CN112176035A - Novel CRISPR nucleic acid detection method and application - Google Patents
Novel CRISPR nucleic acid detection method and application Download PDFInfo
- Publication number
- CN112176035A CN112176035A CN202011097291.2A CN202011097291A CN112176035A CN 112176035 A CN112176035 A CN 112176035A CN 202011097291 A CN202011097291 A CN 202011097291A CN 112176035 A CN112176035 A CN 112176035A
- Authority
- CN
- China
- Prior art keywords
- reaction system
- nucleic acid
- enzyme
- amplification
- enzyme digestion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a novel CRISPR nucleic acid detection method and application, wherein the detection method comprises the following steps: step one, sample processing; step two, preparing a reaction system; the reaction system comprises: crRNA, tracrRNA, Cas14 enzyme and enzyme buffer solution which are complementary with a target sequence to be detected; adding the nucleic acid to be detected and the probe into the ribose protein complex solution; step four, enzyme digestion reaction, signal detection and result interpretation; the invention can be applied to detecting various nucleic acids and multiple sites such as single-stranded DNA, RNA, double-stranded DNA, single-site mutated CRISPR nucleic acid and the like, and has the advantages of high design flexibility, good specificity, convenience, rapidness and low cost.
Description
Technical Field
The invention relates to the field of biological detection, in particular to a novel CRISPR nucleic acid detection method and application.
Background
In recent years, the CRISPR nucleic acid detection technology is changing day by day, and its application in the fields of pathogen detection, genetic disease detection, cancer detection, microbial drug resistance detection, environmental microbial detection and the like is rapidly increasing.
The earliest CRISPR nucleic acid detection technology utilizes amino acid-modified dCas9 protein fused with EGFP fluorescent protein, and specifically binds to a target sequence under the guidance of a specific guide RNA. The method has long time consumption, high cost, complex operation and difficult practical application.
The turning point of CRISPR nucleic acid detection technology was in 2016, and the tensor peak team found that Cas13a has alternative cleavage activity. When Cas13a binds to crRNA with a target recognition region, it can specifically recognize the target single-stranded RNA and cleave the target RNA. At the same time, the enzyme is activated for its alternative cleavage activity, and non-specifically cleaves nearby single-stranded RNA. With this technology, in 2017, the first relatively simple and practical CRISPR nucleic acid detection technology SHERLOCK was born. At the same time, the alternative cleavage activity of Cas12a was also found. Unlike Cas13a, Cas12a is capable of specifically recognizing and binding double-stranded DNA under the guidance of a guide RNA and obtaining a bypass cleavage activity for single-stranded DNA. Based on this technique, the detection and HOLMES assays are published sequentially.
The methods are currently applied to a plurality of fields such as pathogen detection, single-site polymorphism detection and the like, and compared with the traditional Realtime-PCR or FISH hybridization technology, the method has the characteristics of high speed, high specificity, simple operation and the like.
Cas enzymes currently applied to CRISPR nucleic acid detection mainly comprise Type II dCas9, Type V Cas12a, Cas12b, Cas12c, Type VI Cas13a, Cas13b and the like. dCas9 does not have the activity of bypass cleavage and thus cannot function as signal amplification, and its detection sensitivity is not high and operation is complicated. The Cas 13-based SHERLLOCK nucleic acid detection method has poor compatibility of specific recognition RNA fragments and common fragment amplification technologies, and needs to introduce a T7 reverse transcription step in the reaction, so that the difficulty and the operability are high. The detection substrates of the Cas 12-based DETECTOR and HOLMES can be double-stranded DNA or single-stranded DNA, but when single-stranded DNA is used as a detection object, the specificity is reduced to a certain extent, and the detection object is insensitive to site mutation and the like.
In addition, in the existing CRISPR detection method, the premise of pam (promoter adjacent motif) site needs to be considered when designing a target sequence. Target sequences such as Cas12 must be designed near the PAM site downstream of a stretch of TTTN or TTN, otherwise the method is not effective in recognizing the target sequence. The probability that a particular PAM site sequence will occur in certain organisms is not high, which makes the design of the overall assay difficult.
Meanwhile, Cas9, Cas12 and Cas13 have large molecular weight and long hydrophobic regions, so that certain difficulty exists in expression and the material cost is increased.
According to the defects of products on the market, a CRISPR method which is not limited by a PAM site in the target design, can detect nucleic acid including single-stranded DNA, double-stranded DNA and RNA, has low cost, simple and convenient operation and good specificity is developed, and has great significance in scientific research and industrial application; the present invention solves such problems.
Disclosure of Invention
In order to solve the defects of the prior art, the invention aims to provide a novel CRISPR nucleic acid detection method and application, the invention mixes crRNA, tracrRNA and Cas14 enzyme which are complementary with a target sequence to be detected to obtain a ribonucleoprotein complex, directly detects multiple nucleic acids and multiple sites such as single-stranded DNA, RNA, double-stranded DNA and the like, and has the advantages of high design flexibility, good specificity, convenience, rapidness and low cost.
In order to achieve the above object, the present invention adopts the following technical solutions:
a novel CRISPR nucleic acid detection method comprising:
crRNA, tracrRNA, Cas14 enzyme and enzyme buffer solution which are complementary with a target sequence to be detected; or a reaction system consisting of sgRNA formed by connecting crRNA and tracrRNA which are complementary to a target sequence to be detected, Cas14 enzyme and enzyme buffer solution, and generating detectable signal change through enzyme digestion reaction after adding nucleic acid to be detected.
A novel CRISPR nucleic acid detection method comprises the following steps:
step one, preparing a reaction system;
the reaction system comprises: crRNA, tracrRNA, Cas14 enzyme, probe and enzyme buffer solution which are complementary with a target sequence to be detected; or the reaction system comprises: sgRNA formed by connecting crRNA and tracrRNA, Cas14 enzyme, a probe and enzyme buffer solution;
adding the nucleic acid to be detected into the ribose protein complex solution;
and step three, enzyme digestion reaction, signal detection and result interpretation.
The novel CRISPR nucleic acid detection method, Cas14 enzyme, comprises: cas14a, Cas14b, Cas14c, or Cas proteins with similar activity in Cas14 bypass cleavage.
In the novel CRISPR nucleic acid detection method, the nucleic acid to be detected is a nucleic acid in a direct detection sample or a nucleic acid after amplification.
The novel CRISPR nucleic acid detection method comprises the following steps: RNA, single-stranded DNA, or double-stranded DNA.
The application of the novel CRISPR nucleic acid detection method in the direct detection of nucleic acid comprises the following steps:
preparing a reaction system, wherein the reaction system comprises: tracrRNA, crRNA, Cas14 enzyme, probe, enzyme buffer; the crRNA is complementary with a target sequence to be detected;
adding the nucleic acid to be detected into a reaction system,
the reaction system is placed at 25-95 ℃ for 5-200 min.
The signal is read.
The application of the novel CRISPR nucleic acid detection method in the one-step nucleic acid detection combined with isothermal amplification comprises the following steps:
preparing a reaction system, wherein the reaction system comprises a constant-temperature amplification reaction system, a Cas14 enzyme, a probe, tracrRNA and crRNA; adding nucleic acid to be detected into a reaction system, and carrying out amplification and enzyme digestion at 25-95 ℃ for 5-200 min; the crRNA is complementary with a target sequence to be detected;
the signal is read.
The application of the novel CRISPR nucleic acid detection method is applied to the two-step nucleic acid detection combined with the amplification technology, and comprises the following steps:
preparing a constant-temperature amplification reaction system or a PCR reaction system; adding nucleic acid to be detected into an amplification reaction system, and carrying out amplification for 5-240min at 25-99 ℃;
preparing a Cas14a enzyme digestion reaction system, and carrying out warm bath on the prepared enzyme digestion reaction system at 25-95 ℃ for 1-60 min; the Cas14a enzyme digestion reaction system comprises: cas14 enzyme, probe, tracrRNA and crRNA, enzyme buffer;
adding the amplification product into an enzyme digestion reaction system, wherein the volume ratio of the amplification product to the enzyme digestion reaction system is 0.0001/1-5/1;
placing the reaction system in a warm bath at 25-95 ℃ for 1-60 min;
the signal is read.
The application of the novel CRISPR nucleic acid detection method in detecting single-stranded DNA comprises the following steps:
preparing a reaction system, wherein the reaction system comprises: tracrRNA, crRNA, Cas14 enzyme, probe, enzyme buffer; the crRNA is complementary with a target sequence to be detected;
adding the nucleic acid to be detected into a reaction system,
placing the reaction system at 25-95 deg.C for 5-200 min;
the signal is read.
The application of the novel CRISPR nucleic acid detection method,
the ssDNA targets are:
5’-GCCGCGATCAAGGAGTTCTTCATTTCATGGACCAGAACAACCCGCTATTTCGTCATCTGGACTGCTATTGGAGTCTGTCACGTGAGCGTGCCG-3’；
tracrRNA:
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUU-3’；
the crRNA is: 5' -GACGAAUGAAGGAAUGCAACGUCAUCUGGACUGCUAUUGG-3;
the single-stranded DNA probe is: 5 '-FAM-TTTTTTTTTT-BHQ-3'.
The application of the novel CRISPR nucleic acid detection method in detecting double-stranded DNA comprises the following steps:
preparing a constant-temperature amplification reaction system or a PCR reaction system; adding nucleic acid to be detected into an amplification reaction system, and carrying out amplification for 5-240min at 25-99 ℃;
preparing a Cas14a enzyme digestion reaction system, and carrying out warm bath on the prepared enzyme digestion reaction system at 25-95 ℃ for 1-60 min; the Cas14a enzyme digestion reaction system comprises: cas14 enzyme, probe, tracrRNA, crRNA, enzyme buffer; the crRNA is complementary with a target sequence to be detected;
adding the amplification product into an enzyme digestion reaction system, wherein the volume ratio of the amplification product to the enzyme digestion reaction system is 0.0001/1-5/1;
placing the reaction system in a warm bath at 25-95 ℃ for 1-60 min;
the signal is read.
The application of the novel CRISPR nucleic acid detection method,
the cross primers comprise:
forward crossover primer CPF:
TGGCTCCTGTGTATTTTATAGCATTGAGATGAAGTTATTGTTCCAACA；
reverse crossover primer CPR:
TGAAACTTGGCAAATGTCTGTTAGTAATGGACACACATAATAGCTTTA；
forward peripheral primer FB:
AGCGTTAGGTATATCGGAAG；
internal enhancer primer 1IP 1:
CTGACATATATAGCATCAGTTA；
inner enhancer primer 2IP 2:
GTTTTATTAGTGATTTTTTGTT；
reverse peripheral primer RB:
GTTCCATATCACATGGATGTC；
the TrcrRNA is:
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUU-3’；
the crRNA is: 5'-GACGAAUGAAGGAAUGCAAC-3', respectively;
the single-stranded DNA probe is: 5 '-Hex-TTTTTTTT-BHQ-3'.
The application of the novel CRISPR nucleic acid detection method in the detection of single-site mutation comprises the following steps:
asymmetric PCR amplification:
preparing an amplification system, wherein the concentration of a reverse primer of the amplification system is 1.5-50 times that of a forward primer, or the concentration of the forward primer is 1.5-50 times that of the reverse primer;
PCR amplification;
preparing a Cas14a enzyme digestion reaction system, wherein the Cas14a enzyme digestion reaction system comprises: mixing the Cas14 enzyme, the probe, the sgRNA and the enzyme digestion buffer solution;
placing the prepared enzyme digestion reaction system in a warm bath at 25-95 ℃ for 1-60 min;
and (3) enzyme digestion reaction: adding the amplification product into an enzyme digestion reaction system, wherein the volume ratio of the amplification product to the enzyme digestion reaction system is 0.0001/1-5/1;
placing the reaction system at 25-99 deg.C for 1-60 min; the signal is read.
The application of the novel CRISPR nucleic acid detection method,
mutant sequence:
5’-aGCCGCGATCAAGGAGTTCTTCaCAATCTACCCGCGGCTAGACGGGAAGACCCCATGAACCTTTACTGaGTCTGTCACGTGAGCGTGCCGa-3’；
wild-type sequence:
5’-aGCCGCGATCAAGGAGTTCTTCaCAATCTACCCGCGGCTAGACGGAAAGACCCCATGAACCTTTACTGaGTCTGTCACGTGAGCGTGCCGa-3’；
a forward primer: 5'-GCCGCGATCAAGGAGTTCTTC-3', respectively;
reverse primer: 5'-CGGCACGCTCACGTGACTGAC-3', respectively;
sgRNA is:
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUAAAGACGAAUGAAGGAAUGCAACCGGCUAGACGGGAAGACCCC-3；
the single-stranded DNA probe is: 5 '-FAM-TTTTTTTTTT-BHQ-3'.
The application of the novel CRISPR nucleic acid detection method in RNA detection comprises the following steps:
formulating a reverse transcription amplification system comprising: RT-PCR, RT-LAMP, RT-CPA and other types of reverse transcription amplification reaction systems;
adding RNA to be detected for reverse transcription amplification;
preparing a Cas14a enzyme digestion reaction system, which comprises the following steps: cas14 enzyme, a probe, tracrRNA, crRNA and enzyme digestion buffer solution;
placing the prepared enzyme digestion reaction system in a warm bath at 25-95 ℃ for 1-60 min;
and (3) enzyme digestion reaction: adding the amplification product into an enzyme digestion reaction system, wherein the volume ratio of the amplification product to the enzyme digestion reaction system is 0.0001/1-5/1;
placing the reaction system at 25-95 deg.C for 1-60 min; the signal is read.
The application of the novel CRISPR nucleic acid detection method,
the primers for detecting the new coronavirus comprise:
the forward peripheral primer BF: AACACAAGCTTTCGGCAG,
the reverse peripheral primer BR: GAAATTTGGATCTTTGTCATCC,
the forward loop primer CPF: TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC,
reverse loop primer CPR: CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG the flow of the air in the air conditioner,
internal enhancer primer 2 AR: ACCTTCGGGAACGTGGTT, respectively;
tracrRNA：
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUU-3’；
crRNA：5’-GACGAAUGAAGGAAUGCAACGAAGAACGCUGAAGCGCUG-3’；
single-stranded DNA Probe: 5 '-FAM-TTTTTTTTTT-BHQ-3'.
The invention has the advantages that:
the method is not limited by a PAM site in the design of the detection target, the design flexibility is high, and other CRISPR nucleic acid detection methods using Cas12 or Cas13 enzymes all require a PAM site near the detection target;
the invention utilizes the activity of Cas14, mixes crRNA, tracrRNA and Cas14 enzyme which are complementary with a target sequence to be detected to obtain a ribonucleoprotein complex, obtains the characteristics of specific binding and nonspecific bypass cutting activity, and can directly detect various nucleic acids and multiple sites including single-stranded DNA, RNA, double-stranded DNA and the like by applying the method;
the detection technology has the advantages of good specificity, convenience, rapidness and low cost.
Drawings
FIG. 1 is a schematic diagram of a ribonucleoprotein complex obtained by mixing crRNA, tracrRNA and Cas14 enzyme of the invention;
FIG. 2 is a graph showing the results of the experiment in example 1 of the present invention (ordinate: final signal intensity after subtraction of reference value, abscissa: different analyte concentrations);
FIG. 3 is a graph showing the results of the sensitivity test in example 2 of the present invention;
FIG. 4 is a graph showing the results of an experiment for detecting a mutant sequence in example 3 of the present invention;
FIG. 5 is a graph showing the relationship between the cleavage signal curve and the fluorescence channel FAM in the experimental results of example 4 of the present invention;
FIG. 6 is a comparison of the final fluorescence intensity of the positive and negative samples minus the standard according to the experimental results of example 4 of the present invention.
Detailed Description
The invention is described in detail below with reference to the figures and the embodiments.
A novel CRISPR nucleic acid detection method,
step one, sample processing;
before CRISPR detection, an appropriate sample processing method is selected according to the characteristics of different samples.
Secondly, sample amplification; (optional step)
The concentration of a detection target can be improved by amplifying the nucleic acid to be detected, and the variety of the nucleic acid detected by the method can be expanded by using different amplification technologies;
as an example, when the nucleic acid to be detected is double-stranded DNA, a large number of single-stranded DNA fragments of the target to be detected can be obtained by an amplification method such as asymmetric PCR or CPA. As another example, when the nucleic acid to be detected is RNA, a reverse transcription step or a reverse transcriptase may be added on the basis of the amplification method, thereby obtaining a single-stranded DNA fragment to be detected by amplification.
Step three, preparing a reaction system;
the reaction system comprises: crRNA, tracrRNA, Cas14 enzyme and enzyme buffer solution which are complementary with a target sequence to be detected; or the reaction system comprises: sgRNA formed by connecting crRNA and tracrRNA, Cas14 enzyme and enzyme buffer solution; as an example, Cas14 enzymes include: cas14a, Cas14b, Cas14 c.
Adding the nucleic acid to be detected and the probe into the ribose protein complex solution; the probe is a single-stranded DNA probe, and may be labeled with a fluorophore or an antibody.
And step five, detecting signals and interpreting results.
Detection of the signal and interpretation of the results includes: detection of fluorescence signal and interpretation of result, detection of immunochromatographic test paper and interpretation of result. When the added probe is single-stranded DNA with a fluorescent group and a quenching group, the probe releases a fluorescent signal after being sheared by Cas enzyme, and the fluorescent signal can be collected by a PCR (polymerase chain reaction) instrument, an enzyme-labeling instrument or other fluorescent signal detection equipment. The signal acquisition time may be after the detection reaction is finished, and may be performed simultaneously with the detection reaction. Whether the result is detected or not can be determined by the intensity of the fluorescent signal. When the added probe is an antibody label, the result can be displayed by an immunochromatographic test paper after the detection reaction is finished.
The above steps are not absolute, and the combination can be simplified into a one-step method or a two-step method, but the invention is not limited to the method, as long as the activity of the Cas14 is utilized, and the crRNA, the tracrRNA and the Cas14 enzyme which are complementary to the target sequence to be detected are mixed to obtain the ribonucleoprotein complex, so that the method for obtaining the characteristics of specific combination and non-specific bypass cleavage activity is within the protection scope of the invention. The detection method can be directly used for detecting single-stranded DNA samples. Can also be used in combination with various amplification techniques to improve sensitivity and expand the range of the detected sample. This technique may be used with techniques including PCR; cross primer isothermal amplification technology; LAMP; the detection of single-stranded and double-stranded DNA is achieved by combining various amplification techniques including RPA. If reverse transcriptase is added into the amplification system, the detection of RNA can be realized. The principle of the method can be combined with digital PCR, chip technology and the like to develop a nucleic acid detection method with higher sensitivity.
Principle analysis of the present invention:
cas14 is a novel class of Cas enzymes, including Cas14a, Cas14b, Cas14c, and the like. It has a shorter amino acid sequence of only Cas12 and half to two thirds of Cas13, which is 400-700 amino acids. Cas14 needs to bind to guide RNA in order to obtain the ability to specifically bind and cleave single-stranded DNA. Guide RNAs can take two forms: 1. one is in the form of the shorter CRISPR RNA (crRNA), binding of crRNA to Cas14 needs to be achieved with the help of trans activating CRISPR RNA (tracrRNA) with specific secondary structure. The 5 'end of the crRNA has a complementary region to the 3' end of the tracrRNA, and the two combine via the complementary region to form a secondary structure capable of binding to Cas 14. 2. Another form is to combine crRNA with tracrRNA into a single sgRNA, which after folding forms a secondary structure with the ability to bind Cas 14.
As shown in fig. 1: the 3 'and 5' sequences of the tracrRNA bind by complementarity and the tracrRNA is able to fold to form a complex secondary structure with multiple hairpin structures. This structure enables the tracrRNA and crRNA to bind to Cas14 enzyme, being encapsulated by Cas14 enzyme, forming a ribonucleoprotein complex. Cas14, when bound to the guide RNA, is capable of specifically recognizing the single stranded target DNA sequence complementary to the crRNA recognition region sequence. When the target sequence is found by the Cas 14-guide RNA complex, it can bind to the target sequence and cleave the target sequence downstream of the 3' end of the recognition region. At the same time, the Cas 14-guide RNA complex acquires nonspecific alternative cleavage activity, i.e., rapidly and indiscriminately cleaves all nearby single-stranded DNA (e.g., single-stranded DNA probes).
The invention utilizes the activity of Cas14 to design crRNA complementary with a target sequence to be detected. The crRNA, tracrRNA and Cas14 enzyme were mixed and incubated in enzyme buffer to obtain ribonucleoprotein complexes. Adding the nucleic acid to be detected and the single-stranded report probe into the ribose protein complex solution, carrying out enzyme digestion reaction at a proper temperature, and reading signals to obtain a detection result.
The following four application examples verify that the detection method has the beneficial effect of high sensitivity;
example 1:
cas14a method for detecting single-stranded DNA
This example illustrates a CRISPR nucleic acid detection method using Cas14a enzyme to detect single stranded DNA.
1. The material and the method are as follows:
1.1 ssDNA target:
5’-GCCGCGATCAAGGAGTTCTTCATTTCATGGACCAGAACAACCCGCTATTTCGTCATCTGGACTGCTATTGGAGTCTGTCACGTGAGCGTGCCG-3’；
1.2 tracrRNA：
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUU-3’；
1.3 crRNA：
5’-GACGAAUGAAGGAAUGCAACGUCAUCUGGACUGCUAUUGG-3；
1.4 Single-stranded DNA Probe:
5’-FAM-TTTTTTTTTT-BHQ-3’；
1.4 Cas14 enzyme
The Cas14 enzyme may be Cas14a, Cas14b, Cas14c or other Cas14 enzymes;
1.51 Xenzyme reaction solution:
10-200mM NaCl，
5-100mM Tris-HCl，
2-50mM MgCl2，
10-500μg/ml BSA，
pH 7-9@25℃。
the detection process comprises the following steps:
step 1: and (4) preparing a reaction system. The reaction system is as follows: 10-500nM tracrRNA, 10-500nM crRNA, 10-500nM Cas14 enzyme, 1nM-2000mM single stranded DNA probe, 10-200mM NaCl, 5-100mM Tris-HCl, 2-50mM MgCl2, 10-500. mu.g/ml BSA, pH 7-9@25 ℃;
step 2: (optional step): the reaction system is set to 30-60 ℃ for 5-60 min;
and step 3: adding the single-stranded DNA to be detected into a reaction system, wherein the concentration of the single-stranded DNA probe is 5-2000 nM;
and 4, step 4: the reaction system is set at 25-65 ℃ for 5-60 min.
And 5: the fluorescent signal is read.
As a result: as shown in fig. 2.
And (4) analyzing results: the method is used for directly detecting single-stranded DNA, and the sensitivity can reach: the 0.1nM. ordinate is the final fluorescence signal intensity after subtraction of the reference value. The abscissa is the concentration of the different analytes.
And (4) conclusion: the detection method can be used for detecting the single-stranded DNA sample, and the detection sensitivity of the single-stranded DNA sample reaches 0.1nM.
Example 2:
double-cross primer isothermal amplification combined with Cas14a detection of escherichia coli
This example describes a method for CRISPR nucleic acid detection using Cas14a enzyme after amplification of double-stranded DNA to be detected using double-crossover primer isothermal amplification technique.
Materials and methods
Primer:
CPF：TGGCTCCTGTGTATTTTATAGCATTGAGATGAAGTTATTGTTCCAACA；
CPR：TGAAACTTGGCAAATGTCTGTTAGTAATGGACACACATAATAGCTTTA；
FB AGCGTTAGGTATATCGGAAG；
IP1 CTGACATATATAGCATCAGTTA；
IP2 GTTTTATTAGTGATTTTTTGTT；
RB GTTCCATATCACATGGATGTC；
TracrRNA：
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUU-3’；
CrRNA：
5’--3’；
single-stranded DNA Probe:
5’-Hex-TTTTTTTT-BHQ-3’；
cas14 enzyme:
the Cas14 enzyme may be Cas14a, Cas14b, Cas14c or other Cas14 enzymes.
Bst DNA polymerase Neb.
The detection process comprises the following steps:
step 1: sample processing
Diluting the culture solution containing Escherichia coli with water, and boiling at 100 deg.C for 5-30 min;
step 2: configuring a constant-temperature amplification reaction system:
0.1-2 mu M CPF forward cross primer
0.1-2 mu M CPR reverse cross primer
0.1-1 μ M FB Forward peripheral primer
0.1-1. mu.M RB reverse peripheral primer
0.1-2. mu.M IP1 internal enhancer primer 1
0.1-2. mu.M IP2 internal enhancer primer 2
0.1-1M Betaine
2-15mM MgSO4
0.4-1.2mM dNTPs
1-20U Bst DNA polymerase.
And step 3: nucleic acid amplification
Adding the treated Escherichia coli sample into a cross primer isothermal amplification reaction system, and performing amplification at 55-65 ℃ for 10-60 min.
And 4, step 4: cas14a enzyme digestion reaction system preparation.
Equimolar amounts of Cas14 enzyme, tracrRNA and crRNA (final concentration (0.02-2. mu.M)), 1nM-2000mM probe were mixed with the digestion buffer. The components of the enzyme digestion buffer solution are as follows:
10-200mM NaCl
5-100mM Tris-HCl
2-50mM MgCl2
10-500μg/ml BSA
pH 7-9@25℃
the prepared enzyme digestion reaction system is put into a warm bath for 5-30min at the temperature of 30-55 ℃.
And 5: enzyme digestion reaction
Adding the amplification product with proper volume into the enzyme cutting reaction system, wherein the volume ratio of the amplification product to the enzyme cutting reaction system is 0.001/1-5/1. Enzyme digestion is carried out for 5-60min at 25-55 ℃ in a microplate reader or a PCR instrument, and a fluorescence signal is read.
As a result: as shown in fig. 3: the sensitivity of detecting the escherichia coli by using the method can reach 100CFU/ml, and a negative sample has no enzyme digestion signal.
And (4) conclusion: the method can effectively detect Escherichia coli. The cross primer isothermal amplification technology can perform isothermal amplification on the double-stranded template, and the product contains a large number of single strands of target sequences, so that the method is very suitable for being combined with Cas14a enzyme.
Example 3:
this example illustrates a CRISPR nucleic acid detection method using asymmetric PCR in combination with Cas14a enzyme to detect single-site mutations.
And (3) detecting a sequence to be detected:
materials:
mutant sequence:
5’-aGCCGCGATCAAGGAGTTCTTCaCAATCTACCCGCGGCTAGACGGGAAGACCCCATGAACCTTTACTGaGTCTGTCACGTGAGCGTGCCGa-3’；
wild-type sequence:
5’-aGCCGCGATCAAGGAGTTCTTCaCAATCTACCCGCGGCTAGACGGAAAGACCCCATGAACCTTTACTGaGTCTGTCACGTGAGCGTGCCGa-3’；
forward amplification primer: 5'-GCCGCGATCAAGGAGTTCTTC-3', respectively;
reverse amplification primer: 5'-CGGCACGCTCACGTGACTGAC-3', respectively;
SgRNA:
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUAAAGACGAAUGAAGGAAUGCAACCGGCUAGACGGGAAGACCCC-3’；
PCR kit: TaKaRa Ex
Cas14 enzyme: the Cas14 enzyme may be Cas14a, Cas14b, Cas14c or other Cas14 enzymes;
single-stranded DNA Probe: 5 '-FAM-TTTTTTTTTT-BHQ-3';
the detection process comprises the following steps:
step 1: asymmetric PCR amplification
Preparation of an amplification system: the preparation solution of the amplification system is as follows, the concentration of the reverse primer needs to be 10-50 times of that of the forward primer;
and (3) amplification procedure:
procedure 1: cycle number of 98 ℃ 10sec, 55 ℃ 30sec, 72 ℃ 45 sec: 20-40 parts of;
or the program 2: 10sec at 98 deg.C and 20-40 cycles at 60 deg.C for 1 min.
Step 2: cas14a enzyme digestion reaction system preparation.
An equimolar amount of Cas14 enzyme, sgRNA (final concentration (0.02-2. mu.M)), 1nM-2000mM probe, was mixed with the digestion buffer. The components of the enzyme digestion buffer solution are as follows:
pH 7-9@25℃
the prepared enzyme digestion reaction system is put into a warm bath for 5-30min at the temperature of 30-55 ℃.
And step 3: enzyme digestion reaction
Adding the amplification product with proper volume into the enzyme cutting reaction system, wherein the volume ratio of the amplification product to the enzyme cutting reaction system is 0.001/1-5/1. Enzyme digestion is carried out for 5-60min at 25-55 ℃ in a microplate reader or a PCR instrument, and a fluorescence signal is read.
As a result:
as shown in fig. 4: the CRISPR nucleic acid detection method using asymmetric PCR amplification in combination with Cas14a can effectively detect mutant sequences.
And (4) conclusion: the method amplifies double-stranded DNA to be detected into a product mainly comprising single-stranded DNA by asymmetric PCR. And performing enzyme digestion detection on the product by using a Cas14a CRISPR nucleic acid detection method. And judging whether the DNA to be detected is wild type or mutant type according to the intensity of the enzyme digestion signal. The method has the advantages of good specificity, high sensitivity and strong repeatability. Has the characteristics of simple and convenient operation, clear interpretation of results and the like.
Example 4: method for detecting novel coronavirus by using Cas14a1
This example illustrates a one-step method for detecting RNA in novel coronavirus using RT-LAMP and CRISPR
Materials:
1.1 target:
a new coronavirus N gene target nucleic acid;
1.2 primer:
the positive peripheral primer BF: AACACAAGCTTTCGGCAG;
reverse peripheral primer BR: GAAATTTGGATCTTTGTCATCC;
the forward loop primer CPF: TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC;
reverse loop primer CPR: CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG, respectively;
internal enhancer primer 2 AR: ACCTTCGGGAACGTGGTT, respectively;
1.3tracrRNA：
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUU-3’；
1.4crRNA：
5’-GACGAAUGAAGGAAUGCAACGAAGAACGCUGAAGCGCUG-3’；
1.5Cas14 enzyme:
the Cas14 enzyme may be Cas14a, Cas14b, Cas14c or other Cas14 enzymes;
1.6 reverse transcriptase:
AMV-RT；
1.7 Single-stranded DNA Probe: 5 '-FAM-TTTTTTTTTT-BHQ-3';
the detection method comprises the following specific steps:
the method comprises the following steps: preparing an RT-LAMP amplification system:
0.1-2μM CPF
0.1-2μM CPR
0.1-1μM BF
0.1-1μM BR
0.1-2μM AF
0.1-2μM AR
0.1-1M Betaine
2-15mM MgSO4
0.4-1.2mM dNTPs
1-20U Bst DNA polymerase
1-20U AMV-RT
Step 2: sample application
Adding the new coronavirus N gene target nucleic acid to be detected, adding the sample with the concentration of not 100 copies per reaction, and adding ultrapure water or pharynx swab extracting solution without the new coronavirus with the same volume as the negative control. Negative and positive 4 replicates each.
And step 3: RT-LAMP amplification
And (3) placing the reaction tube after sample adding into equipment which can be heated at constant temperature, such as a metal bath, a PCR instrument, a water bath and the like, and amplifying at the temperature of 50-70 ℃.
And 4, step 4: cas14a enzyme digestion reaction system preparation.
Equimolar amounts of Cas14 enzyme, crRNA, tracrRNA (final concentration (0.02-2. mu.M)), 1nM-2000mM probe were mixed with the digestion buffer. The components of the enzyme digestion buffer solution are as follows:
pH 7-9@25℃；
the prepared enzyme digestion reaction system is put into a warm bath for 5-30min at the temperature of 30-55 ℃.
And 5: enzyme digestion reaction
Adding the amplification product with proper volume into the enzyme cutting reaction system, wherein the volume ratio of the amplification product to the enzyme cutting reaction system is 0.01/1-1/1. Enzyme digestion is carried out for 5-60min at 25-55 ℃ in a microplate reader or a PCR instrument, and a fluorescence signal is read.
The results are shown in FIGS. 5 and 6:
FIG. 5: for the restriction signal curve, the fluorescence channel is FAM. FIG. 6 is a comparison of the final fluorescence intensity of the positive and negative samples after subtraction of the standard.
All 4 positive samples were detected, and all negative samples were not detected.
And (4) conclusion: by integrating by RT-LAMP, the CRISPR detection method can detect the virus RNA sample, and the sensitivity is higher than 100 copies per reaction.
The experiments show that compared with the conventional CRISPR nucleic acid detection, the detection method disclosed by the invention has the characteristic of no PAM site restriction, and has the advantages that the detected fragments, crRNA/sgRNA and amplification primers can be flexibly designed; the detection sensitivity is high, the operation is simple and convenient, and the cost is controllable; can detect a variety of nucleic acids such as single-stranded DNA, double-stranded DNA, RNA, etc., and particularly has excellent specificity in detecting single-stranded DNA or single-stranded DNA amplification products.
The foregoing illustrates and describes the principles, general features, and advantages of the present invention. It should be understood by those skilled in the art that the above embodiments do not limit the present invention in any way, and all technical solutions obtained by using equivalent alternatives or equivalent variations fall within the scope of the present invention.
Sequence listing
<110> Hangzhou Yosida Biotechnology Co., Ltd
<120> novel CRISPR nucleic acid detection method and application
<141> 2020-10-14
<160> 27
<170> SIPOSequenceListing 1.0
<210> 1
<211> 93
<212> DNA
<213> Artificial Sequence
<400> 1
gccgcgatca aggagttctt catttcatgg accagaacaa cccgctattt cgtcatctgg 60
actgctattg gagtctgtca cgtgagcgtg ccg 93
<210> 2
<211> 140
<212> RNA
<213> Artificial Sequence
<400> 2
cuucacugau aaaguggaga accgcuucac caaaagcugu cccuuagggg auuagaacuu 60
gagugaaggu gggcugcuug caucagccua augucgagaa gugcuuucuu cggaaaguaa 120
cccucgaaac aaauucauuu 140
<210> 3
<211> 40
<212> RNA
<213> Artificial Sequence
<400> 3
gacgaaugaa ggaaugcaac gucaucugga cugcuauugg 40
<210> 4
<211> 10
<212> DNA
<213> Artificial Sequence
<400> 4
<210> 5
<211> 48
<212> DNA
<213> Artificial Sequence
<400> 5
tggctcctgt gtattttata gcattgagat gaagttattg ttccaaca 48
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence
<400> 6
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 7
ctgacatata tagcatcagt ta 22
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 8
gttttattag tgattttttg tt 22
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 9
gttccatatc acatggatgt c 21
<210> 10
<211> 140
<212> RNA
<213> Artificial Sequence
<400> 10
cuucacugau aaaguggaga accgcuucac caaaagcugu cccuuagggg auuagaacuu 60
gagugaaggu gggcugcuug caucagccua augucgagaa gugcuuucuu cggaaaguaa 120
cccucgaaac aaauucauuu 140
<210> 12
<211> 20
<212> RNA
<213> Artificial Sequence
<400> 12
<210> 12
<211> 8
<212> DNA
<213> Artificial Sequence
<400> 12
tttttttt 8
<210> 13
<211> 91
<212> DNA
<213> Artificial Sequence
<400> 13
agccgcgatc aaggagttct tcacaatcta cccgcggcta gacgggaaga ccccatgaac 60
ctttactgag tctgtcacgt gagcgtgccg a 91
<210> 14
<211> 91
<212> DNA
<213> Artificial Sequence
<400> 14
agccgcgatc aaggagttct tcacaatcta cccgcggcta gacggaaaga ccccatgaac 60
ctttactgag tctgtcacgt gagcgtgccg a 91
<210> 15
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 15
gccgcgatca aggagttctt c 21
<210> 16
<211> 21
<212> DNA
<213> Artificial Sequence
<400> 16
cggcacgctc acgtgactga c 21
<210> 17
<211> 183
<212> RNA
<213> Artificial Sequence
<400> 17
cuucacugau aaaguggaga accgcuucac caaaagcugu cccuuagggg auuagaacuu 60
gagugaaggu gggcugcuug caucagccua augucgagaa gugcuuucuu cggaaaguaa 120
cccucgaaac aaauucauuu aaagacgaau gaaggaaugc aaccggcuag acgggaagac 180
ccc 183
<210> 18
<211> 10
<212> DNA
<213> Artificial Sequence
<400> 18
<210> 19
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 19
aacacaagct ttcggcag 18
<210> 20
<211> 22
<212> DNA
<213> Artificial Sequence
<400> 20
gaaatttgga tctttgtcat cc 22
<210> 21
<211> 41
<212> DNA
<213> Artificial Sequence
<400> 21
tgcggccaat gtttgtaatc agccaaggaa attttgggga c 41
<210> 22
<211> 39
<212> DNA
<213> Artificial Sequence
<400> 22
cgcattggca tggaagtcac tttgatggca cctgtgtag 39
<210> 23
<211> 19
<212> DNA
<213> Artificial Sequence
<400> 23
ttccttgtct gattagttc 19
<210> 24
<211> 18
<212> DNA
<213> Artificial Sequence
<400> 24
accttcggga acgtggtt 18
<210> 25
<211> 140
<212> RNA
<213> Artificial Sequence
<400> 25
cuucacugau aaaguggaga accgcuucac caaaagcugu cccuuagggg auuagaacuu 60
gagugaaggu gggcugcuug caucagccua augucgagaa gugcuuucuu cggaaaguaa 120
cccucgaaac aaauucauuu 140
<210> 26
<211> 39
<212> RNA
<213> Artificial Sequence
<400> 26
gacgaaugaa ggaaugcaac gaagaacgcu gaagcgcug 39
<210> 27
<211> 10
<212> DNA
<213> Artificial Sequence
<400> 27
Claims (16)
1. A novel method of CRISPR nucleic acid detection comprising:
crRNA, tracrRNA, Cas14 enzyme and enzyme buffer solution which are complementary with a target sequence to be detected; or a reaction system consisting of sgRNA formed by connecting crRNA and tracrRNA which are complementary to a target sequence to be detected, Cas14 enzyme and enzyme buffer solution, and generating detectable signal change through enzyme digestion reaction after adding nucleic acid to be detected.
2. A novel CRISPR nucleic acid detection method is characterized by comprising the following steps:
step one, preparing a reaction system;
the reaction system comprises: crRNA, tracrRNA, Cas14 enzyme, probe and enzyme buffer solution which are complementary with a target sequence to be detected; or the reaction system comprises: sgRNA formed by connecting crRNA and tracrRNA, Cas14 enzyme, a probe and enzyme buffer solution;
adding the nucleic acid to be detected into the ribose protein complex solution;
and step three, enzyme digestion reaction, signal detection and result interpretation.
3. The novel CRISPR nucleic acid detection method of claim 1 or 2, wherein said Cas14 enzyme comprises: cas14a, Cas14b, Cas14c, or Cas proteins with similar activity in Cas14 bypass cleavage.
4. The novel CRISPR nucleic acid detection method of claim 1 or 2, wherein said nucleic acid to be detected is a nucleic acid in a sample directly or an amplified nucleic acid.
5. The novel CRISPR nucleic acid detection method of claim 1 or 2, wherein said nucleic acid to be detected comprises: RNA, single-stranded DNA, or double-stranded DNA.
6. The application of the novel CRISPR nucleic acid detection method is characterized in that the step of directly detecting nucleic acid comprises the following steps:
preparing a reaction system, wherein the reaction system comprises: tracrRNA, crRNA, Cas14 enzyme, probe, enzyme buffer; the crRNA is complementary with a target sequence to be detected;
adding the nucleic acid to be detected into a reaction system,
the reaction system is placed at 25-95 ℃ for 5-200 min.
The signal is read.
7. The application of the novel CRISPR nucleic acid detection method is characterized in that the step of applying the method to the one-step nucleic acid detection combined with isothermal amplification comprises the following steps:
preparing a reaction system, wherein the reaction system comprises a constant-temperature amplification reaction system, a Cas14 enzyme, a probe, tracrRNA and crRNA; adding nucleic acid to be detected into a reaction system, and carrying out amplification and enzyme digestion at 25-95 ℃ for 5-200 min; the crRNA is complementary with a target sequence to be detected;
the signal is read.
8. The application of the novel CRISPR nucleic acid detection method is characterized in that the step of applying the method to the two-step nucleic acid detection combined with the amplification technology comprises the following steps:
preparing a constant-temperature amplification reaction system or a PCR reaction system; adding nucleic acid to be detected into an amplification reaction system, and carrying out amplification for 5-240min at 25-99 ℃;
preparing a Cas14a enzyme digestion reaction system, and carrying out warm bath on the prepared enzyme digestion reaction system at 25-95 ℃ for 1-60 min; the Cas14a enzyme digestion reaction system comprises: cas14 enzyme, probe, tracrRNA and crRNA, enzyme buffer;
adding the amplification product into an enzyme digestion reaction system, wherein the volume ratio of the amplification product to the enzyme digestion reaction system is 0.0001/1-5/1;
placing the reaction system in a warm bath at 25-95 ℃ for 1-60 min;
the signal is read.
9. The application of the novel CRISPR nucleic acid detection method is characterized in that the step of detecting single-stranded DNA comprises the following steps:
preparing a reaction system, wherein the reaction system comprises: tracrRNA, crRNA, Cas14 enzyme, probe, enzyme buffer; the crRNA is complementary with a target sequence to be detected;
adding nucleic acid to be detected into a reaction system;
placing the reaction system at 25-95 deg.C for 5-200 min;
the signal is read.
10. The use of the novel CRISPR nucleic acid detection method according to claim 9,
the ssDNA targets are:
5’-GCCGCGATCAAGGAGTTCTTCATTTCATGGACCAGAACAACCCGCTATTTCGTCATCTGGACTGCTATTGGAGTCTGTCACGTGAGCGTGCCG-3’；
tracrRNA:
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUU-3’；
the crRNA is: 5' -GACGAAUGAAGGAAUGCAACGUCAUCUGGACUGCUAUUGG-3;
the single-stranded DNA probe is: 5 '-FAM-TTTTTTTTTT-BHQ-3'.
11. The application of the novel CRISPR nucleic acid detection method is characterized in that the step of detecting double-stranded DNA comprises the following steps:
preparing a constant-temperature amplification reaction system or a PCR reaction system; adding nucleic acid to be detected into an amplification reaction system, and carrying out amplification for 5-240min at 25-99 ℃;
preparing a Cas14a enzyme digestion reaction system, and carrying out warm bath on the prepared enzyme digestion reaction system at 25-95 ℃ for 1-60 min; the Cas14a enzyme digestion reaction system comprises: cas14 enzyme, probe, tracrRNA, crRNA, enzyme buffer; the crRNA is complementary with a target sequence to be detected;
adding the amplification product into an enzyme digestion reaction system, wherein the volume ratio of the amplification product to the enzyme digestion reaction system is 0.0001/1-5/1;
placing the reaction system in a warm bath at 25-95 ℃ for 1-60 min;
the signal is read.
12. The use of the novel CRISPR nucleic acid detection method of claim 11, wherein the cross-primers comprise:
forward crossover primer CPF:
TGGCTCCTGTGTATTTTATAGCATTGAGATGAAGTTATTGTTCCAACA；
reverse crossover primer CPR:
TGAAACTTGGCAAATGTCTGTTAGTAATGGACACACATAATAGCTTTA；
forward peripheral primer FB:
AGCGTTAGGTATATCGGAAG；
internal enhancer primer 1IP 1:
CTGACATATATAGCATCAGTTA；
inner enhancer primer 2IP 2:
GTTTTATTAGTGATTTTTTGTT；
reverse peripheral primer RB:
GTTCCATATCACATGGATGTC；
the TracrRNA is:
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUU-3’；
the crRNA is: 5'-GACGAAUGAAGGAAUGCAAC-3', respectively;
the single-stranded DNA probe is: 5 '-Hex-TTTTTTTT-BHQ-3'.
13. The application of the novel CRISPR nucleic acid detection method is characterized in that the step of detecting single-site mutation comprises the following steps:
asymmetric PCR amplification:
preparing an amplification system, wherein the concentration of a reverse primer of the amplification system is 1.5-50 times that of a forward primer, or the concentration of the forward primer is 1.5-50 times that of the reverse primer;
PCR amplification;
preparing a Cas14a enzyme digestion reaction system, wherein the Cas14a enzyme digestion reaction system comprises: mixing the Cas14 enzyme, the probe, the sgRNA and the enzyme digestion buffer solution;
placing the prepared enzyme digestion reaction system in a warm bath at 25-95 ℃ for 1-60 min;
and (3) enzyme digestion reaction: adding the amplification product into an enzyme digestion reaction system, wherein the volume ratio of the amplification product to the enzyme digestion reaction system is 0.0001/1-5/1;
placing the reaction system at 25-99 deg.C for 1-60 min; the signal is read.
14. The use of the novel CRISPR nucleic acid detection method according to claim 13,
mutant sequence:
5’-aGCCGCGATCAAGGAGTTCTTCaCAATCTACCCGCGGCTAGACGGGAAGACCCCATGAACCTTTACTGaGTCTGTCACGTGAGCGTGCCGa-3’；
wild-type sequence:
5’-aGCCGCGATCAAGGAGTTCTTCaCAATCTACCCGCGGCTAGACGGAAAGACCCCATGAACCTTTACTGaGTCTGTCACGTGAGCGTGCCGa-3’；
a forward primer: 5'-GCCGCGATCAAGGAGTTCTTC-3', respectively;
reverse primer: 5'-CGGCACGCTCACGTGACTGAC-3', respectively;
the sgRNA is:
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUAAAGACGAAUGAAGGAAUGCAACCGGCUAGACGGGAAGACCCC-3；
the single-stranded DNA probe is: 5 '-FAM-TTTTTTTTTT-BHQ-3'.
15. The application of the novel CRISPR nucleic acid detection method is characterized in that the step of applying the method to the RNA detection comprises the following steps:
formulating a reverse transcription amplification system comprising: RT-PCR, RT-LAMP, RT-CPA and other types of reverse transcription amplification reaction systems;
adding RNA to be detected for reverse transcription amplification;
preparing a Cas14a enzyme digestion reaction system, which comprises the following steps: cas14 enzyme, a probe, tracrRNA, crRNA and enzyme digestion buffer solution;
placing the prepared enzyme digestion reaction system in a warm bath at 25-95 ℃ for 1-60 min;
and (3) enzyme digestion reaction: adding the amplification product into an enzyme digestion reaction system, wherein the volume ratio of the amplification product to the enzyme digestion reaction system is 0.0001/1-5/1;
placing the reaction system at 25-95 deg.C for 1-60 min; the signal is read.
16. The use of the novel CRISPR nucleic acid detection method according to claim 15,
the primers for detecting the new coronavirus comprise:
the forward peripheral primer BF: AACACAAGCTTTCGGCAG,
the reverse peripheral primer BR: GAAATTTGGATCTTTGTCATCC,
the forward loop primer CPF: TGCGGCCAATGTTTGTAATCAGCCAAGGAAATTTTGGGGAC,
reverse loop primer CPR: CGCATTGGCATGGAAGTCACTTTGATGGCACCTGTGTAG the flow of the air in the air conditioner,
internal enhancer primer 1 AF: TTCCTTGTCTGATTAGTTC the flow of the air in the air conditioner,
internal enhancer primer 2 AR: ACCTTCGGGAACGTGGTT, respectively;
tracrRNA：
5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUU-3’；
crRNA：5’-GACGAAUGAAGGAAUGCAACGAAGAACGCUGAAGCGCUG-3’；
single-stranded DNA Probe: 5 '-FAM-TTTTTTTTTT-BHQ-3'.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011097291.2A CN112176035A (en) | 2020-10-14 | 2020-10-14 | Novel CRISPR nucleic acid detection method and application |
| PCT/CN2020/129013 WO2022077687A1 (en) | 2020-10-14 | 2020-11-16 | Novel crispr nucleic acid testing method and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011097291.2A CN112176035A (en) | 2020-10-14 | 2020-10-14 | Novel CRISPR nucleic acid detection method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112176035A true CN112176035A (en) | 2021-01-05 |
Family
ID=73950046
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011097291.2A Pending CN112176035A (en) | 2020-10-14 | 2020-10-14 | Novel CRISPR nucleic acid detection method and application |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN112176035A (en) |
| WO (1) | WO2022077687A1 (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112501359A (en) * | 2021-02-07 | 2021-03-16 | 吴江近岸蛋白质科技有限公司 | Primer group and kit for detecting novel coronavirus COVID-19 |
| CN112921119A (en) * | 2021-02-24 | 2021-06-08 | 复旦大学 | Primer group, kit and method for loop-mediated nicking isothermal-CRISPR (clustered regularly interspaced short palindromic repeats) combined detection of rift valley fever virus |
| CN114032340A (en) * | 2021-04-16 | 2022-02-11 | 杭州安誉科技有限公司 | Novel coronavirus nucleic acid detection kit |
| CN114196752A (en) * | 2021-12-08 | 2022-03-18 | 福州市讯刊生物科技有限公司 | miR-21 detection kit based on Cas14 and strand displacement amplification and application thereof |
| CN115044649A (en) * | 2021-08-11 | 2022-09-13 | 山东舜丰生物科技有限公司 | Improved method for detecting target nucleic acid based on CRISPR technology |
| CN116622810A (en) * | 2023-01-10 | 2023-08-22 | 南华大学 | Novel engineering CRISPR-Cas14a1 detection system, method and application |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115820852B (en) * | 2022-09-15 | 2023-09-01 | 广州医科大学附属第一医院（广州呼吸中心） | Electrochemical sensor for detecting TMPRSS2-ERG fusion gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020086908A1 (en) * | 2018-10-24 | 2020-04-30 | The Broad Institute, Inc. | Constructs for improved hdr-dependent genomic editing |
| WO2020102659A1 (en) * | 2018-11-15 | 2020-05-22 | The Broad Institute, Inc. | G-to-t base editors and uses thereof |
| CN111363763A (en) * | 2020-03-31 | 2020-07-03 | 海南大学 | Method for activating Cas14a enzyme collateral cleavage effect by RNA |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117487776A (en) * | 2017-11-01 | 2024-02-02 | 加利福尼亚大学董事会 | CASZ compositions and methods of use |
| CN111690717B (en) * | 2020-04-30 | 2023-05-30 | 山东舜丰生物科技有限公司 | Method and system for detecting target nucleic acid based on CRISPR technology |
-
2020
- 2020-10-14 CN CN202011097291.2A patent/CN112176035A/en active Pending
- 2020-11-16 WO PCT/CN2020/129013 patent/WO2022077687A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020086908A1 (en) * | 2018-10-24 | 2020-04-30 | The Broad Institute, Inc. | Constructs for improved hdr-dependent genomic editing |
| WO2020102659A1 (en) * | 2018-11-15 | 2020-05-22 | The Broad Institute, Inc. | G-to-t base editors and uses thereof |
| CN111363763A (en) * | 2020-03-31 | 2020-07-03 | 海南大学 | Method for activating Cas14a enzyme collateral cleavage effect by RNA |
Non-Patent Citations (5)
| Title |
|---|
| DAVID F. SAVAGE: ""Cas14: Big Advances from Small CRISPR Proteins"", 《BIOCHEMISTRY》 * |
| GUILLERMO AQUINO-JARQUIN: ""CRISPR-Cas14 is now part of the artillery for gene editing and molecular diagnostic"", 《NANOMEDICINE: NANOTECHNOLOGY, BIOLOGY, AND MEDICINE》 * |
| LUCAS B. HARRINGTON等: ""Programmed DNA destruction by miniature CRISPR-Cas14 enzymes"", 《SCIENCE》 * |
| RASHID AMAN等: ""Nucleic Acid Detection Using CRISPR/Cas Biosensing Technologies"", 《ACS SYNTH. BIOL.》 * |
| 王雪亮等: ""CRISPR/Cas系统在分子检测中的应用"", 《检验医学》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112501359A (en) * | 2021-02-07 | 2021-03-16 | 吴江近岸蛋白质科技有限公司 | Primer group and kit for detecting novel coronavirus COVID-19 |
| CN112921119A (en) * | 2021-02-24 | 2021-06-08 | 复旦大学 | Primer group, kit and method for loop-mediated nicking isothermal-CRISPR (clustered regularly interspaced short palindromic repeats) combined detection of rift valley fever virus |
| CN112921119B (en) * | 2021-02-24 | 2024-01-23 | 复旦大学 | Primer group, kit and method for loop-mediated nicking isothermal-CRISPR (clustered regularly interspaced short palace surface plasmon resonance) combined detection of rift valley fever virus |
| CN114032340A (en) * | 2021-04-16 | 2022-02-11 | 杭州安誉科技有限公司 | Novel coronavirus nucleic acid detection kit |
| CN114032340B (en) * | 2021-04-16 | 2022-07-08 | 杭州安誉科技有限公司 | Novel coronavirus nucleic acid detection kit |
| CN115044649A (en) * | 2021-08-11 | 2022-09-13 | 山东舜丰生物科技有限公司 | Improved method for detecting target nucleic acid based on CRISPR technology |
| CN114196752A (en) * | 2021-12-08 | 2022-03-18 | 福州市讯刊生物科技有限公司 | miR-21 detection kit based on Cas14 and strand displacement amplification and application thereof |
| CN114196752B (en) * | 2021-12-08 | 2023-08-08 | 福州市讯刊生物科技有限公司 | miR-21 detection kit based on Cas14 and strand displacement amplification and application thereof |
| CN116622810A (en) * | 2023-01-10 | 2023-08-22 | 南华大学 | Novel engineering CRISPR-Cas14a1 detection system, method and application |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2022077687A1 (en) | 2022-04-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112176035A (en) | Novel CRISPR nucleic acid detection method and application | |
| US20210388425A1 (en) | Nicking and Extension Amplification Reaction for the Exponential Amplification of Nucleic Acids | |
| EP3074535B1 (en) | Rolling circle amplification method | |
| EP2382330B1 (en) | Cross priming amplification of target nucleic acids | |
| CN111560482B (en) | Detection method based on CRISPR/Cas and nucleic acid test paper and human papilloma virus detection kit | |
| CA2378408C (en) | Polynucleotide amplification method | |
| US11788119B2 (en) | Padlock probe detection method | |
| CN105821138B (en) | A kind of method that double loop-stem structure DNA profiling detection nucleic acid are built based on coupled reaction | |
| SU et al. | Transrenal DNA as a diagnostic tool: important technical notes | |
| JP2006504440A (en) | Improved method for making multiple RNA copies | |
| JP3789317B2 (en) | Isometric primer extension method and kit for detecting and quantifying specific nucleic acids | |
| JP2019509724A (en) | A method for direct target sequencing using nuclease protection | |
| CN116083575A (en) | Kit for detecting cervical cancer and application thereof | |
| US20070202522A1 (en) | Isothermal screening of tumor cell related nucleic acids | |
| CN112063759A (en) | RT-LAMP primer, kit and detection method for simultaneously detecting multiple viruses of banana | |
| CN101405407A (en) | Mitigation of Cot-1 DNA distortion in nucleic acid hybridization | |
| US9212398B2 (en) | Cross priming amplification of target nucleic acids | |
| WO2023170144A1 (en) | Method of detection of a target nucleic acid sequence | |
| CN117535383A (en) | Detection method based on nicking enzyme coupling rolling circle amplification and application thereof | |
| CN116606931A (en) | POCT system for directly detecting methylation genes and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 310051 floor 6, building 2, No. 611, Dongguan Road, Binjiang District, Hangzhou City, Zhejiang Province Applicant after: Hangzhou Yousida Biotechnology Co.,Ltd. Address before: Room 801-808, no.3766, South Ring Road, Binjiang District, Hangzhou City, Zhejiang Province, 310051 Applicant before: USTAR BIOTECHNOLOGIES (HANGZHOU) Co.,Ltd. |