 7, 0.5 mu L of each upstream primer; 900nM is as shown in SEQ ID NO: 0.5. Mu.L of each of the downstream primers shown in 6 and 8; 4 × TaqPath ^TM 1-Step Multiplex Master Mix 12.5μL；Nuclease-free water 3μL。

5. The kit of claim 2 or 3, further comprising a positive control comprising a nucleic acid sequence as set forth in SEQ ID NO:9, and a plasmid positive for the nucleotide sequence shown in figure 9.

6. The kit of claim 2 or 3, further comprising a negative control, wherein the negative control is a nucleic-free water.

7. A novel qualitative detection method of coronaviruses for non-diagnostic purposes, characterized in that it comprises the following steps:

1) Extracting RNA of a sample to be detected;

2) Performing RT-qPCR reaction by using RNA of a sample to be detected as a template and adopting the kit of any one of claims 2 to 6;

3) And (4) judging a result: if the Ct values of the two targets detected by the RT-qPCR are both greater than 30, the sample to be detected is negative; if the Ct values of the two targets detected by RT-qPCR are both less than 30, the sample to be detected is positive; in other cases, the sample to be detected is a suspected sample and needs to be detected again.

8. A novel quantitative detection method for coronavirus which is not used for diagnosis, and is characterized by comprising the following steps:

1) Taking a quantitative coronavirus SARS-CoV-2RNA standard substance for multiple dilution;

2) Extracting RNA of a sample to be detected;

3) Performing RT-qPCR reaction by using RNA standard and RNA of a sample to be detected as templates and adopting the kit of any one of claims 3-6;

4) Calculating the copy number of the nucleic acid corresponding to each dilution according to the known concentration of the standard substance;

5) Taking the logarithm value of the nucleic acid copy number of the quantitative RNA standard product as a Y axis, and taking the Ct value detected by RT-qPCR as an X axis to prepare a standard curve;

6) And substituting the Ct value of the sample to be detected into a linear regression equation of the standard curve to calculate the nucleic acid copy number of the sample to be detected, so as to obtain the nucleic acid concentration of the sample to be detected.

9. The detection method according to claim 7 or 8, wherein the RNA of the sample to be detected is extracted by a Trizol method.

10. The detection method according to claim 7 or 8, wherein the reaction procedure of RT-qPCR is as follows: 1 cycle at 25 ℃ for 2min,53 ℃ for 10min,1 cycle at 95 ℃ for 2min,40 cycles at 95 ℃ for 3second, and 60 ℃ for 30second.

Images