CN115354044A - Application of rice RLK mutant in promoting plant growth or rice oil rotation - Google Patents

Abstract

The invention belongs to the technical field of agriculture, and particularly relates to application of an Osflr3 or Osflr11 rice mutant in promotion of plant growth or rice oil rotation. The Osflr3 or Osflr11 gene in the rice is edited at a fixed point through a CRISPR/Cas9 technology, the genetic stability is stronger after the Cas9 background is further removed through selfing, and the rice material is edited at the fixed point, so that the rice material has a good effect on the growth of rape.

Description

Application of rice RLK mutant in promoting plant growth or rice oil rotation

Technical Field

The invention belongs to the technical field of agriculture, and particularly relates to application of an Osflr3 or Osflr11 rice mutant in plant growth promotion or rice oil rotation.

Background

FERONIA (FER), an important member of the RLK subfamily Catharanthus roseus RLK1-like (CrRLK 1L), has been reported that FER mutation (FER 8) in Arabidopsis can enrich beneficial microbial flora (such as Pseudomonas fluorescens) to promote the growth of other plants, but Arabidopsis is inhibited due to FER mutation. FER module-mediated immunosuppression enables the formation of specific microbial flora to alleviate low phosphorus stress. Arabidopsis thaliana is disclosed to balance the immune response, flora composition and mineral uptake of plants through regulatory mechanisms under conditions of nutritional stress.

The safety of grain and oil is a big matter related to the national family and the long-term security, and the rice and oil tanker working system is an effective means for guaranteeing the safety of the national grain and oil. The root soil of rice is closely related to fertility, so the research on the root soil is the basis of increasing yield and increasing efficiency under the rice-oil tanker working system. Under the rice-oil rotation mode, the research on the physiological mechanism of rice oil rotation influenced by the efficient utilization of soil or crop nutrients regulated and controlled by rice root flora has been greatly developed, but the excellent gene resources of rice promoting the rice oil rotation are very deficient, and no relevant report is found. The method researches and utilizes the excellent gene resources of the rice for promoting the rotation of the rice oil to increase the yield of the rape, fully exerts the advantages of the cultivation of the rape and the grain increase, and brings basic guarantee for the safety of the grain and the oil in China.

Disclosure of Invention

The invention mainly solves the technical problems that: how to utilize gene engineering means to edit OsFLR3 or OsFLR11 gene influence to obtain rice mutant to participate in rice and oil tanker operation and increase grain yield.

The application of the Osflr3 or Osflr11 rice mutant in promoting plant growth is that the OsFLR3 gene is low-expressed or not expressed in the Osflr3 rice mutant respectively; the OsFLR11 gene is low or not expressed in the Osflr11 rice mutant.

Preferably, the nucleotide sequence of the OsFLR3 gene is shown as SEQ ID NO.1; the nucleotide sequence of the OsFLR11 gene is shown as SEQ ID NO. 2; the amino acid sequences coded by the OsFLR3 gene are respectively SEQ ID NO.3; the amino acid sequence coded by the OsFLR11 gene is shown in SEQ ID NO. 4.

Preferably, gene editing means are used to cause low or no expression of the OsFLR3 gene in said Osflr3 rice mutant; and low expression or no expression of the OsFLR11 gene in the Osflr11 rice mutant by using a gene editing means.

Preferably, the gene editing is site-directed editing of the Osflr3 or Osflr11 gene of rice by using CRISPR/Cas9 gene editing or interference technology.

Preferably, the specific method of the CRISPR/Cas9 gene editing technology is as follows: designing a sgRNA sequence based on CRISPR/Cas9 by taking a rice Osflr3 or Osflr11 gene as a target, connecting a DNA fragment containing the sgRNA into a CRISPR/Cas9 vector to transform rice, realizing the fixed-point editing of the rice OsFLR3 or OsFLR11 gene, and obtaining a rice variety with low expression or no expression of the OsFLR3 or OsFLR11 gene; the OsFLR3 or OsFLR11 site-specific editing region comprises a promoter, 5'-UTR, a coding region and 3' -UTR.

Preferably, the nucleotide sequence of sgRNA of the Osflr3 gene comprises one of SEQ ID NO 6-7; the nucleotide sequence of sgRNA of the Osflr11 gene comprises one of SEQ ID NO. 10-11.

Preferably, the plant is oilseed rape.

The application of Osflr3 or Osflr11 rice mutant in rice oil rotation, wherein the OsFLR3 gene is low expressed or not expressed in the Osflr3 rice mutant; the OsFLR11 gene is low or not expressed in the Osflr11 rice mutant.

Preferably, the method for obtaining the Osflr3 or Osflr11 rice mutant comprises the following steps: constructing a target expression vector by using a CRISPR/cas9 gene knockout system, transforming the expression vector into rice callus by adopting an agrobacterium-mediated method, and performing site-directed knockout on OsFLR3 or OsFLR11 gene to obtain an Osflr3 or Osflr11 rice mutant; the nucleotide sequence of the OsFLR3 gene is shown as SEQ ID NO.1; the nucleotide sequence of the OsFLR11 gene is shown as SEQ ID NO. 2; the amino acid sequences coded by the OsFLR3 gene are respectively SEQ ID NO.3; the amino acid sequence of the OsFLR11 gene code is shown in SEQ ID NO. 4.

The invention takes rice Osflr3 or Osflr11 gene as a target, designs a sgRNA sequence of CRISPR/Cas9, connects a DNA fragment containing the sgRNA into a CRISPR/Cas9 vector, then transforms rice, obtains an editing material of the rice Osflr3 or Osflr11 gene, and finds that root soil of the rice has obvious promotion effect on the growth of rape.

The inventor plants Osflr3 or Osflr11 mutant in earlier stage, and finds that the growth condition is similar to Nipponbare and is not obviously influenced. And planting the rape in Osflr3 or Osflr11 mutant root soil, and finding that the Osflr3 or Osflr11 mutant root soil promotes the growth of the rape in the vegetative stage. The rice receptor kinase Osflr3 or Osflr11 is a key factor influencing rice root system soil to participate in rice and oil rotation, and excellent rice gene resources promoting rice and oil rotation are obtained and applied.

Drawings

FIG. 1 is the sequencing analysis diagram of the editing sites in OsFLR3 knockout plants and control plants.

FIG. 2 is the sequencing analysis diagram of the editing sites in OsFLR11 knockout plants and control plants.

FIG. 3 is the vegetative growth observation of WT and rice Osflrs mutants.

FIG. 4 shows the root soil of WT and Osflr3 or Osflr11 mutant has the function of promoting the growth of rape.

FIG. 5 shows the recovery effect of Osflr3 or Osflr11 mutant root system soil on low-nutrition rape.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

1. Laboratory test

The rice ecotype is Nipponbare; the agrobacterium strain is EH105; vector pYLCRISPR/Cas9P _ubi -H; the main reagents comprise: restriction enzymes of Thermo Fisher bio, DNA polymerase of nuozu, infusion ligase, etc.; reverse transcription kit from Thermo corporation; RNA extraction kit of tiangen corporation; a plasmid extraction kit and a DNA recovery kit of Tiangen corporation; quantitative PCR reagents of Taraka corporation; MS culture medium, agarAntibiotics such as lipoid powder, agarose, ampicillin, kanamycin and rifampicin and the like are purchased from Sigma; the various other chemical reagents used in the examples were all imported or domestic analytical reagents; primer synthesis and sequencing were performed by the biotechnology limited of Beijing Optimus department.

The nucleotide sequence of the OsFLR3 gene is shown as SEQ ID NO.1; the nucleotide sequence of the OsFLR11 gene is shown as SEQ ID NO. 2; the amino acid sequences coded by the OsFLR3 gene are respectively SEQ ID NO.3; the amino acid sequence coded by the OsFLR11 gene is shown in SEQ ID NO. 4.

Firstly, logging in a website http:// skl.scau.edu.cn/, designing a primer according to a target site design principle, and finally selecting a sequence shown as SEQ ID NO.5 in an OsFLR3 gene as a target site of sgRNA: 5 'gccctcctatcgattgcca-3'; selecting a sequence shown as SEQ ID NO.9 in an OsFLR11 gene as a target spot of sgRNA: 5 'of organic silicon garcgctgaac cgcgcgccgag-3'. Designing a primer according to the target, and constructing a CRISPR/Cas9 target vector in the modes of PCR, enzyme digestion, connection and the like.

The sgRNA sequence is as follows:

OsFLR3-Y1+:cagtGGTCTCaggcgccctcctatcgattgcca(SEQ ID NO.6)

OsFLR3-Y1-:cagtGGTCTCaaaactggcaatcgataggagggc(SEQ ID NO.7)

OsFLR11-Y1+:cagtGGTCTCaggcgacgctgaaccgcgccgag(SEQ ID NO.10)

OsFLR11-Y1-:cagtGGTCTCaaaacctcggcgcggttcagcgtc(SEQ ID NO.11)

the vector was constructed as follows:

(1) Annealing: the annealing reaction of the primers is carried out according to the product specification (product number: D0251) of Shanghai Biyun biotechnology limited, and the reaction system: 5 × Annealing Buffer for DNA oligonucleotides 4 μ L, upstream and downstream primers 4 μ L each (50 μmol/. Mu.L), and Nuclear-free water to 20 μ L; reaction procedures are as follows: 95 deg.C for 5min, and decreasing by 0.1 deg.C every 8s to 25 deg.C; storing at 4 ℃;

(2) Carrier connection: connecting the DNA product obtained by annealing reaction to pYRCISPR/Cas 9P after Bsa I enzyme digestion _ubi -on an H support; a connection system: annealing DNA product 2. Mu.L, cutting pYLCRISPR/Cas9P _ubi -H-carrier 1.mu.L, 10 XT 4 DNA Ligase Buffer 1. Mu.L, T4 DNA Ligase (400U/. Mu.L) 0.5. Mu.L, sterile water to 10. Mu.L. Transforming DH5a competent cells by the ligation product, and screening positive clones; with the upstream primer: cagtGGTCTCgcctccctatcgattgcca (SEQ ID NO. 6) or cagtGGTCTCTCaggcgacgctgaaccgcgcgccgccgag (SEQ ID NO. 10); a downstream primer: vector universal primers: colony PCR was performed on plaques by atacgaagtttatgactgcgaccga (SEQ ID NO. 8); carrying out sequencing verification after detecting by 1% agarose gel electrophoresis; FIG. 1 is a sequencing analysis diagram of editing sites in OsFLR3 knockout plants and control plants. FIG. 2 sequencing analysis of the editing sites in OsFLR11 knockout plants and control plants.

(3) Transformation of expression vector agrobacterium and rice genetic transformation: the correct pYLCRISPR/Cas9P will be sequenced _ubi Transforming EH105 agrobacterium after extracting plasmids from the carrier H, screening and culturing on a YEB plate containing kanamycin and rifampicin resistance, selecting bacterial plaques to carry out colony PCR verification, carrying out propagation culture on positive bacterial liquid, centrifuging the bacterial liquid, resuspending the bacterial liquid by using an MS liquid culture medium, then impregnating rice callus by using the resuspension liquid, screening the infected callus in an MS solid culture medium containing NAA, 6-BA and hygromycin, and finally obtaining callus and positive plantlets through resistance screening; the gene edited plant is subjected to selfing and breeding to obtain a T1 generation for subsequent experiments, in order to prevent mutation from occurring again, the mutant can be picked out for selfing after sequencing, the Cas9 background is removed, and the mutant is named as Osflr3 or Osflr11 respectively.

Gene editing material root system soil collection test: the potting test of rice was carried out in a greenhouse of the subject group of the institute of biology, hunan university, and the rice planting soil was from the rice field of the lake university Cross research institute (113E, 28.21N). Soaking seeds of Nipponbare, osflr3 and Osflr11 mutant of rice in deionized water for 1d, sowing in a culture dish with wet filter paper, placing in a culture box at 37 ℃ for dark treatment, accelerating germination for 48h until the chest is broken and white, transplanting seedlings into the uniformly mixed and weighed soil, and growing for 6-7 weeks in a growth box with the photoperiod of 12h, illumination (28 ℃), 12h and dark (24 ℃). The overground parts of the plants of the first generation rice Nipponbare, osflr3 and Osflr11 mutants are cut off, the rest parts (including roots and soil) of the same genotype are completely mixed in a disinfection container, dried in the sun and put into a new clean pot (figure 3), and the growth of the Osflrs mutants is not obviously different from that of wild rice.

And (3) rape pot experiment: the cultivation of the potted test rape at the seedling stage was carried out in the group of subjects of the institute of biology of Hunan university in the light culture room. The temperature of the light culture chamber is set at 22 deg.C, the light period is 14h (light)/10 h (dark), and the light intensity is 300-320 μmol/m ² And/s, humidity of 60-75%. Selecting rape seeds with consistent sizes, and sterilizing for 10min by using 1% NaClO; washing seed surface, sterilizing ultrapure water at 4 ℃: (>18.25M Ω) for 24h. Uniformly sowing the soaked seeds on gauze fixed on the surface of the plastic seedling raising tray, and adding a proper amount of ultrapure water into the seedling raising tray. And after 3d of seedling raising, transplanting the seedlings with consistent growth vigor into pots filled with rice root soil with different genotypes. And carrying out autoclaved water watering on the rape seedlings. Different materials are placed side by side in the same growth chamber, and the growth index change of the rape in the vegetative stage is observed (figure 4). Screening finds that the Osflr3 mutant root soil has more remarkable promotion effect on the growth of the rapes. The rice receptor kinase Osflr3 or Osflr11 is a key potential factor influencing rice oil rotation.

Rape low-nutrition treatment test: the method is used for sterilizing and raising the seedlings of the rape seeds. And transplanting the seedlings with consistent growth vigor onto perlite after 3 days of seedling culture. The perlite is disinfected, cleaned and sieved by dilute hydrochloric acid, and 2kg of perlite is weighed in each pot. The pot experiment set 2 nutrient levels: in the absence of macroelements and normal, 5 biological replicates were set per genotype material per level of treatment. The rape growth phenotype is observed by daily watering with ultrapure water (> 18.25M omega). The test of recovering the low-nutrition growth of the rape by the rice root system soil comprises the following steps: planting the first generation rice Nipponbare, osflrs3 and Osflrs11 mutants in uniformly mixed and weighed soil for 6-7 weeks, pulling out rice plants, collecting root system soil (including root systems), grinding, irrigating rape seedlings planted on low-nutrition perlite, and observing whether the growth indexes of the rape in the vegetative stage are recovered. The result is shown in figure 5, and the result shows that the root system soil recovery capability is obviously enhanced by using Osflr3 or Osflr11, the plant height and root length of the rape in the vegetative period are obviously prolonged, and the fresh weight is obviously increased. The rice receptor kinase Osflr3 or Osflr11 root system soil is explained to promote the growth of the rape under the low nutrition stress.

Sequence listing

<110> university of Hunan

Application of rice RLK mutant in promoting plant growth or rice oil rotation

<141> 2022-06-22

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2646

<212> DNA

<213> Oryza sativa

<400> 1

atgatgcacc caagcctact agctaccatc caatggctca cactgtcagc cctcctatcg 60

attgccatgg cggctgataa caattccacg gcctctgctc caatctttct gaattgtgga 120

gcctctggtg tgcaacctga tagctacaat cggagctggg atggggatgc tagctccaag 180

tttgcgccat cggtgaaagg caatgtagcc agggcttcat accaagaccc ttcgctccca 240

tcacccgtgc cttacatgac tgctcgattc ttcacttcaa attacaccta ttccttccct 300

gtcagcccag gccgcatgtt cgtgcgccta cacttctatc caactaatta taatgggaac 360

cttgattctg caaatgccta ctttggtgtc acaaccaaca atctgatcct tttagacaac 420

ttcaacgcat cacaaactgc tctggcaaca agctctgcct acttctttcg agaattctcg 480

gttaatgtca cttcaagcag cctaaaactc acctttgccc cgtccacacg aaacgggtct 540

tatgcatttg tgaatgggat tgagattgtg cccacgcctg acatcttcac aacaccgaca 600

cctacatctg ccaatggcgg ggacaatgtg caatatggca tagatcctgt gatgggtctc 660

caaacgatgt accggctcaa tgttggggga cagcccatct ctccgcaagg tgattctgga 720

ttctatcgtt cttgggataa tgattctcct tacatatatg gtgctgccta tggggtgacc 780

ttctccaaag atggtaatgt caccatcaaa tatccaaata ctgagccaaa ttacactgca 840

ccagttgcag tctacgcaac agcaaggtca atggggccaa ctgcacagat caacctgaac 900

tacaatctta catggatctt accggttgat gcggggttca cctacctctt gaggttccat 960

ttctgtgaga tccagtatcc aataaccaag gtgaatcaga gatcattttt catttacatc 1020

aacaaccaga cggcgcagaa tcaaatggac gtcattgttt ggagtggagg aattggcaga 1080

acaacatata ccaactatgt tgtcacaacg gttggttctg gccagacgga cctgtgggtc 1140

gcgcttcacc ctgatctttc aagcaaacca gagtattttg atgcaatact aaatggcctt 1200

gaggtcttca agctacagga ccttggaaga aataaccttg ctgggctcaa ccctccactt 1260

ccaccaaagc ctggtgtgaa tcccaatggg ggatctagta gaggtaaatc aaagagtgtt 1320

gccccagcag ccataggtgg agcagtgggt ggccttgccg tgttgttgat tgcttgtgtt 1380

ggattgtgca tcatctgtag acgaaagaag aaggtagcaa aggatactgg caaatctgat 1440

gaaggacgct ggactcctct cactgatttc accaagtcac agtcagccac ctcaggaaag 1500

acaaccaaca cagggagcca ctcgatgctg ccagccaatc tttgccggca cttttcgttt 1560

gcagaaatcc aggctgccac caacaatttc gacaaatcct tcctcctcgg caaaggtgga 1620

tttggcaacg tttaccttgg agagatagac agtggcacta gagttgcaat caagcgtggg 1680

aacccgctgt ctgagcaggg tgtccatgag ttccagaatg agattgagat gctgtccaag 1740

ctccgacacc gtcaccttgt gtctctaatc gggtactgcg aggataggaa tgagatgatt 1800

ttggtatatg actacatggc tcatgggaca cttcgagaac acttgtacaa caccaagaac 1860

ccaccattgt cgtggaagca gaggctggag atctgcatcg gcgccgcccg tgggctgtat 1920

tacctgcaca cgggtgcaaa gcaaaccatc atccaccgcg atgtcaagac caccaacatt 1980

ttgctggatg acaagtgggt tgccaaggtt tccgacttcg ggctgtccaa ggccggtcca 2040

aacgtggaca acacccatgt gagcacagtg gtgaagggca gcttcggata ccttgatcct 2100

gagtacttcc gacggcagca gcttaccgag aaatctgatg tctactcctt cggagttgtg 2160

ctgttcgagg tcctgtgcgc ccgcaacgcc ctgagcccat cacttccgaa ggagcaagtg 2220

agccttgcag actgggctct gcgttgccag aagaaaggtg ttcttggcga gatcattgac 2280

ccactcctca aagggaagat cgctccccag tgcttcttga agttcgccga gaccgcggag 2340

aaatgtgtgg ccgatcgcag cgtcgacagg ccgtccatgg gtgatgtgct ctggaacctc 2400

gagtttgcgc tccagctgca ggagagcacg gaggacagta gcagcctgac cgaggggacg 2460

tcagcgagca cgtcgccgct ggttgtggcc aggctgcatt cagatgagcc gtcgaccgac 2520

gtgactacta ccactacaac gacaacttct ttgagcatca ctgaccgtag cattgcgagc 2580

gtggagtctg atgggctgac cccaagcaac atcttctccc agctcatgac accagatgga 2640

agatga 2646

<210> 2

<211> 2535

<212> DNA

<213> Oryza sativa

<400> 2

atggctgcga tcgttttgct gctcttcctt gtcgtgggct tgatgccggt ttccaatggg 60

cagacgacgc ccttctcccc gcgattctcc gtctacctcg cgtgcggcgc cggcgggaac 120

gtcgtcgtga cgtcggactc gccgcagcgg actttcgtcc cggacgacgg cgagctgtcc 180

gggaagtccg cgaggttcag caaccccgac gcgagcccgc cgtcccctct ctacgccgcg 240

gcgcgcgcgg ggacgagcgg cttctcgtac cggctcagct acgctgccga cgcggcgccc 300

gacggcaaca ccacgctcgt cctccgcctc cacttcttcc ccttcgcgtc gcagtccggc 360

gacctcctct cggcgcggtt cagcgtctcg gccatgggga ggtacgtcct cctgcctcct 420

tccttctcgc cgccgcgcgc cggcgtggtg agggagttcc tcctcccgtc cgatggctcc 480

ggcgagttcg acgtcgcctt cacgcccgaa tcaggggggc tcgccttcgt caacgccatc 540

gagctgttcc ccgcgccgca ggagcttctg tggaagttcc ccctgacggc ggtcaacacc 600

gacgtctcgc cgtcgcatca ggcgctggag acgctgtacc ggctcaacgt cggcgggcca 660

acggtgacgc cgacgggcga caccatgtgg cgaacatggc tccccgacga ctcctacctc 720

tccccggcga cggtctcggc ggtggccagc atccagggcc agatcatctt cgaccgggcg 780

cagggctaca cgcagatggt cgcgccggac gccgtgtaca agtcgcagcg cacgacgaac 840

tcgaccacgt cgaacgtgac atggacgttc gccgtcgacg gcaacagcag ctacgtcgtc 900

cgcctccact tctgcgcctt cgaggagctc agctccgtca tcggagaagg cgtcgatttc 960

aatgtttatc tgatgcaagc catgggtacc cgggaattga aggccaagga ctacgcgacg 1020

ctgagcagtc cgacccaagc tttctacatg gactatgtcg ccgtggtccc gaccgccggc 1080

gagaacctca cggtgagcat cggcagggcg gcgagcagcg acagcaagaa ggcgatactg 1140

aacgggctgg agatcatgaa gctcagagcc gttgatatga ctccggcgag ctcgtccggc 1200

aagacgagca aggtcgtcgt cgtagccgtg accgcggcgg tgctcggcgc ggcggttcta 1260

gcaggtgtgg cattgtgcgt actgcttgtg cggcggagac agcggcgggc gacgctgcct 1320

gtgccggagg aggaggagaa ggagagcgtg gggacgccgt ggtcgccgtt cacgccggac 1380

ggcgagggct cgttcggcag cgccgtggtc acgccgcgga ggatgaacat gaagctccac 1440

atcccgctcg ccgagatcat ggtggcgacg ggggacttcg acgacgcaaa catcctcggc 1500

gtcggcgggt tcgggaacgt gtaccgcggc gtgctccgcg acggcacccg cgtcgccgtg 1560

aagcgcgcca agcgcgcgtc caggcagggg ttcccggagt tccagactga gatcctggtg 1620

ctctccagca tccgccaccg ccacctcgtc tcgctcatcg gctactgcaa cgagcggtcg 1680

gagatgatcc tcgtgtacga gctcatggcg cacggcaccc tgaggagcca cctgtacggc 1740

tccgacgccg cggcggcgac gccgccgccg ctgtcgtgga agcagcggct ggagatctgc 1800

atcggcgcgg cgaaggggct ccactacctg cacaccggcc actccgataa catcatccac 1860

cgcgacgtca agtcgacgaa catcctcctc ggcgacggct tcgtggcgaa ggtggccgac 1920

ttcgggctgt cccgcgtcgg gccatcgacg gggcagacgc acgtgagcac ggcggtgaag 1980

ggcagcttcg gctacctcga cccggagtac ttcaagacgc ggcagctcac cgaccgctcc 2040

gacgtctact ccttcggcgt cgtcctcttc gaggtgctgt gcgcgcggcc ggcgatcgac 2100

cagagcctcc cgcccgacga gatcaacctc gcggagtggg cgatgcagtg gagccggagg 2160

ggccggttcg acaagatcgt cgacccggcc gtcgccggcg acgccagcac gaactcgctc 2220

cggaagttcg cggagaccgc cgggaggtgc ctcgcggact acggcgagca gcggccgtcc 2280

atgggcgacg tggtgtggaa cctcgagtac tgcctccagc tgcaggagag ccagccgagc 2340

accgagacgg cgctggactt ggacgacagc ggcgcgcacc tgccacggga catcgtcgtg 2400

gcgaggcgag tggcgccgct cgcgcccgat gcttcggcgg acgccgccgg agacgacatg 2460

agctggtcgg agacggcgag cttcacggcg acgggcaacg tgttctcgca gattatgtcc 2520

cgcgatggta gatga 2535

<210> 3

<211> 881

<212> PRT

<213> Oryza sativa

<400> 3

Met Met His Pro Ser Leu Leu Ala Thr Ile Gln Trp Leu Thr Leu Ser

1 5 10 15

Ala Leu Leu Ser Ile Ala Met Ala Ala Asp Asn Asn Ser Thr Ala Ser

20 25 30

Ala Pro Ile Phe Leu Asn Cys Gly Ala Ser Gly Val Gln Pro Asp Ser

35 40 45

Tyr Asn Arg Ser Trp Asp Gly Asp Ala Ser Ser Lys Phe Ala Pro Ser

50 55 60

Val Lys Gly Asn Val Ala Arg Ala Ser Tyr Gln Asp Pro Ser Leu Pro

65 70 75 80

Ser Pro Val Pro Tyr Met Thr Ala Arg Phe Phe Thr Ser Asn Tyr Thr

85 90 95

Tyr Ser Phe Pro Val Ser Pro Gly Arg Met Phe Val Arg Leu His Phe

100 105 110

Tyr Pro Thr Asn Tyr Asn Gly Asn Leu Asp Ser Ala Asn Ala Tyr Phe

115 120 125

Gly Val Thr Thr Asn Asn Leu Ile Leu Leu Asp Asn Phe Asn Ala Ser

130 135 140

Gln Thr Ala Leu Ala Thr Ser Ser Ala Tyr Phe Phe Arg Glu Phe Ser

145 150 155 160

Val Asn Val Thr Ser Ser Ser Leu Lys Leu Thr Phe Ala Pro Ser Thr

165 170 175

Arg Asn Gly Ser Tyr Ala Phe Val Asn Gly Ile Glu Ile Val Pro Thr

180 185 190

Pro Asp Ile Phe Thr Thr Pro Thr Pro Thr Ser Ala Asn Gly Gly Asp

195 200 205

Asn Val Gln Tyr Gly Ile Asp Pro Val Met Gly Leu Gln Thr Met Tyr

210 215 220

Arg Leu Asn Val Gly Gly Gln Pro Ile Ser Pro Gln Gly Asp Ser Gly

225 230 235 240

Phe Tyr Arg Ser Trp Asp Asn Asp Ser Pro Tyr Ile Tyr Gly Ala Ala

245 250 255

Tyr Gly Val Thr Phe Ser Lys Asp Gly Asn Val Thr Ile Lys Tyr Pro

260 265 270

Asn Thr Glu Pro Asn Tyr Thr Ala Pro Val Ala Val Tyr Ala Thr Ala

275 280 285

Arg Ser Met Gly Pro Thr Ala Gln Ile Asn Leu Asn Tyr Asn Leu Thr

290 295 300

Trp Ile Leu Pro Val Asp Ala Gly Phe Thr Tyr Leu Leu Arg Phe His

305 310 315 320

Phe Cys Glu Ile Gln Tyr Pro Ile Thr Lys Val Asn Gln Arg Ser Phe

325 330 335

Phe Ile Tyr Ile Asn Asn Gln Thr Ala Gln Asn Gln Met Asp Val Ile

340 345 350

Val Trp Ser Gly Gly Ile Gly Arg Thr Thr Tyr Thr Asn Tyr Val Val

355 360 365

Thr Thr Val Gly Ser Gly Gln Thr Asp Leu Trp Val Ala Leu His Pro

370 375 380

Asp Leu Ser Ser Lys Pro Glu Tyr Phe Asp Ala Ile Leu Asn Gly Leu

385 390 395 400

Glu Val Phe Lys Leu Gln Asp Leu Gly Arg Asn Asn Leu Ala Gly Leu

405 410 415

Asn Pro Pro Leu Pro Pro Lys Pro Gly Val Asn Pro Asn Gly Gly Ser

420 425 430

Ser Arg Gly Lys Ser Lys Ser Val Ala Pro Ala Ala Ile Gly Gly Ala

435 440 445

Val Gly Gly Leu Ala Val Leu Leu Ile Ala Cys Val Gly Leu Cys Ile

450 455 460

Ile Cys Arg Arg Lys Lys Lys Val Ala Lys Asp Thr Gly Lys Ser Asp

465 470 475 480

Glu Gly Arg Trp Thr Pro Leu Thr Asp Phe Thr Lys Ser Gln Ser Ala

485 490 495

Thr Ser Gly Lys Thr Thr Asn Thr Gly Ser His Ser Met Leu Pro Ala

500 505 510

Asn Leu Cys Arg His Phe Ser Phe Ala Glu Ile Gln Ala Ala Thr Asn

515 520 525

Asn Phe Asp Lys Ser Phe Leu Leu Gly Lys Gly Gly Phe Gly Asn Val

530 535 540

Tyr Leu Gly Glu Ile Asp Ser Gly Thr Arg Val Ala Ile Lys Arg Gly

545 550 555 560

Asn Pro Leu Ser Glu Gln Gly Val His Glu Phe Gln Asn Glu Ile Glu

565 570 575

Met Leu Ser Lys Leu Arg His Arg His Leu Val Ser Leu Ile Gly Tyr

580 585 590

Cys Glu Asp Arg Asn Glu Met Ile Leu Val Tyr Asp Tyr Met Ala His

595 600 605

Gly Thr Leu Arg Glu His Leu Tyr Asn Thr Lys Asn Pro Pro Leu Ser

610 615 620

Trp Lys Gln Arg Leu Glu Ile Cys Ile Gly Ala Ala Arg Gly Leu Tyr

625 630 635 640

Tyr Leu His Thr Gly Ala Lys Gln Thr Ile Ile His Arg Asp Val Lys

645 650 655

Thr Thr Asn Ile Leu Leu Asp Asp Lys Trp Val Ala Lys Val Ser Asp

660 665 670

Phe Gly Leu Ser Lys Ala Gly Pro Asn Val Asp Asn Thr His Val Ser

675 680 685

Thr Val Val Lys Gly Ser Phe Gly Tyr Leu Asp Pro Glu Tyr Phe Arg

690 695 700

Arg Gln Gln Leu Thr Glu Lys Ser Asp Val Tyr Ser Phe Gly Val Val

705 710 715 720

Leu Phe Glu Val Leu Cys Ala Arg Asn Ala Leu Ser Pro Ser Leu Pro

725 730 735

Lys Glu Gln Val Ser Leu Ala Asp Trp Ala Leu Arg Cys Gln Lys Lys

740 745 750

Gly Val Leu Gly Glu Ile Ile Asp Pro Leu Leu Lys Gly Lys Ile Ala

755 760 765

Pro Gln Cys Phe Leu Lys Phe Ala Glu Thr Ala Glu Lys Cys Val Ala

770 775 780

Asp Arg Ser Val Asp Arg Pro Ser Met Gly Asp Val Leu Trp Asn Leu

785 790 795 800

Glu Phe Ala Leu Gln Leu Gln Glu Ser Thr Glu Asp Ser Ser Ser Leu

805 810 815

Thr Glu Gly Thr Ser Ala Ser Thr Ser Pro Leu Val Val Ala Arg Leu

820 825 830

His Ser Asp Glu Pro Ser Thr Asp Val Thr Thr Thr Thr Thr Thr Thr

835 840 845

Thr Ser Leu Ser Ile Thr Asp Arg Ser Ile Ala Ser Val Glu Ser Asp

850 855 860

Gly Leu Thr Pro Ser Asn Ile Phe Ser Gln Leu Met Thr Pro Asp Gly

865 870 875 880

Arg

<210> 4

<211> 844

<212> PRT

<213> Oryza sativa

<400> 4

Met Ala Ala Ile Val Leu Leu Leu Phe Leu Val Val Gly Leu Met Pro

1 5 10 15

Val Ser Asn Gly Gln Thr Thr Pro Phe Ser Pro Arg Phe Ser Val Tyr

20 25 30

Leu Ala Cys Gly Ala Gly Gly Asn Val Val Val Thr Ser Asp Ser Pro

35 40 45

Gln Arg Thr Phe Val Pro Asp Asp Gly Glu Leu Ser Gly Lys Ser Ala

50 55 60

Arg Phe Ser Asn Pro Asp Ala Ser Pro Pro Ser Pro Leu Tyr Ala Ala

65 70 75 80

Ala Arg Ala Gly Thr Ser Gly Phe Ser Tyr Arg Leu Ser Tyr Ala Ala

85 90 95

Asp Ala Ala Pro Asp Gly Asn Thr Thr Leu Val Leu Arg Leu His Phe

100 105 110

Phe Pro Phe Ala Ser Gln Ser Gly Asp Leu Leu Ser Ala Arg Phe Ser

115 120 125

Val Ser Ala Met Gly Arg Tyr Val Leu Leu Pro Pro Ser Phe Ser Pro

130 135 140

Pro Arg Ala Gly Val Val Arg Glu Phe Leu Leu Pro Ser Asp Gly Ser

145 150 155 160

Gly Glu Phe Asp Val Ala Phe Thr Pro Glu Ser Gly Gly Leu Ala Phe

165 170 175

Val Asn Ala Ile Glu Leu Phe Pro Ala Pro Gln Glu Leu Leu Trp Lys

180 185 190

Phe Pro Leu Thr Ala Val Asn Thr Asp Val Ser Pro Ser His Gln Ala

195 200 205

Leu Glu Thr Leu Tyr Arg Leu Asn Val Gly Gly Pro Thr Val Thr Pro

210 215 220

Thr Gly Asp Thr Met Trp Arg Thr Trp Leu Pro Asp Asp Ser Tyr Leu

225 230 235 240

Ser Pro Ala Thr Val Ser Ala Val Ala Ser Ile Gln Gly Gln Ile Ile

245 250 255

Phe Asp Arg Ala Gln Gly Tyr Thr Gln Met Val Ala Pro Asp Ala Val

260 265 270

Tyr Lys Ser Gln Arg Thr Thr Asn Ser Thr Thr Ser Asn Val Thr Trp

275 280 285

Thr Phe Ala Val Asp Gly Asn Ser Ser Tyr Val Val Arg Leu His Phe

290 295 300

Cys Ala Phe Glu Glu Leu Ser Ser Val Ile Gly Glu Gly Val Asp Phe

305 310 315 320

Asn Val Tyr Leu Met Gln Ala Met Gly Thr Arg Glu Leu Lys Ala Lys

325 330 335

Asp Tyr Ala Thr Leu Ser Ser Pro Thr Gln Ala Phe Tyr Met Asp Tyr

340 345 350

Val Ala Val Val Pro Thr Ala Gly Glu Asn Leu Thr Val Ser Ile Gly

355 360 365

Arg Ala Ala Ser Ser Asp Ser Lys Lys Ala Ile Leu Asn Gly Leu Glu

370 375 380

Ile Met Lys Leu Arg Ala Val Asp Met Thr Pro Ala Ser Ser Ser Gly

385 390 395 400

Lys Thr Ser Lys Val Val Val Val Ala Val Thr Ala Ala Val Leu Gly

405 410 415

Ala Ala Val Leu Ala Gly Val Ala Leu Cys Val Leu Leu Val Arg Arg

420 425 430

Arg Gln Arg Arg Ala Thr Leu Pro Val Pro Glu Glu Glu Glu Lys Glu

435 440 445

Ser Val Gly Thr Pro Trp Ser Pro Phe Thr Pro Asp Gly Glu Gly Ser

450 455 460

Phe Gly Ser Ala Val Val Thr Pro Arg Arg Met Asn Met Lys Leu His

465 470 475 480

Ile Pro Leu Ala Glu Ile Met Val Ala Thr Gly Asp Phe Asp Asp Ala

485 490 495

Asn Ile Leu Gly Val Gly Gly Phe Gly Asn Val Tyr Arg Gly Val Leu

500 505 510

Arg Asp Gly Thr Arg Val Ala Val Lys Arg Ala Lys Arg Ala Ser Arg

515 520 525

Gln Gly Phe Pro Glu Phe Gln Thr Glu Ile Leu Val Leu Ser Ser Ile

530 535 540

Arg His Arg His Leu Val Ser Leu Ile Gly Tyr Cys Asn Glu Arg Ser

545 550 555 560

Glu Met Ile Leu Val Tyr Glu Leu Met Ala His Gly Thr Leu Arg Ser

565 570 575

His Leu Tyr Gly Ser Asp Ala Ala Ala Ala Thr Pro Pro Pro Leu Ser

580 585 590

Trp Lys Gln Arg Leu Glu Ile Cys Ile Gly Ala Ala Lys Gly Leu His

595 600 605

Tyr Leu His Thr Gly His Ser Asp Asn Ile Ile His Arg Asp Val Lys

610 615 620

Ser Thr Asn Ile Leu Leu Gly Asp Gly Phe Val Ala Lys Val Ala Asp

625 630 635 640

Phe Gly Leu Ser Arg Val Gly Pro Ser Thr Gly Gln Thr His Val Ser

645 650 655

Thr Ala Val Lys Gly Ser Phe Gly Tyr Leu Asp Pro Glu Tyr Phe Lys

660 665 670

Thr Arg Gln Leu Thr Asp Arg Ser Asp Val Tyr Ser Phe Gly Val Val

675 680 685

Leu Phe Glu Val Leu Cys Ala Arg Pro Ala Ile Asp Gln Ser Leu Pro

690 695 700

Pro Asp Glu Ile Asn Leu Ala Glu Trp Ala Met Gln Trp Ser Arg Arg

705 710 715 720

Gly Arg Phe Asp Lys Ile Val Asp Pro Ala Val Ala Gly Asp Ala Ser

725 730 735

Thr Asn Ser Leu Arg Lys Phe Ala Glu Thr Ala Gly Arg Cys Leu Ala

740 745 750

Asp Tyr Gly Glu Gln Arg Pro Ser Met Gly Asp Val Val Trp Asn Leu

755 760 765

Glu Tyr Cys Leu Gln Leu Gln Glu Ser Gln Pro Ser Thr Glu Thr Ala

770 775 780

Leu Asp Leu Asp Asp Ser Gly Ala His Leu Pro Arg Asp Ile Val Val

785 790 795 800

Ala Arg Arg Val Ala Pro Leu Ala Pro Asp Ala Ser Ala Asp Ala Ala

805 810 815

Gly Asp Asp Met Ser Trp Ser Glu Thr Ala Ser Phe Thr Ala Thr Gly

820 825 830

Asn Val Phe Ser Gln Ile Met Ser Arg Asp Gly Arg

835 840

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

gccctcctat cgattgcca 19

<210> 6

<211> 33

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

cagtggtctc aggcgccctc ctatcgattg cca 33

<210> 7

<211> 34

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

cagtggtctc aaaactggca atcgatagga gggc 34

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

atacgaagtt atgactgcga ccga 24

<210> 9

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

gacgctgaac cgcgccgag 19

<210> 10

<211> 33

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

cagtggtctc aggcgacgct gaaccgcgcc gag 33

<210> 11

<211> 34

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

cagtggtctc aaaacctcgg cgcggttcag cgtc 34

Claims (8)

1. The application of Osflr3 or Osflr11 rice mutant in promoting plant growth is characterized in that the OsFLR3 gene is low expressed or not expressed in the Osflr3 rice mutant respectively; the OsFLR11 gene is low or not expressed in the Osflr11 rice mutant.
2. 2. The use according to claim 1, wherein the nucleotide sequence of the OsFLR3 gene is as shown in SEQ ID No.1; the nucleotide sequence of the OsFLR11 gene is shown as SEQ ID NO. 2; the amino acid sequences coded by the OsFLR3 gene are respectively SEQ ID NO.3; the amino acid sequence of the OsFLR11 gene code is shown in SEQ ID NO. 4.
3. 3. The use according to claim 2, wherein gene editing means is used to cause low or no expression of the OsFLR3 gene in said Osflr3 rice mutant; and low expression or no expression of the OsFLR11 gene in the Osflr11 rice mutant by using a gene editing means.
4. 4. The use of claim 3, wherein the gene editing is site-directed editing of rice Osflr3 or Osflr11 gene by using CRISPR/Cas9 gene editing or interference technology.
5. 5. The application of claim 4, wherein the CRISPR/Cas9 gene editing technology is realized by the following specific method: designing a sgRNA sequence based on CRISPR/Cas9 by taking a rice Osflr3 or Osflr11 gene as a target, connecting a DNA fragment containing the sgRNA into a CRISPR/Cas9 vector to transform rice, realizing the fixed-point editing of the rice OsFLR3 or OsFLR11 gene, and obtaining a rice variety with low expression or no expression of the OsFLR3 or OsFLR11 gene; the OsFLR3 or OsFLR11 site-specific editing region comprises a promoter, a 5'-UTR, a coding region and a 3' -UTR.
6. 6. The use of claim 5, wherein the nucleotide sequence of sgRNA of Osflr3 gene comprises one of SEQ ID NO 6-7; the nucleotide sequence of sgRNA of the Osflr11 gene comprises one of SEQ ID NO. 10-11.
7. 7. The use according to any one of claims 1 to 6, wherein said plant is oilseed rape.
8. The application of Osflr3 or Osflr11 rice mutant in rice oil rotation is characterized in that the OsFLR3 gene is low expressed or not expressed in the Osflr3 rice mutant; the OsFLR11 gene is low or not expressed in the Osflr11 rice mutant.

Images