CN115404237B

CN115404237B - Combination product, kit, use and method for detecting mutant SARS-CoV-2 virus

Info

Publication number: CN115404237B
Application number: CN202110592489.6A
Authority: CN
Inventors: 高堂杰; 郭鑫武; 何翔; 谭德勇; 任小梅; 吴康; 戴立忠; 刘佳; 邓中平; 缪为民
Original assignee: Sansure Biotech Inc
Current assignee: Sansure Biotech Inc
Priority date: 2021-05-28
Filing date: 2021-05-28
Publication date: 2024-01-26
Anticipated expiration: 2041-05-28
Also published as: CN115404237A

Abstract

The invention relates to the field of biotechnology and medicine, in particular to a combined product, a kit, application and a method for detecting mutant SARS-CoV-2 virus. The primer probes are designed for N501Y, P681H and HV69-70del respectively, so that the sensitivity is high, and the mutation can be specifically detected.

Description

Combination product, kit, use and method for detecting mutant SARS-CoV-2 virus

Technical Field

The invention relates to the field of biotechnology and medicine, in particular to a combined product, a kit, application and a method for detecting mutant SARS-CoV-2 virus.

Background

At present, a nucleic acid detection kit for screening novel coronaviruses (SARS-CoV-2) has a primer probe whose design region is located at the N gene, the ORF1ab gene or the E gene. Under the condition that the detection area is not mutated, variant strains of different types can be detected, but key mutation sites of the variant strains cannot be distinguished, so that more accurate guidance is difficult to provide for clinical treatment and prevention and control. And once the detection area is mutated, the detection sensitivity is affected to a certain extent, so that the positive detection rate is drastically reduced.

Therefore, there is a strong need in the art for a related technology and product that can efficiently detect novel coronaviruses, and also can identify and detect key mutation sites.

In view of this, the present invention has been made.

Disclosure of Invention

According to the design scheme adopted by the invention, the N501Y, P681H mutation and the HV69-70del mutation can be detected at the same time with high efficiency, so that the detection method can be used for screening viruses and distinguishing the key mutation, is applicable to detection of different sample types, and can well solve the problems. In order to achieve the above object of the present invention, the following technical solutions are specifically adopted:

the first aspect of the invention relates to a primer probe combination product comprising a and/or b:

a) The nucleotide sequence is SEQ ID NO: 1-6 and the primers shown in SEQ ID NO:7 to 9;

b) The nucleotide sequence is SEQ ID NO: 10-15, and the primers shown in SEQ ID NO:16 to 18.

The second aspect of the invention relates to a kit comprising a primer probe combination product as described above.

A third aspect of the invention relates to the use of a primer probe combination product as described above for the preparation of a kit for detecting mutant SARS-CoV-2 virus.

A fourth aspect of the invention relates to a method for detecting mutant SARS-CoV-2 virus, the method comprising the steps of:

a) Obtaining nucleic acid in a sample to be detected;

b) Amplification is performed using the nucleic acid as a template using the primer probe combination product described above, or the kit described above, to determine whether at least one of the three mutant forms of SARS-CoV-2 virus, N501Y, P681H and HV69-70del, is present in the sample.

The beneficial effects of the invention are as follows:

the primer probes are designed for N501Y, P681H and HV69-70del respectively, so that the sensitivity is high, and the mutation can be specifically detected.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.

FIG. 1 is an amplification curve corresponding to the primer probe combinations in Table 1 for amplifying a positive sample with a mutation according to an embodiment of the present invention;

FIG. 2 is an amplification curve corresponding to the primer probe combinations in Table 2 for amplifying a positive sample with a mutation according to an embodiment of the present invention;

FIG. 3 is an amplification curve corresponding to the primer probe combinations of Table 1 in one embodiment of the present invention when amplifying a negative sample without mutation;

FIG. 4 is an amplification curve corresponding to the primer probe combinations in Table 2 for amplifying a negative sample without mutation according to an embodiment of the present invention;

FIG. 5 is a graph showing amplification curves corresponding to combinations of primer probes in Table 1 for amplifying samples of different concentrations according to an embodiment of the present invention;

FIG. 6 is an amplification curve corresponding to the primer probe combinations of Table 2 for amplifying samples of different concentrations in one embodiment of the present invention.

Detailed Description

Reference now will be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. Indeed, it will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the scope or spirit of the invention. For example, features illustrated or described as part of one embodiment can be used on another embodiment to yield still a further embodiment.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and/or" as used herein includes any and all combinations of one or more of the associated listed items.

One aspect of the invention relates to a primer probe combination product comprising a and/or b:

The primer and the probe adopt ARMS-PCR (amplification refractory mutation system), namely a mutation blocking amplification system for mutation detection, and the principle is that the characteristic that DNA polymerase lacks 3' -5' exonuclease activity is utilized, and under a certain reaction system or condition, the mismatch of the 3' end of the PCR primer leads to the rapid reduction of the PCR amplification efficiency, even no amplification. Therefore, the purpose of detecting the mutation site is achieved by a fluorescent PCR method by designing a proper primer and a fluorescent probe aiming at the known mutation site.

The design scheme of the invention is that primer probes are respectively designed for N501Y, P681H and HV69-70del, so that the sensitivity is high, mutation can be specifically detected, wild type and mutant novel coronaviruses can be distinguished according to detection results, effective guidance can be provided for epidemic prevention and control and patient treatment, and epidemic prevention is more scientific and accurate.

The sensitivity of the novel coronavirus key mutation detection system provided by the invention can reach 200copies/mL; and has good detection specificity, and detects 1×10 ⁶ The copies/mL wild novel coronavirus nucleic acid and other pathogenic microorganism nucleic acid samples with homology similarity with the novel coronavirus nucleic acid sequence have no non-specific amplification, and can meet clinical requirements.

The sequence region (Genbank accession number: NC_045512.2:21519-25412) in which the N501Y, P681H and HV69-70del mutations on the novel coronavirus S gene were located was searched for by NCBI, and primer probe design was performed, and the amplification sequence and primer probe are as follows. The invention constructs a PCR detection system to detect the three mutations, and the specific detection sequence and the specific detection sites are shown as follows (the underlined part is the base change of the mutation site detected by the invention).

ACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCT{ATACATG>A，HV 69-70del}TACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACT{A>T，N501Y}ATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTC{C>A，P681H}TCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAA

In some embodiments, the primer probe combination product further comprises a quality control primer and/or a quality control probe for detecting a conserved segment of the SARS-CoV-2 gene.

The SARS-CoV-2 gene conserved region may be selected from any gene of the novel coronavirus, such as ORF1ab gene, S gene, E gene, M gene, N gene, and preferably, the SARS-CoV-2 gene conserved region is not selected from the S gene. In some embodiments, the conserved regions are from the SARS-CoV-2N gene.

In some embodiments, the nucleotide sequence of the quality control primer is SEQ ID NO: 19-20, wherein the nucleotide sequence of the quality control probe is SEQ ID NO: 21.

And (3) designing a primer probe aiming at an N gene conserved region, and performing quality control on the nucleic acid content of the novel coronavirus in the sample through the amplification of the N gene, so that false positive detection results caused by overhigh nucleic acid concentration or false negative results caused by overhigh nucleic acid concentration are avoided.

The conserved regions are relative to the mutation frequency of the sample to be detected, and nucleic acid fragments with low mutation frequency known in SARS-CoV-2 can be selected to ensure that the quality control primer can stably detect the SARS-CoV-2 in the sample. In some embodiments, the conserved region is capable of hybridizing to SEQ ID NO: 19-20, and the primer shown in SEQ ID NO: 21; "stringent conditions" are well known and include, for example, hybridization in a hybridization solution containing 400mM NaCl, 40mM PIPES (pH 6.4) and 1mM EDTA at 60℃for 12 to 16 hours, followed by washing with a washing solution containing 0.1% SDS and 0.1% SSC at 65℃for 15 to 60 minutes. In some specific embodiments, the conserved region comprises SEQ ID NO: 22.

N Gene detection region sequence (GenBank: LC 528233.2)

CTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGG(SEQ ID NO：22)

In addition, in one aspect, useful primers and probes include nucleotide sequences that are greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the primers or probes provided in tables 1 and 2. Such primer and probe modifications are also contemplated and can be prepared according to standard techniques.

The term "% identity" in the context of two or more nucleotide sequences or amino acid sequences refers to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. For example,% identity is the entire length of the coding region relative to the sequences to be compared.

For sequence comparison, typically one sequence is used as a reference sequence, and the test sequence is compared to that sequence. When using a sequence comparison algorithm, the test sequence and reference sequence are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the specified program parameters. The percent identity can be determined using search algorithms such as BLAST and PSI-BLAST (Altschul et al, 1990, J Mol Biol 215:3,403-410;Altschul et al, 1997,Nucleic Acids Res25:17,3389-402).

The primer and probe modification may be performed by a known method. Modified versions of these primer and/or probe sequences can include, by way of non-limiting example, adding one or more nucleotides to the 5 'end, one or more nucleotides to the 3' end, one or more nucleotides to the 5 'and 3' ends, adding tails, shortening the sequence, extending the sequence, shifting the sequence several bases upstream and downstream, or any combination thereof.

Base modifications such as 3'P, 5'P, 5-nitroindole, 2-aminopurine, 8-amino-2 ' -deoxyadenosine, C-5 propynyl-deoxycytidine, C-5 propynyl-deoxyuridine, 2-amino-2 ' -deoxyadenosine-5 ' -triphosphate, 2, 6-diaminopurine (2-amino-dA), inverted dT, inverted dideoxy-T, hydroxymethyl dC, iso-dC, 5-methyl dC, aminoethyl-phenoxazine-deoxycytidine, and locked nucleic acids (LNA's) and include at least one mismatched base at one of the bases, or at least one of the bases is replaced with an RNA base, to effect, for example, an increase in nucleic acid interactions at the 3' end of the mutant-specific primer to increase Tm. The addition of double-stranded stable base modifications has a positive effect on PCR, enabling it to be performed at higher temperatures, within which Taq polymerase is known to exhibit maximum activity. The modified probe should retain the ability to distinguish between the mutation site to be detected and the wild-type site.

In some embodiments, the probe is labeled with a detectable signal substance.

In some embodiments, the signal species are fluorophores, colorimetric labels, colloidal gold, quantum dots, biotin, and other tag molecules that can be used for detection (e.g., alkyne groups for raman diffraction imaging, cyclic olefins for click reactions, priming groups for polymer labeling), and can also be selected from polypeptide/protein molecules, LNA/PNAs, unnatural amino acids and analogs thereof (e.g., peptidomimetics), unnatural nucleic acids and analogs thereof (pseudonucleotides) and nanostructures (including inorganic nanoparticles, NV-centers, aggregation/assembly-induced emission molecules, rare earth ion ligand molecules, polymetallic oxygen clusters, and the like).

In some embodiments, the probe is labeled with a fluorescent substance.

In some embodiments, the fluorescent substance may be selected from the group consisting of fluorescein-based dyes, rhodamine-based dyes, and cyanine dyes.

In some embodiments, the fluorescein-based dye includes standard fluorescein and its derivatives, such as Fluorescein Isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), and the like.

In some embodiments, the rhodamine-based dye includes R101, tetraethylrhodamine (RB 200), carboxytetramethyl rhodamine (TAMRA), and the like.

In some embodiments, the cyanine dye is selected from two main classes, one class being Thiazole Orange (TO), oxazole orange (YO) series and dimers thereof, and the other class being polymethine series cyanine dyes.

In some embodiments, the fluorophore may also be selected from the following dyes: stilbene, naphthalimide, coumarin, acridine, pyrene, etc.

In some preferred embodiments, the fluorescent substance on each probe is independently selected from one or two of AMCA, atto 425, atto 590, FAM, HEX, TET, NED, ROX, CY5, CY5.5, CY3, texas Red, TFAM, TAMRA, VIC, and JOE.

In some preferred embodiments, SEQ ID NO: 7-9, the fluorescent substances on the probes can be distinguished under the same reaction system; further, SEQ ID NO: the fluorescent substances on the probes shown in 7 to 9 and 21 can be distinguished under the same reaction system.

In some preferred embodiments, SEQ ID NO: the fluorescent substances on the probes shown in 16-18 can be distinguished under the same reaction system; further, SEQ ID NO: the fluorescent substances on the probes shown by 16 to 18 and 21 can be distinguished under the same reaction system.

Fluorescent substances can be distinguished under the same reaction system, for example, meaning that different fluorescent channels can be used for typing each other. Different combinations of other fluorescent channels are possible; meanwhile, different targets can also correspond to different fluorescent channels, for example, any fluorescent channel can be used as an internal standard detection channel.

Fluorophores are typically labeled at the 5 'end of the primer or probe sequence, but may be placed at the 3' end or modified intermediately by changing modification bonds (e.g., -OH or-NH bonds), or may be modified simultaneously by at least two of the 3 'end, 5' end, or intermediate modifications.

The invention also relates to a kit of the primer-probe combination product.

The term "kit" refers to any article of manufacture (e.g., package or container) comprising at least one device, which may further comprise instructions, supplemental reagents, and/or components or assemblies for use in the methods described herein or steps thereof.

In some embodiments, the kit further comprises dNTPs, mg ²⁺ At least one of a DNA polymerase (in particular Taq enzyme), reverse transcriptase, PCR buffer, RNase inhibitor, positive control and negative control suitable for ARMS-PCR system;

the negative control and the positive control are SARS-CoV-2 nucleic acid fragments containing complementary pairing sequences with a detection primer of a mutation site to be detected under strict conditions; the negative control does not contain mutation sites to be detected; the positive control contains the mutation site to be detected.

Preferably, the nucleic acid components of the kit, such as primers, probes, positive controls, and negative controls, are stored in the kit in dry powder form. The positive control and the negative control may also be present as plasmids.

The components are preferably realized in lyophilized form, for example in the form of one or more so-called lyophilized beads. Lyophilization beads are generally understood to mean lyophilisates which are pressed into spheres after manufacture, after which the substance is usually present as a powder. Thus, the components required for a PCR batch, in particular the DNA polymerase, the nucleic acid components and the reaction buffer components, can be provided, for example, in lyophilized form. In this way, the PCR process can be started directly in a very user-friendly manner by adding the sample to be quantified and optionally other desired components. In particular, the provision of a lyophilized form is very advantageous for automated applications.

The invention also relates to a solution, which is obtained by mixing the components in the kit and the template nucleic acid.

A solution is also understood to be a reaction system, wherein, when the kit contains both a and b components, the two components are preferably located in two different solution systems.

In a preferred embodiment of the reaction mixture, the amount of reference DNA (negative control and/or positive control) may be present in a concentration corresponding to the detection limit of the DNA fragment to be quantified. Furthermore, depending on the application, it may be provided that the target DNA and the reference DNA are present in a ratio of 1:1, and furthermore in specific amounts.

The invention also relates to the application of the primer probe combination product in preparing a kit for detecting mutant SARS-CoV-2 virus.

The primer probe combination product provided by the invention can be used for detecting mutant SARS-CoV-2 virus, especially at least one of three mutant forms of N501Y, P681H and HV69-70del of S gene.

Thus, in particular, the invention also relates to a method for detecting mutant SARS-CoV-2 virus, said method comprising:

a) Obtaining nucleic acid in a sample to be detected;

The methods can be used to diagnose a mutated SARS-CoV-2 infection, or to detect SARS-CoV-2 virus in an environment.

In some embodiments, in step b), the amplification is performed with SEQ ID NO: 1-6 or SEQ ID NO:10 to 15, the concentration of each primer is 0.2. Mu.M to 0.4. Mu.M, and 0.3. Mu.M, 0.33. Mu.M, and 0.36. Mu.M may be selected.

In some embodiments, in step b), the amplification is performed with SEQ ID NO:7 to 9 or SEQ ID NO:16 to 18, the concentration of each probe is 0.1. Mu.M to 0.2. Mu.M, and 0.15. Mu.M, 0.17. Mu.M, and 0.19. Mu.M may be selected.

As an exemplary preferred embodiment, the concentrations of the components in the amplification system are shown in Table 3.

The method is based on ARMS-PCR (mutation blocking amplification System) method for amplification. Further ARMS-Taqman method.

In certain embodiments, the biological sample is a bodily fluid. The bodily fluid may be fluid isolated from any portion of the subject's body (e.g., peripheral region), including, but not limited to, blood, plasma, serum, urine, sputum, spinal fluid, cerebrospinal fluid, pleural effusion, nipple aspirate, lymph fluid, respiratory, intestinal and genitourinary fluids, tears, saliva, milk, fluid from the lymphatic system, semen, cerebrospinal fluid, intraorgan system fluid, ascites, tumor cyst fluid, amniotic fluid, and combinations thereof, for example. For example, the body fluid is urine, serum or cerebrospinal fluid. The sample used for detecting SARS-CoV-2 is preferably an upper respiratory tract specimen (e.g., pharyngeal swab, nasal swab, nasopharyngeal swab, etc.), a lower respiratory tract specimen (e.g., respiratory tract aspirate, broncholavage, alveolar lavage, deep expectoration, etc.), an ocular conjunctival swab, a fecal specimen, an anal swab, an anticoagulation and serum specimen, etc. of a subject. The clinical specimens should collect respiratory tract specimens (especially lower respiratory tract specimens) in early onset of the cases as much as possible, acute stage serum within 7 days of onset and convalescence serum 3-4 weeks after onset.

The subject for the above use may refer to a patient or an animal suspected of carrying SARS-CoV-2, in particular a mammal, e.g. bat, castors; preferably a primate, more preferably a human.

Embodiments of the present invention will be described in detail below with reference to examples.

Examples

The combinations of primer probes used in this example are shown in tables 1 and 2.

Table 1N Gene and mutation Joint detection primer and probe combination 1

Primer name	Sequence (5 '-3')	SEQ ID NO	Modification
				NY-F1	CAATCATATGGTTTCCAACCCAGTT	1	Without any means for
NY-R1	GTCCACAAACAGTTGCTGGTGC	2	Without any means for
				NY-P1	TGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCT	7	5’FAM；3’BHQ1
HV-F1	CAATGTTACTTGGTTCCATGCTACCT	3	Without any means for
				HV-R1	GGACTGGGTCTTCGAATCTAAAGTAGTA	4	Without any means for
HV-P1	CTGGGACCAATGGTACTAAGAGGTTTGATAACC	8	5’HEX；3’BHQ1
				PH-F1	CGCTAGTTATCAGACTCAGACTAATTGTA	5	Without any means for
PH-R1	GGGTATGGCAATAGAGTTATTAGAGTAAGC	6	Without any means for
				PH-P1	CGGCGGGCACGTAGTGTAGCTAGTC	9	5’CY5；3’BHQ2
N-F1	GCTGGCAATGGCGGTGATG	19	Without any means for
				N-R1	TGGCCTTTACCAGACATTTTGC	20	Without any means for
N-P1	CTCTTGCTTTGCTGCTGCTTGACAG	21	5’ROX；3’BHQ2

Table 2N Gene and mutation Joint detection primer probe combination 2

Sample detection example 1

Positive samples: a synthetic nucleic acid sequence comprising a N501Y, HV69-70del and a P681H mutation;

negative samples: the nucleic acid extracted from the novel coronavirus without N501Y, HV69-70del and P681H mutation is subjected to concentration calibration by adopting a novel coronanucleic acid detection kit.

The detection process comprises the following steps:

1. diluting the positive sample to 200copies/mL according to the calibrated theoretical concentration;

2. will markDiluting the negative sample with a fixed concentration to 10 ⁶ copies/mL；

3. The primer probe combinations in the primer table 1 and the primer probe combinations in the primer table 2 are adopted to prepare PCR reaction liquid according to the reagent formula of the following table, and the system comprises the primer probe combinations, dNTPs and Mg ²⁺ The concentrations and amounts of the components in this example, such as reverse transcriptase, DNA polymerase (taq enzyme), PCR buffer, RNase inhibitor (RNasin) and the like, are shown in Table 3.

TABLE 3 Table 3

4. And (3) detection: the prepared reagent is adopted for detection, 20uL of sample and 30uLPCR reaction liquid are adopted for each reaction, the detection is repeated for 30 times, and after the reagent and the sample are respectively added in a reagent preparation room and a sample treatment room, a PCR tube cover is covered and transferred to a PCR amplification room.

5. Fluorescent PCR reaction and result analysis

And placing the PCR reaction tube into a sample tank of an amplification instrument, and setting the names of samples to be detected according to the corresponding sequence.

2) Fluorescence detection channel selection: selecting FAM channel (reporter: FAM, quantiser: none) to detect N501Y mutation; selecting HEX channel (reporter: HEX, quantiser: none) to detect HV69-70del deletion mutation; selecting ROX channel (reporter: ROX, quantiser: none) to detect N gene; the CY5 channel (reporter: CY5, quantiser: none) was selected to detect the gene P681H mutation;

3) The fluorescent quantitative PCR reaction conditions are shown in table 4:

TABLE 4 Table 4

The PCR amplification cycle is divided into two phases, the first phase being reverse transcription, by which complementary cDNA is synthesized.

The second stage is an amplification and fluorescent signal collection stage, and the annealing temperature is 55-62 ℃, preferably 60 ℃.

4) Analysis of results

After the reaction is finished, the instrument automatically stores the result, and the automatic analysis can be performed by using software of the instrument (the analysis can be performed by manually adjusting the starting value, the ending value and the threshold line value of the base line), and the intersection point of the amplification curve and the threshold line is called Ct (cycle threshold, which is the cycle number undergone when the fluorescent signal in the PCR reaction tube reaches the set threshold). The amplification curve is shown in figures 1-4, the sensitivity of the 2 sets of combined detection primer probe combinations provided by the invention can reach 200copies/mL (repeated detection is carried out for 30 times, the detection rate reaches 100 percent), and the detection is 10 ⁶ The wild-type samples of copies/mL were free of non-specific amplification (30 replicates without non-specific amplification).

Sample detection example 2

Sample type: nucleic acid sample extracted from throat swab and nasopharyngeal swab

Sample characteristics: the sequencing shows that the nucleic acid sample of the clinical novel coronavirus containing the N501Y, P681H, HV-70 del mutation is derived from the long-time salon infectious disease hospital.

The method comprises the steps of calibrating the concentration of a sample by adopting a novel coronavirus nucleic acid detection reagent of I department, sequentially diluting the sample to 20000copies/mL,2000copies/mL and 200copies/mL according to the calibrated concentration, detecting according to the method of sample detection implementation 1, and repeatedly detecting each concentration sample for 30 times, wherein the detection result shows that when the concentration of the sample is 200copies/mL, the positive detection rate reaches 100%, and the amplification curve is shown in figures 5-6, so that the detection reagent can be used for efficiently detecting the mutation of a clinical sample, and the detection sensitivity can reach 200copies/mL.

Sample detection implementation 3, specificity verification

A novel coronavirus nucleic acid sample which is verified by sequencing and does not contain N501Y, HV69-70del and P681H mutation and a pathogen nucleic acid sample which has homology with the novel coronavirus nucleic acid sequence and is easy to cause the same or similar clinical symptoms are adopted as a sample to be tested. The test samples are shown in Table 5.

TABLE 5

The detection results of the samples are shown in Table 6, and all the mutation detection results of the samples are negative, so that the detection reagent provided by the invention has good specificity.

TABLE 6

The technical features of the above-described embodiments may be arbitrarily combined, and all possible combinations of the technical features in the above-described embodiments are not described for brevity of description, however, as long as there is no contradiction between the combinations of the technical features, they should be considered as the scope of the description.

The above examples illustrate only a few embodiments of the invention, which are described in detail and are not to be construed as limiting the scope of the invention. It should be noted that it will be apparent to those skilled in the art that several variations and modifications can be made without departing from the spirit of the invention, which are all within the scope of the invention. Accordingly, the scope of protection of the present invention is to be determined by the appended claims.

Sequence listing

<110> san Hunan biotechnology Co., ltd

<120> combination products, kits, uses and methods for detecting mutant SARS-CoV-2 virus

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 25

<212> DNA

<213> artificial sequence

<400> 1

caatcatatg gtttccaacc cagtt 25

<210> 2

<211> 22

<212> DNA

<213> artificial sequence

<400> 2

gtccacaaac agttgctggt gc 22

<210> 3

<211> 26

<212> DNA

<213> artificial sequence

<400> 3

caatgttact tggttccatg ctacct 26

<210> 4

<211> 28

<212> DNA

<213> artificial sequence

<400> 4

ggactgggtc ttcgaatcta aagtagta 28

<210> 5

<211> 29

<212> DNA

<213> artificial sequence

<400> 5

cgctagttat cagactcaga ctaattgta 29

<210> 6

<211> 30

<212> DNA

<213> artificial sequence

<400> 6

gggtatggca atagagttat tagagtaagc 30

<210> 7

<211> 37

<212> DNA

<213> artificial sequence

<400> 7

tgttggttac caaccataca gagtagtagt actttct 37

<210> 8

<211> 33

<212> DNA

<213> artificial sequence

<400> 8

ctgggaccaa tggtactaag aggtttgata acc 33

<210> 9

<211> 25

<212> DNA

<213> artificial sequence

<400> 9

cggcgggcac gtagtgtagc tagtc 25

<210> 10

<211> 24

<212> DNA

<213> artificial sequence

<400> 10

aatcatatgg tttccaaccc aatt 24

<210> 11

<211> 31

<212> DNA

<213> artificial sequence

<400> 11

gacacatttg tttttaacca aattagtaga c 31

<210> 12

<211> 26

<212> DNA

<213> artificial sequence

<400> 12

caatgttact tggttccatg ctgtct 26

<210> 13

<211> 29

<212> DNA

<213> artificial sequence

<400> 13

ccagcctctt attatgttag acttctcag 29

<210> 14

<211> 28

<212> DNA

<213> artificial sequence

<400> 14

gctagttatc agactcagac taatgcta 28

<210> 15

<211> 30

<212> DNA

<213> artificial sequence

<400> 15

gtggtaacac taatagtaaa atttgtgggt 30

<210> 16

<211> 39

<212> DNA

<213> artificial sequence

<400> 16

ccaaccatac agagtagtag tactttcttt tgaacttct 39

<210> 17

<211> 32

<212> DNA

<213> artificial sequence

<400> 17

ctctgggacc aatggtacta agaggtttga ta 32

<210> 18

<211> 31

<212> DNA

<213> artificial sequence

<400> 18

cgggcacgta gtgtagctag tcaatccatc a 31

<210> 19

<211> 19

<212> DNA

<213> artificial sequence

<400> 19

gctggcaatg gcggtgatg 19

<210> 20

<211> 22

<212> DNA

<213> artificial sequence

<400> 20

tggcctttac cagacatttt gc 22

<210> 21

<211> 25

<212> DNA

<213> artificial sequence

<400> 21

ctcttgcttt gctgctgctt gacag 25

<210> 22

<211> 350

<212> DNA

<213> artificial sequence

<400> 22

ctacgcagaa gggagcagag gcggcagtca agcctcttct cgttcctcat cacgtagtcg 60

caacagttca agaaattcaa ctccaggcag cagtagggga acttctcctg ctagaatggc 120

tggcaatggc ggtgatgctg ctcttgcttt gctgctgctt gacagattga accagcttga 180

gagcaaaatg tctggtaaag gccaacaaca acaaggccaa actgtcacta agaaatctgc 240

tgctgaggct tctaagaagc ctcggcaaaa acgtactgcc actaaagcat acaatgtaac 300

acaagctttc ggcagacgtg gtccagaaca aacccaagga aattttgggg 350

Claims

1. Primer probe combination product comprising a and/or b:

a) The nucleotide sequence is SEQ ID NO: 1-6, and a primer shown in SEQ ID NO: 7-9, a probe;

b) The nucleotide sequence is SEQ ID NO: 10-15, and SEQ ID NO: 16-18.

2. The primer probe combination product of claim 1, further comprising a quality control primer and/or a quality control probe for detecting a conserved segment of the SARS-CoV-2 gene.

3. The primer probe combination product of claim 2, wherein the conserved segment is derived from the SARS-CoV-2N gene.

4. The primer probe combination product of claim 2, wherein the nucleotide sequence of the quality control primer is SEQ ID NO: 19-20, wherein the nucleotide sequence of the quality control probe is SEQ ID NO: 21.

5. The primer-probe combination product according to any one of claims 1 to 4, wherein the probe is labeled with a fluorescent substance.

6. The primer probe combination product of claim 5, wherein the fluorescent material on each probe is independently selected from one or two of AMCA, atto 425, atto 590, FAM, HEX, TET, NED, ROX, CY5, CY5.5, CY3, texas Red, TFAM, TAMRA, VIC, and JOE.

7. A kit comprising the primer-probe combination product of any one of claims 1 to 6.

8. The kit of claim 7, further comprising dNTPs, mg ²⁺ At least one of a DNA polymerase, a reverse transcriptase, a PCR buffer, an RNase inhibitor, a positive control and a negative control suitable for use in an ARMS-PCR system.

9. The kit of claim 8, wherein the negative control and the positive control are both SARS-CoV-2 nucleic acid fragments comprising a detection primer capable of complementarily pairing with the mutation site to be detected under stringent conditions; the negative control does not contain a mutation site to be detected; the positive control contains the mutation site to be detected.

10. Use of the primer-probe combination product of any one of claims 1-6 in the preparation of a kit for detecting mutant SARS-CoV-2 virus.

11. A method for detecting mutant SARS-CoV-2 virus for non-disease diagnostic and therapeutic purposes, said method comprising the steps of:

a) Obtaining nucleic acid in a sample to be detected;

b) Amplification is performed using the primer probe combination product of any one of claims 1 to 6, or the kit of any one of claims 7 to 9, using the nucleic acid as a template to determine whether at least one of three mutant forms of SARS-CoV-2 virus, N501Y, P681H and HV69-70del, is present in the sample.

12. The method according to claim 11, wherein in step b) the amplification is performed with the sequence of SEQ ID NO: 1-6 or SEQ ID NO: among the primers shown in 10-15, the concentration of each primer is 0.2 mu M-0.4 mu M.

13. The method according to claim 11, wherein in step b) the amplification is performed with the sequence of SEQ ID NO: 7-9 or SEQ ID NO: among the probes shown in 16-18, the concentration of each probe is 0.1 mu M-0.2 mu M.