CN115386658A - Single-molecule RNA quantitative detection method and system without nucleic acid amplification - Google Patents

Abstract

The invention provides a nucleic acid amplification-free single-molecule RNA quantitative detection method and a nucleic acid amplification-free single-molecule RNA quantitative detection system, which comprise the following steps: s1: preparing a microsphere functionally modified by a single-stranded RNA fluorescent reporter probe; s2: designing crRNA specific to the target RNA; s3: co-incubating target RNA, crRNA, cas13 protein, reaction buffer solution and S1 preparation microspheres with known concentrations at a proper temperature; s4: carrying out fluorescence imaging on the microspheres incubated in the step S3, and establishing a linear corresponding relation between the fluorescence intensity of the microspheres and the RNA concentration; s5: and (5) quantitatively detecting the RNA in the sample by using the linear corresponding relation established by the S4. The RNA detection method can realize single-molecule level RNA quantitative analysis, does not need reverse transcription and nucleic acid pre-amplification steps, has mild detection conditions and simple operation steps, and provides a novel high-sensitivity, simple, convenient and universal strategy for RNA diagnosis and analysis.

Description

Single-molecule RNA quantitative detection method and system without nucleic acid amplification

[ technical field ] A method for producing a semiconductor device

The invention relates to the field of molecular diagnosis and biochemical analysis method research, in particular to a method and a system for quantitatively detecting single-molecule RNA without nucleic acid amplification.

[ background of the invention ]

As important genetic materials, RNA plays a vital role in various biological processes, and high-sensitivity and high-specificity RNA detection is becoming more and more important from basic biological research, molecular biological exploration and clinical diagnosis and analysis. For example, nucleic acid detection based on the genomic RNA of the novel coronavirus (SRAS-CoV-2), as a gold standard for the diagnosis of the novel coronavirus disease (COVID-19), plays a crucial role in the prevention and control of COVID-19; for another example, RNA, a fusion gene transcript formed by chromosomal rearrangement, is used as a molecular marker for classification, diagnosis, treatment, prognosis and monitoring of minimal residual foci of various cancers by National Comprehensive Cancer Network Clinical Practice Guidelines (NCCN Guidelines) and world health organization Blue book (WHO Blue Books).

Currently, RNA detection relies mainly on nucleic acid amplification techniques, including reverse transcription-polymerase chain reaction (RT-PCR), ligase Chain Reaction (LCR), recombinase amplification technique (RPA), loop-mediated isothermal nucleic acid amplification (LAMP), and the like. These methods achieve very high sensitivity, even to the single molecule level, due to the efficient exponential amplification mechanism. However, these methods typically require a reverse transcription/ligation step to convert RNA to DNA, and a subsequent DNA replication step to generate detectable levels of nucleic acid. However, the amplification step often introduces some troublesome problems, such as loss of the target RNA molecule due to incomplete reverse transcription, amplification bias due to error-prone sequence replication, and false positive results due to contamination. In addition, multiple target-specific probes/primers need to be carefully designed, multiple tool enzymes used, and experimental conditions need to be rigorously optimized. Therefore, there is an urgent need to develop a universal RNA quantitative detection method which not only has the same sensitivity as the nucleic acid amplification technique but also avoids the above-mentioned problems of nucleic acid amplification.

The CRISPR/Cas13a system is found to have target-dependent trans-cleavage activity, can specifically recognize and bind to target RNA through crRNA and activate the trans-cleavage activity, and the trans-cleavage activity of Cas13a can efficiently hydrolyze single-stranded RNA reporter probes existing in the surrounding environment, thereby realizing the RNA detection without amplification. Although the CRISPR/Cas13a system has a multiple response mechanism, only RNA above pM can be detected, and most practical sample analysis requirements cannot be met. Recently, researchers have improved the sensitivity of non-amplification RNA analysis to the fM level through the CRISPR/Cas system in series and the CRISPR/Cas13a system for designing multiple crRNA, but the analysis cost is undoubtedly increased, and the design is complicated; even so, quantitative detection of RNA at aM level is still not satisfactory.

[ summary of the invention ]

In view of this, the invention provides a universal, simple and convenient method for quantitatively detecting single-molecule RNA without nucleic acid amplification.

The RNA quantitative detection method provided by the invention comprises the following steps:

s1: preparing a microsphere functionally modified by a single-stranded RNA fluorescent reporter probe;

s2: designing crRNA specific to the synthesized target RNA;

s3: co-incubating target RNA, crRNA, cas13 protein, reaction buffer solution and S1 preparation microspheres with known concentrations at a proper temperature;

s4: carrying out fluorescence imaging on the microspheres incubated in the step S3, and establishing a linear corresponding relation between the fluorescence intensity of the microspheres and the RNA concentration;

s5: and (5) quantitatively detecting RNA in the sample by using the linear corresponding relation established by S4.

As to the above-mentioned aspect and any possible implementation manner, there is further provided an implementation manner, where the S1 specifically includes:

s11: screening out streptavidin modified single microspheres with the same size by using a microscope;

s12: designing and synthesizing a single-stranded RNA (ribonucleic acid) report probe marked by biotin, a fluorescent group and a quenching group;

s13: and (3) fixing the single-stranded RNA report probe on the surface of the microsphere obtained by S11 through biotin-streptavidin immunoreaction.

The above aspects and any possible implementations further provide an implementation, wherein the optimized selection of the single beads in S11 is streptavidin-modified agarose magnetic beads, with a size of 1-1000 μm; the magnetic single-stranded RNA reporter probe has the advantages of magnetism and convenience in separation, and the streptavidin modification is convenient for fixing the biotin-modified single-stranded RNA reporter probe on the surface of the microsphere.

In the above aspect and any possible implementation manner, an implementation manner is further provided, in S13, other fixing manners may be adopted, and the surface of the corresponding microsphere needs a corresponding functional unit; for example, the surface of the microsphere can be modified with an anti-FITC antibody, and the corresponding RNA report probe does not need biotin modification.

The aspects defined above and any one of the possible implementations further provides an implementation in which, in S13, the streptavidin and biotin reaction is performed in a phosphate buffer solution (10mm, 137mm nacl,2.7mm kcl, ph 7.4) for a reaction time of greater than 30 minutes at a reaction temperature of 20-40 ℃.

In the above aspect and any possible implementation manner, there is further provided an implementation manner, in the S3, the reaction volume is 5 μ L, the incubation temperature is 20-40 ℃, the optimal incubation time is 60 minutes, the final concentration of crRNA in the reaction system is 50nm, the optimal final concentration of cas13 in the reaction system is 100nM, and the pH of the reaction buffer solution is 7.9, and the reaction buffer solution comprises the following components: 4U RNase inhibitor, 10mM Tris-HCl,50mM NaCl,10mM MgCl ₂ ，1μg/mL BSA。

As to the above-mentioned aspect and any possible implementation manner, there is further provided an implementation manner, where the S4 specifically includes:

s41: using magnetic separation techniques, the S3-incubated microspheres were washed once with a phosphate buffer solution containing a surfactant (10mM, 137mM NaCl,2.7mM KCl, 0.05%; tween-20, pH 7.4) and then resuspended in a phosphate buffer solution (10mM, 137mM NaCl,2.7mM KCl, pH 7.4);

s42: absorbing the single microspheres onto a glass slide and carrying out fluorescence imaging on the glass slide, wherein the laser wavelength is 488nm, the fluorescence collection range is 500nm-570nm, the RNA detection with different concentrations is carried out, the RNA in a sample is quantitatively analyzed, and the same imaging conditions are kept;

s43: obtaining the intensity of the fluorescence signal on the surface of the microsphere, and fitting a linear corresponding relation between the fluorescence intensity and the RNA concentration;

as to the above-mentioned aspect and any possible implementation manner, there is further provided an implementation manner, where the S5 specifically includes:

s51: replacing the RNA in the S3 with an RNA sample to be detected, and executing the same experiment steps as S3 and S41-S42;

s52: obtaining the intensity of the fluorescence signal on the surface of the microsphere;

s53: quantitative analysis of target RNA in samples was performed using S43 fitted linear correspondences.

The above-described aspects and any possible implementations further provide a quantitative detection system for single-molecule RNA without nucleic acid amplification, the quantitative detection system for RNA comprising:

the microsphere preparation unit is used for preparing microspheres functionally modified by the single-stranded RNA fluorescent reporter probe;

a crRNA design synthesis unit for designing and synthesizing a crRNA specific to the target RNA;

a co-incubation unit for co-incubating the target RNA, the crRNA, the Cas13 protein, the reaction buffer solution and the microspheres prepared by the microsphere preparation unit at known concentrations at a suitable temperature;

the linear relation establishing unit is used for carrying out fluorescence imaging on the microspheres incubated by the co-incubation unit and establishing a linear corresponding relation between the fluorescence intensity of the microspheres and the RNA concentration;

and the sample detection unit is used for quantitatively detecting the RNA in the sample through the established linear corresponding relation.

Compared with the prior art, the invention can obtain the following technical effects:

1. the invention is a rapid, simple and convenient RNA quantitative detection method, does not need reverse transcription, connection and nucleic acid pre-amplification processes, does not need complicated primer and probe design, does not need to use various tool enzymes, and does not need to strictly optimize detection conditions.

2. The invention relates to a universal RNA quantitative analysis method, and the prepared single-strand RNA fluorescent reporter probe functionalized modified single microsphere is universal for the detection of any RNA, and only needs to newly design and synthesize a crRNA specific to a target RNA.

3. The invention relates to a single-molecule RNA quantitative analysis method, which adopts a single microsphere as a reactor for CRISPR/Cas13a trans-cleavage reaction, so that the cleavage reaction can only be carried out in a very effective volume range on the surface of the microsphere, thereby generating a local concentration increasing effect, namely, the RNA with the same molecular number appears in a smaller volume, the concentration is higher, the trans-cleavage effect can be greatly increased by the concentration increasing effect, and the sensitivity of RNA detection is further improved; meanwhile, the single microsphere enriches all fluorescence signals on the surface, and the sensitivity of RNA detection reaches a single-molecule level by combining with a CRISPR/Cas13a system multiple response mechanism.

4. The invention is not limited to the quantitative detection of the RNA of the novel coronavirus (SARS-CoV-2) as set forth in the examples, and can be generalized to the quantitative analysis of any RNA molecule.

Of course, it is not necessary for any one product in which the invention is practiced to achieve all of the above-described technical effects simultaneously.

[ description of the drawings ]

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without creative efforts.

FIG. 1 is a schematic diagram of the preparation process of microspheres functionalized with single-stranded RNA reporter probes according to the present invention;

FIG. 2 is a schematic representation of RNA detection using functionalized single microspheres and CRISPR/Cas13a system according to the present invention;

FIG. 3 is a graphical representation of the local concentration enhancement effect of the present invention;

FIG. 4 shows the results of the detection of IVT SARS-CoV-2-N-RNA of different concentrations according to the present invention;

FIG. 5 shows the effect of the present invention on the quantitative determination of IVT SARS-CoV-2-N-RNA at different concentrations;

FIG. 6 is a graph showing the effect of the specific evaluation of the method according to the embodiment of the present invention;

FIG. 7 is a graph showing the results of detection of new coronavirus from a throat swab sample in an embodiment of the present invention.

[ detailed description ] A

In order to better understand the technical scheme of the invention, the following detailed description of the embodiments of the invention is made with reference to the accompanying drawings.

The invention provides a nucleic acid amplification-free single-molecule RNA quantitative detection method and system concept and detection principle as follows:

different from a classical CRISPR/Cas13a sensing system, the invention fixes a single-stranded RNA fluorescent reporter probe of the CRISPR/Cas13a sensing system on the surface of a single microsphere through the immune reaction of streptavidin and biotin to prepare the Functionalized single microsphere, namely Functionalized-SMB (figure 1). When a target RNA molecule exists, the crRNA guides the Cas13a protein to specifically recognize the target RNA, after the crRNA is combined with the target RNA, the trans-enzyme digestion activity of the Cas13a protein is activated, the activity can efficiently and quickly cut and modify the single-stranded RNA fluorescent reporter probe on the surface of the single microsphere, so that a quenching group and a fluorescent group are separated, and all the fluorescent groups are fixed on the surface of the microsphere, therefore, under the irradiation of laser, the fluorescence of the fluorescent group on the surface of the single microsphere is lightened, and the fluorescence intensity is related to the concentration of the target RNA molecule, so that the target RNA molecule can be quantitatively detected (figure 2). It is worth mentioning that the target RNA-activated Cas13a trans-enzyme digestion reaction only occurs in a very small volume of the microsphere surface, and a significant local concentration increase effect is generated, that is, the concentration increase effect of the same molecular RNA in a small volume (fig. 3) increases the efficiency of the Cas13a trans-enzyme digestion reaction, so that the low-concentration RNA molecules can generate significant response signals, and thus the invention can realize the detection of single-molecule RNA.

The invention provides a single-molecule RNA quantitative detection method with high sensitivity and specificity and without a nucleic acid amplification step, and the method is successfully applied to the visualized quantitative analysis of SARS-CoV-2 RNA.

The technical scheme for realizing the invention comprises the following steps:

step 1, preparing single microspheres functionally modified by a single-stranded RNA fluorescent reporter probe;

step 2, designing and synthesizing SARS-CoV-2N gene RNA specific crRNA;

step 3, incubating IVT SARS-CoV-2N gene RNA, crRNA, cas13 protein, reaction buffer solution and S1 preparation microspheres with known concentration at proper temperature;

step 4, performing fluorescence imaging on the microspheres incubated in the step 3, and establishing a linear corresponding relation between the fluorescence intensity of the microspheres and the RNA concentration of the RSARS-CoV-2N gene;

and 5, quantitatively detecting SARS-CoV-2N gene RNA in the throat swab sample by utilizing the linear corresponding relation established in the step 4.

The invention also provides a single-molecule RNA quantitative detection system without nucleic acid amplification, which comprises the quantitative detection method and comprises the following steps:

the microsphere preparation unit is used for preparing microspheres functionally modified by the single-stranded RNA fluorescent reporter probe;

a crRNA design synthesis unit for designing and synthesizing a crRNA specific to the target RNA;

a co-incubation unit for co-incubating the target RNA, the crRNA, the Cas13 protein, the reaction buffer solution and the microspheres prepared by the microsphere preparation unit at known concentrations at a suitable temperature;

the linear relation establishing unit is used for carrying out fluorescence imaging on the microspheres incubated by the co-incubation unit and establishing a linear corresponding relation between the fluorescence intensity of the microspheres and the RNA concentration;

and the sample detection unit is used for quantitatively detecting the RNA in the sample through the established linear corresponding relation.

The basic principle and the specific steps of the invention are as follows:

step 1: preparation of single microsphere functionally modified by single-stranded RNA fluorescent reporter probe

First, streptavidin-modified agarose magnetic microspheres (STV-MBs) of the same size (80. + -.3 μm) were microscopically screened, placed in a 1.5mL nucleic acid low-adsorption centrifuge tube, washed twice with 1 XPBST (10mM, 137mM NaCl,2.7mM KCl, 0.05%; tween-20 (water and tween-20), pH 7.4), and resuspended in 1 XPBS (10mM, 137mM NaCl,2.7mM KCl, pH 7.4); subsequently, an excessive single-stranded RNA (single-stranded RNA) reporter probe (2 pmol in single-sphere reaction and 2nmol in multi-sphere reaction) is added into the resuspended STV-MB, and the mixture is incubated for 1 hour at room temperature by shaking, so that the single-stranded RNA reporter probe is immobilized on the surface of the microsphere, and Functionalized-SMB (figure 1) is prepared; wherein, the two ends of the single-stranded RNA report probe are respectively marked with a fluorescent group and a quenching group, but the fluorescent group and the biotin are required to be marked on the same basic group.

In the embodiment, the single-stranded RNA report probe sequence is 5 '-UUUUUUUC-3', 5 '-end U basic group, is covalently modified with FAM fluorescent group, is covalently modified with biotin, is 3' -end modified with quenching group BHQ1, and is synthesized by Shanghai.

In order to better explain the RNA quantitative detection principle of the invention and demonstrate the feasibility and application value of the invention, the method of the invention is utilized to carry out quantitative detection on SRAS-CoV-2N gene RNA.

Example 1.

Step 2, designing and synthesizing SARS-CoV-2N gene RNA specific crRNA;

in this embodiment, the SARS-COV-2N gene specific crRNA targets the N gene of SARS-CoV-2, and covers the reported probe sequence for SARS-CoV-2N gene RT-PCR detection published by the American centers for prevention and control of disease. The sequence is 5 'GAUUAGACUACCCAAAAAACGAAG GGGACUAAAACACGCUAAGCUGGCUGGGGGCAAAUUGGC-3', and is synthesized by Shanghai.

Step 3, incubating SARS-CoV-2N gene RNA, crRNA, cas13 protein, reaction buffer solution and S1 preparation microspheres with known concentration at a proper temperature;

s1: SRAS-CoV-2N gene RNA (IVT SARS-CoV-2-N-RNA) is prepared by an in vitro transcription method, and the specific steps are as follows;

(1) An in vitro T7 transcribed DNA template was obtained from a DNA plasmid (pUC 57-2019-nCov-N, kinsley) by PCR amplification:

mu.L of the PCR reaction mixture contained 100ng of DNA plasmid, 1 XPCR reaction buffer, 250. Mu.M dNTPs (250. Mu.M each), 500nM forward primer labeled with the T7 promoter (T7-FP-SRAS-CoV-2, sequence 5-. The PCR cycle included a hot start step (95 ℃ for 4 minutes), a thermocycling process (40 cycles: 95 ℃ for 20 seconds; 62 ℃ for 30 seconds; 72 ℃ for 1 minute), and a final extension (72 ℃ for 5 minutes). The PCR product was confirmed by 4% agarose gel electrophoresis and then purified using a SanPrep column PCR product purification kit (Shanghai Prov.) to obtain a T7 transcription DNA template.

(2) Preparation of SARS-CoV-2N Gene RNA by T7 transcription reaction: a transcription reaction mixture (50. Mu.L) containing 2. Mu.g of T7 transcribed DNA template, 1 XT 7 RNApol reaction buffer (NEB), 5mM NTP and 250U T7 RNA polymerase (NEB) was incubated at 37 ℃ for 5 h. The transcript was then treated with DNase I for 1h at 37 ℃ to remove the T7 transcribed DNA template. After confirmation of the product by 4% agarose gel electrophoresis, the transcript was purified using Spin Column RNAclean kit (TIANGEN). Finally, the concentration of SARS-CoV-2-N-RNA was quantified using a Nanodrop One UV-Vis spectrophotometer and the copy number was further calculated using the transcript length and concentration.

S2: the SARS-CoV-2-N-RNA detection comprises the following steps:

10 μ L CRISPR/Cas13a reaction mix solution containing functional-SMB (single microspheres added for one sample), 200nM Cas13a protein, 100nM N-crRNA, 4U RRI, 1 × reaction buffer (10 mM Tris-HCl,50mM NaCl,10mM MgCl. RTM.) (Single microspheres for one sample), 1 mM reaction buffer solution ₂ 1. Mu.g/mL BSA) and known concentrations of IVT SARS-CoV-2-N-RNA, incubated at 37 ℃ for 60min.

Step 4, performing fluorescence imaging on the microspheres incubated in the step 3, and establishing a linear corresponding relation between the fluorescence intensity of the microspheres and the RNA concentration of the RSARS-CoV-2N gene;

fluorescence imaging of the incubated microspheres from step 3 using confocal laser fluorescence microscopy, results shown asFIG. 4 shows that the concentration of SARS-CoV-2-N-RNA increases from 1aM (6 copies) to 100fM (. About.6.0X 10) ⁵ Copy), the fluorescence signal on the surface of the microsphere is gradually enhanced, and if different colors are adopted to represent different fluorescence intensities, the change of the fluorescence intensity can be clearly distinguished by naked eyes.

The results of the quantitative detection of IVT SARS-CoV-2-N-RNA are shown in FIG. 5, the negative pair number of the microsphere surface Fluorescence Intensity (FI) and the SARS-CoV-2-N-RNA concentration shows a good linear relationship in the range of 10aM to 100fM, and the correlation equation is FI =2.56 x 10 ⁵ +9.59*10 ⁴ lgC _RNA The correlation coefficient is 0.9998, which shows that the method can realize high-sensitivity RNA quantitative detection without nucleic acid amplification, and simultaneously the applicant finds that 1aM (namely 6 RNA molecules) can generate a fluorescent signal which can be distinguished from blank, which indicates that the detection of single-molecule level RNA can be realized,

to further verify the specificity of the method for RNA detection, the N gene RNA of various coronaviruses (including bat-SL-COVZC45, SRAS-CoV and Human-COV-HKU 1) was detected by using the CRRNA specific to SARS-CoV-2-N-RNA, and the results are shown in FIG. 6, wherein only SARS-CoV-2-N-RNA generates a distinct fluorescent signal, while other coronaviruses RNA generates signals close to the blank control, indicating that the method has high specificity in the detection of target RNA molecules.

And 5, quantitatively detecting SARS-CoV-2N gene RNA in the throat swab sample by utilizing the linear corresponding relation established in the step 4.

To further evaluate the utility and reliability of the method, SARS-CoV-2-abMEN pseudovirus (biologies) was added to the NP swab sample solution to simulate a series of SARS-CoV-2 positive NP swab samples. After Viral RNA Extraction using a standard Viral RNA Extraction Kit (EZ-10 Spin Column Viral Total RNA Extraction Kit, biologics), SRAS-CoV-2 was detected in these mock-positive NP (positive P1-P3) and negative NP (negative N1-N3) swab samples using this method. As shown in FIG. 7, 10 was included compared to the negative NP samples and the blank ³ -10 ⁵ The positive sample of SARS-CoV-2-abMEN pseudovirion produced a significant fluorescence signal.

The copy number of SARS-CoV-2-abMEN pseudovirus in mock-positive NP swab samples was evaluated according to the correlation equation obtained in FIG. 5 and the dilution factor in the extraction step. The results are shown in table 1, and all calculated copy numbers of these positive samples are about 35.6% to 95% of the theoretical copy number, indicating that some RNA molecules may be lost during the extraction process. To verify these results, the mock SARS-CoV-2 positive NP sample was tested by RT-PCR as reported by CDC, confirming that the assay was essentially identical to the RT-PCR assay. The practicability and reliability of the method in the aspect of clinical sample detection are fully proved.

TABLE 1 New methods and RT-PCR assays for SARS-CoV-2 in mock NP samples

The invention firstly provides a CRISPR/Cas13a sensing platform constructed on the surface of a single microsphere and develops the quantitative detection of the single-molecule RNA without amplification. The invention uses the single-stranded RNA fluorescent report probe coated functional single microsphere as a CRISPR/Cas13a trans-cutting reaction reactor and a fluorescent signal enrichment and output unit, and the CRISPR/Cas13a trans-cutting reaction is only carried out in a very small reaction volume on the microsphere surface, thereby generating a local concentration increase effect and increasing the efficiency of the cutting reaction; meanwhile, due to the single microsphere signal enrichment effect and the multiple response mechanism of the Cas13a protein, the invention can detect RNA at a single molecular level. This eliminates the need for reverse transcription and any nucleic acid amplification steps. The method has been proven to be a reliable and practical method, using the detection of new coronavirus RNA as a model, and can quantitatively determine SARS-CoV-2 in clinical samples. The invention provides a new tool for molecular diagnosis and disease detection with RNA as a target.

The method and system for quantitative detection of single-molecule RNA without nucleic acid amplification provided in the embodiments of the present application are described in detail above. The above description of the embodiments is only for the purpose of helping to understand the method of the present application and its core ideas; meanwhile, for a person skilled in the art, according to the idea of the present application, there may be variations in the specific embodiments and the application scope, and in summary, the content of the present specification should not be construed as a limitation to the present application.

As used in the specification and claims, certain terms are used to refer to particular components. As one skilled in the art will appreciate, manufacturers may refer to a component by different names. This specification and claims do not intend to distinguish between components that differ in name but not function. In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. "substantially" means within an acceptable error range, and a person skilled in the art can solve the technical problem within a certain error range to substantially achieve the technical effect. The description which follows is a preferred embodiment of the present application, but is made for the purpose of illustrating the general principles of the application and not for the purpose of limiting the scope of the application. The protection scope of the present application shall be subject to the definitions of the appended claims.

It should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a good or system that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such good or system. Without further limitation, an element defined by the phrases "comprising one of 8230; \8230;" 8230; "does not exclude the presence of additional like elements in articles of commerce or systems including such elements.

It should be understood that the term "and/or" as used herein is merely a relationship that describes an associated object, meaning that three relationships may exist, e.g., a and/or B, may represent: a exists alone, A and B exist simultaneously, and B exists alone. In addition, the character "/" herein generally indicates that the former and latter associated objects are in an "or" relationship.

The foregoing description shows and describes several preferred embodiments of the present application, but as aforementioned, it is to be understood that the application is not limited to the forms disclosed herein, and is not to be construed as excluding other embodiments, but rather is capable of use in various other combinations, modifications, and environments and is capable of changes within the scope of the application as expressed herein, commensurate with the above teachings, or the skill or knowledge of the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the application, which is to be protected by the claims appended hereto.

Claims (10)

1. A quantitative detection method of single-molecule RNA without nucleic acid amplification, which comprises the following steps:

s1: preparing a microsphere functionally modified by a single-stranded RNA fluorescent reporter probe;

s2: designing and synthesizing crRNA specific to target RNA;

s3: co-incubating target RNA, crRNA, cas13 protein, reaction buffer solution and S1 preparation microspheres with known concentrations at a proper temperature;

s4: carrying out fluorescence imaging on the microspheres incubated in the step S3, and establishing a linear corresponding relation between the fluorescence intensity of the microspheres and the RNA concentration;

s5: and (5) quantitatively detecting RNA in the sample by using the linear corresponding relation established by S4.

2. The quantitative determination method according to claim 1, wherein S1 specifically comprises:

s11: screening out streptavidin modified single microspheres with the same size by using a microscope;

s12: designing and synthesizing a single-stranded RNA (ribonucleic acid) report probe marked by biotin, a fluorescent group and a quenching group;

s13: and (3) fixing the single-stranded RNA report probe on the surface of the S11 single microsphere through a biotin-streptavidin immunoreaction.

3. The quantitative determination method of claim 2, wherein the single beads in S11 include but are not limited to streptavidin-modified agarose magnetic beads, with a size of 1-1000 μm.

4. The quantitative determination method of claim 2, wherein the single-stranded RNA reporter probe in S12 includes but is not limited to a reporter probe with biotin modification.

5. The quantitative determination method of claim 2, wherein in S13, the means for immobilizing the single-stranded RNA reporter probe further comprises: the surface of the microsphere is modified with an anti-FITC antibody, and the single-stranded RNA report probe is not modified.

6. The quantitative determination method of claim 2, wherein in S13, the streptavidin and biotin reaction is performed in a phosphate buffer solution, the reaction time is greater than 30 minutes, and the reaction temperature is 20-40 ℃.

7. The quantitative determination method of claim 1, wherein the incubation temperature in S3 is 20-40 ℃ for 40-80 minutes.

8. The quantitative determination method according to claim 7, wherein the S4 specifically comprises:

s41: washing the microspheres incubated in the step S3 with phosphate buffer solution containing surfactant once by using a magnetic separation technology, and then suspending in the phosphate buffer solution;

s42: sucking the single microspheres onto a glass slide, carrying out fluorescence imaging on the glass slide, detecting RNA with different concentrations, quantitatively analyzing the RNA in the sample, and keeping the same imaging conditions;

s43: and obtaining the intensity of the fluorescence signal on the surface of the microsphere, and fitting a linear corresponding relation between the fluorescence intensity and the RNA concentration.

9. The quantitative determination method according to claim 8, wherein the S5 specifically comprises:

s51: replacing the RNA in the S3 with an RNA sample to be detected, and executing the same experimental steps as S3 and S41-S42;

s52: obtaining the intensity of the fluorescence signal on the surface of the microsphere;

s53: quantitative analysis of target RNA in samples was performed using S43 fitted linear correspondences.

10. A quantitative detection system for single-molecule RNA without nucleic acid amplification, which is characterized by comprising:

the microsphere preparation unit is used for preparing microspheres functionally modified by the single-stranded RNA fluorescent reporter probe;

a crRNA design synthesis unit for designing and synthesizing crRNA specific to the target RNA;

a co-incubation unit for co-incubating the target RNA, crRNA, cas13 protein, reaction buffer solution and the microspheres prepared by the microsphere preparation unit at a known concentration at a suitable temperature;

the linear relation establishing unit is used for carrying out fluorescence imaging on the microspheres incubated by the co-incubation unit and establishing a linear corresponding relation between the fluorescence intensity of the microspheres and the RNA concentration;

and the sample detection unit is used for quantitatively detecting the RNA in the sample through the established linear corresponding relation.

Images