CN115323075A - RT-RAA primer probe set and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe set and kit - Google Patents
RT-RAA primer probe set and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe set and kit Download PDFInfo
- Publication number
- CN115323075A CN115323075A CN202210778469.2A CN202210778469A CN115323075A CN 115323075 A CN115323075 A CN 115323075A CN 202210778469 A CN202210778469 A CN 202210778469A CN 115323075 A CN115323075 A CN 115323075A
- Authority
- CN
- China
- Prior art keywords
- primer
- infectious bronchitis
- primer probe
- positive
- type
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an RT-RAA primer probe group for detecting infectious bronchitis viruses and genotyping of chicken, a kit and application thereof, and belongs to the technical field of molecular biology. The RT-RAA primer probe group provided By the invention comprises at least one group of a Vi primer probe group and a By primer probe group; wherein the nucleotide sequences of the positive primer, the reverse primer and the Vi probe of the Vi primer probe set are respectively shown as SEQ ID NO. 1-3; the nucleotide sequences of the positive primer, the reverse primer and the By probe of the By primer in the By primer probe group are respectively shown as SEQ ID NO. 4-6. The Vi primer pair provided By the invention can be used for specifically detecting the CH I-CH V type or Mass type avian infectious bronchitis viruses, and the By primer pair can be used for specifically detecting the CH VI avian infectious bronchitis viruses, and has the advantages of short detection time and strong specificity.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to an RT-RAA primer probe set for detecting infectious bronchitis viruses and genotyping of chicken, a kit and application of the RT-RAA primer probe set.
Background
Infectious Bronchitis (IB) is an acute, highly contagious respiratory Infectious disease caused by Infectious Bronchitis Virus (IBV). IBV is a member of the avian coronavirus genus Y-coronavirus (gammacoronaravirus) and is characterized by respiratory symptoms, nephritis and reduced productivity following infection. The S1 protein is a main immunogen protein of IBV, can mediate cell fusion, and stimulates an organism to generate a virus neutralizing antibody and a hemagglutination inhibition antibody; the S1 protein gene has stronger type specificity, but is easy to be mutated, so that new serotypes of IBV continuously appear. The vaccine is a main means for preventing and controlling IBV in China, but IBV genomes are easy to mutate, so that genotypes, serotypes, pathogenicity and immunogenicity are diversified, and the cross protection effect of the vaccine is not ideal between strains facing different genotypes or serotypes.
At present, IBV detection aiming at different genotypes mainly adopts a PCR method to detect and send the IBV to a biological company for sequencing, and the sequencing result is analyzed to draw a conclusion, wherein the process needs 2 to 3 days. Under the IBV epidemic situation prevention and control measures which compete for seconds, the method takes too long. The current IBV isolate S1 gene includes 7 genotypes: the CH I type-CH VI type and the Mass type can quickly determine the S1 gene typing, further quickly distinguish the epidemic trend of the IBV, and can provide a quick diagnosis means for the development of biological products such as vaccines and the like and epidemic prevention and control measures.
Disclosure of Invention
In view of this, the invention aims to provide an RAA primer probe set capable of detecting infectious bronchitis viruses and typing genes of the viruses, and the primer probe set provided by the invention is used for detecting infectious bronchitis viruses and typing genes, and has the advantages of simple detection method, high sensitivity, no need of expensive instruments and equipment, short detection time, and suitability for large-scale popularization and application.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides an RT-RAA primer probe group for detecting infectious bronchitis viruses of chickens, which comprises at least one group of a Vi primer probe group and a By primer probe group; the nucleotide sequence of the positive primer and the negative primer of the Vi primer in the Vi primer probe group is shown as SEQ ID NO.1-2, and the nucleotide sequence of the Vi probe is shown as SEQ ID NO. 3; the nucleotide sequence of the positive primer and the negative primer of the By primer in the By primer probe group is shown as SEQ ID NO.4-5, and the nucleotide sequence of the By probe is shown as SEQ ID NO. 6.
The invention also provides application of the primer probe set in preparation of products for detecting the avian infectious bronchitis viruses.
The invention also provides application of the primer probe group in preparation of chicken infectious bronchitis virus genotyping products.
The invention also provides a method for detecting the avian infectious bronchitis virus without diagnosis, which comprises the following steps: extracting RNA of a sample to be detected, taking the RNA of the sample to be detected as a template, carrying out RT-RAA reaction by using the primer probe set of claim 1, wherein if a fluorescence amplification curve appears, the peak time is less than or equal to 20min or the Ct value is less than or equal to 30, the sample to be detected is positive by the avian infectious bronchitis virus, and if no fluorescence amplification curve appears, the peak time is more than 20min or the Ct value is more than 39, the sample to be detected is negative by the avian infectious bronchitis virus.
Preferably, when the Vi primer probe set is used for RT-RAA reaction, if the result is positive, the sample to be detected is the infectious bronchitis virus of CH I type-CH V type or Mass type; when the By primer probe group is adopted to carry out RT-RAA reaction, if the result is positive, the sample to be detected is the CH VI type avian infectious bronchitis virus.
Preferably, when the two groups of primer probe sets are used for RT-RAA reaction, if the results of the two groups of primer probe sets are positive, the sample to be detected is the infectious bronchitis virus CH I-CH VI or Mass; if the result of the Vi primer probe group is positive and the result of the By primer probe group is negative, the sample to be detected is the infectious bronchitis virus of CH I-CH V type or Mass type; if the result of the By primer probe group is positive and the result of the Vi primer probe group is negative, the sample to be detected is the CH VI type avian infectious bronchitis virus; and if the results of the two groups of primer probe sets are negative, the sample to be detected is negative to the avian infectious bronchitis virus.
Preferably, the procedure of the RT-RAA reaction is: 60s at 40 ℃; 30s at 40 ℃ for 40 cycles.
The invention also provides a kit for detecting the infectious bronchitis virus or the genetic typing of the infectious bronchitis virus, and the kit comprises the primer probe group.
Preferably, the concentration proportion relationship of the primers and the probes in the kit is 1, the volume ratio of the Vi primer to the By primer is 1:1-2, and the volume ratio of the Vi probe to the By probe is 2:3.
Preferably, the kit further comprises a positive control substance and a negative control substance, wherein the positive control substance comprises nucleic acids with nucleotide sequences shown as SEQ ID NO.7 and SEQ ID NO.8, and the negative control substance comprises ddH 2 O。
The invention has the beneficial effects that:
the Vi primer pair provided by the invention can specifically amplify the gene S1 of the avian infectious bronchitis virus of CH I type, CH II type, CH III type, CH IV type, CH V type or Mass type, and the avian infectious bronchitis virus of CH I type, CH II type, CH III type, CH IV type, CH V type or Mass type can be specifically detected by utilizing the primer pair. The By primer pair provided By the invention can specifically amplify the S1 gene of the CH VI avian infectious bronchitis virus, and the primer pair can be used for specifically detecting the CH VI avian infectious bronchitis virus.
The primer probe set for detecting the avian infectious bronchitis virus by the RT-RAA fluorescence method can specifically amplify the avian infectious bronchitis virus, has no cross reaction with nucleic acids of avian leukemia virus, newcastle disease virus, avian infectious laryngotracheitis virus, avian infectious anemia virus, marek's disease virus, avian infectious bursal disease virus, avian reticuloendotheliosis virus and H9N2 subtype avian influenza virus, and has strong specificity. The primer probe set provided by the invention can be used for detecting low-copy avian infectious bronchitis virus nucleic acids with different genotypes, can finish detection within 5-20min, consumes shorter time and less reagents than a sequencing method, and has the advantages of simplicity and convenience in operation, low cost, high sensitivity, rapid typing and the like.
Drawings
FIG. 1 shows the verification results of the primer pair of the present invention, wherein the lanes sequentially include Marker, avian infectious bronchitis virus CK/CH/GX/NN16-2 nucleic acid, ddH from left to right 2 O negative control, avian infectious bronchitis Virus YX10 nucleic acid, ddH 2 O negative control;
FIG. 2 shows the amplification results of the positive control and the negative control according to the present invention;
FIG. 3 shows the detection sensitivity results of the Vi primer probe set of the present invention;
FIG. 4 shows the detection sensitivity results of the By primer probe set of the present invention;
FIG. 5 shows the dual RT-RAA detection sensitivity results of the Vi primer probe set and the By primer probe set of the present invention;
FIG. 6 shows the specific detection result of the Vi primer probe set of the present invention, wherein the fluorescence amplification curves are Y10, H120, LDT3-A, 4/91, CK CH JX JA09-1 and TW2575/98 in sequence from top to bottom;
FIG. 7 shows the result of specificity detection of the By primer probe set of the present invention;
FIG. 8 shows the results of the double RT-RAA detection of specificity of the Vi primer probe set and the By primer probe set of the present invention, wherein the fluorescent amplification curves are Y10, H120, CH VI, LDT3-A, 4/91, CK CH JX JA09-1 and TW2575/98 in sequence from top to bottom.
Detailed Description
The invention provides an RT-RAA primer probe group for detecting avian infectious bronchitis viruses, which comprises at least one group of a Vi primer probe group and a By primer probe group; the nucleotide sequence of the positive primer and the negative primer of the Vi primer in the Vi primer probe group is shown as SEQ ID NO.1-2, and the nucleotide sequence of the Vi probe is shown as SEQ ID NO. 3; the nucleotide sequence of the positive primer and the negative primer of the By primer in the By primer probe group is shown as SEQ ID NO.4-5, and the nucleotide sequence of the By probe is shown as SEQ ID NO. 6.
In the invention, two groups of primer probe sets can be used simultaneously or independently, a By primer probe set can be used for independently detecting the infectious bronchitis virus of CH VI, and a Vi primer probe set can be used for independently detecting the infectious bronchitis virus of CH I, CH II, CH III, CH IV, CH V or Mass. In the invention, the nucleotide sequence of the forward primer of the Vi primer in the Vi primer probe group is ATAAGTGTGTTGACTATAATATATATGG, the nucleotide sequence of the reverse primer of the Vi primer in the Vi primer probe group is AAGACCATAGCTGCCCTGTACAACAAAGACATC, and the nucleotide sequence of the Vi probe in the Vi primer probe group is TAGGCCAAGGTTTTATTACTAATGTGACTGATTCTGCTGCTAATTTTAGT. In the invention, the nucleotide sequence of the forward primer of the By primer in the By primer probe group is TTTGTTACACATTGTTTTAAAAATGGAC, the nucleotide sequence of the reverse primer of the By primer in the By primer probe group is TAAATTTACTATAACTAGAAGTGGTAACTG, and the nucleotide sequence of the By probe in the By primer probe group is TAAATTAAGGGAGGGTGATATTCGTATTGGTGTTCTAGATAGTAGTGG. The difficulty of primer design is embodied in a specificity test, two groups of primers are designed in a genome with higher similarity, and at the beginning of primer design, the method not only ensures that a single genome can be specifically detected, but also ensures that the method avoids non-specific combination with the other group of primers. In the present invention, preferably, a fluorophore needs to be modified on the probe, the sequence of the Vi probe modified By the fluorophore is preferably 5'-TAGGCCAAGGTTTTATTACTAATGTGACTGAT/i6FAMdT// THF// iBHQ1dT/GCTGCTAATTTTAGT [ C3-spacer ] -3', and the sequence of the By probe modified By the fluorophore is preferably 5'-TAAATTAAGGGAGGGTGATATTCGTATTGG/i6FAMdT// THF// iBHQ1dT/TCTAGATAGTAGTGG [ C3-spacer ] -3', wherein i6 FAMdT/is the fluorophore,/iQ 1 dT/is the quencher, [ C3-spacer ] is the bio-blocker, and the recognition site of the recombinase/THF/is tetrahydrofuran.
The invention also provides application of the primer probe group in preparation of infectious bronchitis viruses or preparation of infectious bronchitis virus genotyping products. The present invention is not particularly limited with respect to the specific type of product, and preferably includes reagents, kits and chips.
The invention also provides a method for detecting the avian infectious bronchitis virus for non-diagnosis purposes, which comprises the following steps: extracting RNA of a sample to be detected, taking the RNA of the sample to be detected as a template, carrying out RAA reaction by using the primer probe set of claim 1, wherein if a fluorescence amplification curve appears, the peak time is less than or equal to 20min or the Ct value is less than or equal to 30, the sample to be detected is positive by the avian infectious bronchitis virus, and if no fluorescence amplification curve appears, the peak time is more than 20min or the Ct value is more than 39, the sample to be detected is negative by the avian infectious bronchitis virus.
The method for extracting the RNA of the sample to be detected is not particularly limited, and the conventional extraction method in the field can be adopted. In the present invention, the procedure of the RT-RAA reaction is preferably: 60s at 40 ℃; 30s at 40 ℃,40 cycles, and collecting fluorescence signals after the reaction is finished. The system of the RT-RAA reaction is preferably as follows: RT-RAA reaction dry powder 1 tube, 25 muL of A liquid, 2.5 muL of B liquid, 1 muL of Vi forward primer and reverse primer respectively under the condition of equal concentration primer and probe, 2 muL of By forward primer and reverse primer respectively, 0.4 muL of Vi probe, 0.6 muL of By probe, ddH 2 O10.5. Mu.L, RNA template 5. Mu.L, total volume 50. Mu.L. In the present invention, the RT-RAA reaction dry powder preferably comprises recombinase, single-stranded binding protein, polymerase, ATP, dNTP Mix, magnesium chloride (MgCl) 2 ) The liquid A is preferably polyethylene glycol, and the liquid B is preferably magnesium acetate.
In the invention, when the Vi primer probe group is adopted to carry out RT-RAA reaction, if the result is positive, the sample to be detected is the infectious bronchitis virus of CH I type-CH V type or Mass type; when the By primer probe group is adopted to carry out RT-RAA reaction, if the result is positive, the sample to be detected is the CH VI avian infectious bronchitis virus. When the two groups of primer probe sets are adopted to carry out RT-RAA reaction, if the results of the two groups of primer probe sets are positive, the sample to be detected is the infectious bronchitis virus of CH I-CH VI type or Mass type; if the result of the Vi primer probe group is positive and the result of the By primer probe group is negative, the sample to be detected is the infectious bronchitis virus of CH I-CH V type or Mass type; if the result of the By primer probe group is positive and the result of the Vi primer probe group is negative, the sample to be detected is the CH VI type avian infectious bronchitis virus; and if the results of the two groups of primer probe sets are negative, the sample to be detected is negative to the avian infectious bronchitis virus.
The invention also provides a kit for detecting the infectious bronchitis virus or the genetic typing of the infectious bronchitis virus, and the kit comprises the primer probe group.
The concentration proportion of the primers and the probes in the kit is preferably 1, the volume ratio of the Vi primer to the By primer is preferably 1:1-2, more preferably 1. In the present invention, the kit preferably further comprises a positive control and a negative control, the positive control preferably comprises an infectious bronchitis virus YX10 nucleic acid (positive control of Vi primer probe set) and an infectious bronchitis virus CK/CH/GX/NN16-2 nucleic acid (positive control of By primer probe set), wherein the amplification base sequence of the positive control of the Vi primer probe set is preferably: ATAAGTGTGTTGACTATAATATATATGGCAGAGTAGGCCAAGGTTTTATTACTAATGTGACTGATTCTGCTGCTAATTTTAGTTATTTAGCAGATGGTGGGTTAGCTATTTTAGATACTTCGGGTGCCATAGATGTCTTTGTTGTACAGGGCAGCTATGGTCTT, the amplified base sequence of the positive control of the By primer probe set is preferably: TTTGTTACACATTGTTTTAAAAATGGACAAGGAATATGTCCCTTGACAGGTAAATTAAGGGAGGGTGATATTCGTATTGGTGTTCTAGATAGTAGTGGTAATTCTATTTTTAATAAAACAGTTACCACTTCTAGTTATAGTAAATTTA, said negative control preferably comprises ddH 2 And O. In order to avoid the failure or pollution of the used reagent, the invention is provided with a positive control product and a negative control product, wherein the design of the negative control product can effectively verify whether the used reagent is polluted or not, so that the occurrence of false positive is avoided, and the design of the positive control product can effectively verify the effectiveness of the used reagent, so that the occurrence of false negative is avoided. In the kit of the present invention, the judgment criteria for the positive control and the negative control are preferably:
positive control: a typical fluorescence amplification curve appears, the peak-out time is less than or equal to 20min or the Ct value is less than or equal to 30, and the result is an effective result;
negative control: no amplification curve appears, the peak-out time is more than 20min or the Ct value is more than 39, and the result is effective.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
Respectively taking an infectious bronchitis virus YX10 nucleic acid (shown in SEQ ID NO. 7) and an infectious bronchitis virus CK/CH/GX/NN16-2 nucleic acid (shown in SEQ ID NO. 8) as positive templates, and taking ddH as a negative control 2 And O, performing RT-PCR reaction in the following reaction system: 1.0. Mu.L of forward primer (10. Mu.M), 1.0. Mu.L of reverse primer (10. Mu.M), RNase free ddH 2 O5.0. Mu.L, one Step Enzyme Mix 1. Mu.L, 2 Xone Step Mix 10.0. Mu.L, template 2. Mu.L. The reaction procedure is as follows: 30min at 50 ℃; 3min at 94 ℃;94 ℃ for 10s,58 ℃ for 30s,35 cycles; 5min at 72 ℃. The resulting product was analyzed by 1.5% agarose gel electrophoresis.
The results are shown in FIG. 1, the amplified fragment of the Vi primer probe set of the invention is consistent with the expected result, and the size is 164bp; the amplified fragment of the By primer probe set was consistent with the expected result and was 148bp in size.
Example 2
The genomic RNA of the sample to be detected is extracted according to the instruction procedures of an AxyPrep humoral virus DNA/RNA small quantity extraction kit (purchased from Suyao Biotech, guangzhou).
Preparation of an RT-RAA reaction system: each test sample corresponds to one RT-RAA reaction dry powder tube, reaction components and added volume in each RT-RAA reaction tube are shown in Table 1, a Vi probe in the Table 1 is a probe subjected to fluorescent modification on a probe with a nucleotide sequence shown in SEQ ID No.3, a specific sequence of the modified probe is 5'-TAGGCCAAGGTTTTATTACTAATGTGACTGAT/i6FAMdT// THF// iQ 1dT/GCTGCTAATTTTAGT [ C3-spacer ] -3', a specific sequence of the By probe is a probe subjected to fluorescent modification on a probe with a nucleotide sequence shown in SEQ ID No.6, and a specific sequence of the modified probe is 5'-TAAATTAAGGGAGGGTGATATTCGTATTGG/i6FAMdT// THF/BHiQ 1dT/TCTAGATAGTAGTGG [ C3-spacer ] -3'.
TABLE 1 preparation of RT-RAA reaction system
| Components of RT-RAA reaction system | Amount of the composition used |
| RT-RAA reaction dry powder | 1 pipe |
| Solution A | 25μL |
| Liquid B | 2.5μL |
| Vi Forward primer (SEQ ID NO. 1) ( |
1μL |
| Vi reverse primer (SEQ ID NO. 2) ( |
1μL |
| By Forward primer (SEQ ID NO. 4) ( |
2μL |
| By reverse primer (SEQ ID NO. 5) ( |
2μL |
| Vi Probe ( |
0.4μL |
| By probe ( |
0.6μL |
| ddH 2 O | 10.5μL |
| RNA template | 5μL |
| Total volume | 50μL |
Wherein the RT-RAA reaction dry powder comprises the following components: recombinase, single-stranded binding protein, polymerase, ATP, dNTP Mix, magnesium chloride (MgCl) 2 ) (ii) a The liquid A comprises the following components: polyethylene glycol (PEG); the liquid B comprises the following components: magnesium acetate (MgAc) 2 ) (ii) a The RT-RAA reaction dry powder, the solution A and the solution B are components of an RT-RAA nucleic acid amplification reagent which is purchased from Nanning Zhuangbo Biotechnology Co., ltd and has the product number of ZBA 22001.
Respectively taking an infectious bronchitis virus YX10 nucleic acid (shown as SEQ ID NO. 7) and an infectious bronchitis virus CK/CH/GX/NN16-2 nucleic acid (shown as SEQ ID NO. 8) as positive controls, and taking ddH as a negative control 2 O。
And (3) reversing the reaction tube of the prepared RT-RAA reaction system for 6-8 times, fully mixing the reaction liquid, and centrifuging at a low speed for several seconds to ensure that the reaction liquid is completely centrifuged to the bottom of the tube. Placing the reaction tube in a fluorescence quantitative instrument for 60s at 40 ℃; 30s at 40 ℃ for 40 cycles, and FAM and HEX fluorescence signals were collected.
And (3) judging the result of the sample to be detected according to the peak time or Ct value after the amplification is finished, wherein the result is shown in figure 2, and the judgment standard is as follows:
(1) Positive control: typical FAM and HEX fluorescence amplification curves appear, the peak-out time is less than or equal to 20min or the Ct value is less than or equal to 30, and the result is effective;
(2) Negative control: no amplification curve appears, the peak-out time is more than 20min or the Ct value is more than 39, and the result is an effective result;
(3) Detecting a sample: if the FAM fluorescence signal peak time is less than or equal to 20min or the Ct value is less than or equal to 39, the HEX fluorescence signal is more than 20min or the Ct value is more than 39, the sample to be detected is positive for the infectious bronchitis virus of type I, type II, type III, type IV, type V or MASS; if the peak-off time of the HEX fluorescence signal is less than or equal to 20min or the Ct value is less than or equal to 39, the FAM fluorescence signal is more than 20min or the Ct value is more than 39, the sample to be detected is positive for the VI type avian infectious bronchitis virus; if the FAM and HEX fluorescence signal peak time is less than or equal to 20min or the Ct value is less than or equal to 39, the sample to be detected is I type, II type, III type, IV type, V type or Mass type, and the avian infectious bronchitis virus VI is positive; and if the FAM and HEX fluorescence signals are more than 20min or the Ct value is more than 39, determining that the sample to be detected is negative to the avian infectious bronchitis virus.
As can be seen from FIG. 2, the positive control and the negative control of the dual RT-RAA of the present invention are both effective results, wherein the design of the negative control can effectively verify whether the used reagent is contaminated, thereby avoiding the occurrence of false positive, and the design of the positive control can effectively verify the effectiveness of the used reagent, thereby avoiding the occurrence of false negative.
Example 3
A kit for detecting avian infectious bronchitis viruses with different genotypes comprises the following components: RT-RAA reaction dry powder, a Vi forward primer with a nucleotide sequence shown as SEQ ID No.1, a Vi reverse primer with a nucleotide sequence shown as SEQ ID No.2, a Vi probe with a nucleotide sequence shown as SEQ ID No.3, a By forward primer with a nucleotide sequence shown as SEQ ID No.4, a By reverse primer with a nucleotide sequence shown as SEQ ID No.5, a By probe with a nucleotide sequence shown as SEQ ID No.6, A liquid, B liquid, a positive control and a negative control; wherein the volume ratio of the Vi forward primer to the Vi reverse primer to the By forward primer to the By reverse primer is 1; the positive control is avian infectious bronchitis virus YX10 nucleic acid with nucleotide sequence shown as SEQ ID NO.7 and avian infectious bronchitis virus CK/CH/GX/NN16-2 nucleic acid with nucleotide sequence shown as SEQ ID NO.8, and the negative control is ddH 2 O。
The RT-RAA reaction dry powder comprises the following components: reverse transcriptase, recombinase, single-strand binding protein, polymerase, ATP, dNTP Mix; the liquid A comprises the following components: polyethylene glycol (PEG); the liquid B comprises the following components: magnesium acetate (MgAc) 2 ) (ii) a The RT-RAA reaction dry powder, the solution A and the solution BIs a component of RT-RAA nucleic acid amplification reagent with the product number of ZBA22001 which is purchased from Nanning Zhuangbo Biotech Co.
Example 4
Guangdong Wen food group, inc. provided 50 clinical samples suspected of infecting avian infectious bronchitis. Extracting genome RNA of a sample to be detected according to the instruction steps of an AxyPrep body fluid virus D NA/RNA small quantity extraction kit (purchased from Guangzhou Sugao research Biotechnology Co., ltd.) for quantitative RT-qPCR detection and RT-RAA method detection, wherein the primer sequence and the reaction program of the quantitative RT-qPCR are shown in Table 2, and the reaction system of the quantitative RT-qPCR is as follows: 2 Xone Step U + Mix 10. Mu.L, one Step U + Enzyme Mix 1. Mu.L, forward (10. Mu.M) 0.4. Mu.L, reverse (10. Mu.M) 0.4. Mu.L, probe (10. Mu.M) 0.2. Mu.L, RNase-free ddH 2 O6. Mu.L, RNA 2. Mu.L, total reaction system 20. Mu.L. The specific steps of the RT-RAA method detection of the invention are the same as example 2.
TABLE 2 RT-qPCR detection primer sequences and reaction procedures
| Primer name | Sequence 5 '-3' |
| Vi-qPCR-F | GATGGCTCTCGTATACAGACTA(SEQ ID NO.9) |
| Vi-qPCR-R | GCCTACTCTGCCATATATATTATAG(SEQ ID NO.10) |
| Vi-qPCR-P | AACGGAGCCCTTAGTATTAATGCAAC(SEQ ID NO.11) |
| By-qPCR-F | TGAGTGCGTATTGCTTGTGTTTATT(SEQ ID NO.12) |
| By-qPCR-R | ATAATCAACACACCTATCTAAAACCACATT(SEQ ID NO.13) |
| By-qPCR-P | TAGCCCAGGCAGTCGCATATTTACTTCTGA(SEQ ID NO.14) |
| Reaction procedure | 15min at 55 ℃; 30s at 95 ℃; fluorescence signals were collected at 95 ℃ for 10s and 58 ℃ for 30s for a total of 40 cycles. |
The results are shown in Table 3.
TABLE 3 clinical sample test results
As can be seen from Table 3, the RT-RAA detection result of the present invention is substantially the same as the RT-qPCR detection result, indicating that the RT-RAA detection method of the present invention has high consistency with the RT-qPCR detection method. The method has good specificity and sensitivity, can complete detection within 5-20min, and has the advantages of simple operation, low cost and suitability for field mobile detection.
Example 5
Single-fold sensitivity test of Vi primer probe set
The positive standard plasmid (GenBank accession number JX840411.1: 20371-23841) of the S1 gene of the avian infectious bronchitis virus of the prepared Vi primer pair was diluted 10-fold, and 6 concentration gradients were used as templates, 10 for each 5 copies/μL、10 4 copies/μL、10 3 copies/μL、10 2 copies/μL、10 1 copies/μL，10 0 copies/. Mu.L, and in ddH 2 O is a negative controlmu.L of the reaction template was collected and used. The single real-time fluorescent RT-RAA reaction system is RAA reaction dry powder 1 tube (same as example 2), vi forward primer (SEQ ID NO. 1) (with the concentration of 10 MuM) 2 muL, vi reverse primer (SEQ ID NO. 2) (with the concentration of 10 muM) 2 muL, vi probe (SEQ ID NO. 3) (with the concentration of 10 muM) 0.6 muL, ddH 2 O12.9. Mu.L, A solution 25. Mu.L, and B solution 2.5. Mu.L (same as example 2 for A and B solutions). The reaction program is 60s at 40 ℃;40 ℃ 30s,40 cycles, and FAM fluorescence signal was collected. As a result, as shown in FIG. 3, the lowest concentration detectable by the Vi primer set and the probe of the present invention was 10 1 The template with the thickness of more than copies/mu L has high detection sensitivity.
Example 6
The invention By primer probe group single sensitivity test
Diluting the positive standard plasmid (GenBank accession No. MF447729: 287-518) of the S1 gene of the chicken infectious bronchitis virus with the prepared By primer pair By 10 times, and taking 6 concentration gradients as templates which are respectively 10 times 5 copies/μL、10 4 copies/μL、10 3 copies/μL、10 2 copies/μL、10 1 copies/μL，10 0 copies/. Mu.L, and in ddH 2 O is negative control, and 5. Mu.L of each reagent was used as a template. The single real-time fluorescent RT-RAA reaction system is RAA reaction dry powder 1 tube (same as example 2), by forward primer (SEQ ID NO. 4) (with the concentration of 10 μ M) 2 μ L, by reverse primer (SEQ ID NO. 5) (with the concentration of 10 μ M) 2 μ L, by probe (SEQ ID NO. 6) (with the concentration of 10 μ M) 0.6 μ L, ddH 2 O12.9. Mu.L, A solution 25. Mu.L, and B solution 2.5. Mu.L (same as example 2 for A solution and B solution). The reaction program is 60s at 40 ℃; 30s at 40 ℃,40 cycles, and collecting HEX fluorescence signals.
As a result, as shown in FIG. 4, the lowest concentration detectable By the By primer set and the probe of the present invention was 10 1 The template with the thickness of more than copies/mu L has high detection sensitivity.
Example 7
The dual sensitivity test of the Vi primer probe group and the By primer probe group
The positive standard plasmid (GenBank accession number JX840411.1: 20371-23841) of the S1 gene of the avian infectious bronchitis virus of the prepared Vi primer pair and the avian infectious bronchitis of the By primer pair are usedPositive standard plasmid of sex bronchitis virus S1 gene (GenBank accession MF447729: 287-518), plasmid concentration with same multiple is mixed uniformly according to the proportion of 1:1, and diluted by 10 times, and 6 concentration gradients are used as templates, each concentration gradient is 10 times 5 copies/μL、10 4 copies/μL、10 3 copies/μL、10 2 copies/μL、10 1 copies/μL，10 0 copies/. Mu.L, and in ddH 2 O as a negative control, 5. Mu.L of each was used as a template, and the reaction conditions and reaction system for RT-RAA amplification were the same as those in example 2.
As shown in FIG. 5, the detection concentrations of the Vi primer probe set and the By primer probe set of the invention for the double real-time fluorescence RT-RAA were 10 1 The template with the thickness of more than copies/mu L has high detection sensitivity.
Example 8
Single specificity test of Vi primer probe set of the invention
Chicken infectious bronchitis virus nucleic acid (GenBank accession number JX 840411.1) of Vi primer pair is used as positive control, ddH 2 And O is negative control, and Vi primer probe sets are respectively adopted to detect the avian infectious bronchitis viruses of CH I type, CH II type, CH III type, CH IV type, CH V type and Mass type, namely corresponding reference strains are Y10, 4/91, LDT3-A, CK CH JX JA09-1, TW2575/98 and H120, and 5 mu L of nucleic acid of avian infectious bronchitis virus of CH VI type, avian leukemia virus, newcastle disease virus, avian infectious anemia virus, avian infectious laryngotracheitis virus, marek's disease virus, avian infectious bursal disease virus, avian reticuloendotheliosis virus and H9N2 subtype avian influenza virus. The reaction system and reaction procedure of the single real-time fluorescence RT-RAA are the same as those of example 5, and FAM fluorescence signals are collected.
As shown in FIG. 6, the positive control group showed a normal FAM fluorescence amplification curve, the specific detection of infectious bronchitis viruses of CH I, CH II, CH III, CH IV, CH V and Mass showed a normal FAM fluorescence amplification curve, and the other virus test groups and the negative control group showed no amplification curve. The result shows that the single real-time fluorescent RT-RAAVi primer pair can specifically detect the CH I type, CH II type, CH III type, CH IV type, CH V type or Mass type avian infectious bronchitis viruses, and has no cross reaction with the CH VI type avian infectious bronchitis viruses, avian leukosis viruses, newcastle disease viruses, avian infectious anemia viruses, avian infectious laryngotracheitis viruses, marek's disease viruses, avian infectious bursal disease viruses, avian reticuloendotheliosis viruses and H9N2 subtype avian influenza viruses.
Example 9
The invention By primer probe group single specificity test
Infectious bronchitis virus nucleic acid of chicken (GenBank accession MF 447729) of By primer pair is used as positive control, ddH 2 O is a negative control. The By primer probe set of the invention is respectively adopted to detect the infectious bronchitis viruses of CH I type, CH II type, CH III type, CH IV type, CH V type and Mass type, namely corresponding reference strains are Y10, 4/91, LDT3-A, CK CH JX JA09-1, TW2575/98 and H120, and 5 mu L of nucleic acid of the infectious anemia viruses of birds, the infectious laryngotracheitis viruses of birds, marek's disease viruses, the infectious bursal disease viruses of birds, the reticuloendotheliosis viruses of birds and the avian influenza viruses of H9N2 subtype. The reaction system and reaction procedure of the single real-time fluorescence RT-RAA are the same as in example 6, and the HEX fluorescence signal is collected.
The results are shown in fig. 7, in which the positive control test group showed a normal HEX fluorescent amplification curve, and the test groups of other viruses and the negative control group showed no amplification curve. The result shows that the single real-time fluorescent RT-RAABy primer pair can specifically detect the CH VI type avian infectious bronchitis virus, has an HEX fluorescent amplification curve, and has no cross reaction with the CH I type, CH II type, CH III type, CH IV type, CH V type and Mass type avian infectious bronchitis virus, avian infectious anemia virus, avian infectious laryngotracheitis virus, marek's disease virus, avian infectious bursal disease virus, avian reticuloendotheliosis virus and H9N2 subtype avian influenza virus.
Example 10
Dual specificity verification of Vi primer probe group and By primer probe group
Chicken infectious bronchitis with Vi primer pairAvian infectious bronchitis virus nucleic acid (GenBank accession No. MF 447729.1) of tubulitis virus nucleic acid (GenBank accession No. JX 840411.1) and By primer pair as positive control, ddH 2 O is a negative control. The detection of the nucleic acid 5 muL of avian leukemia virus, newcastle disease virus, avian infectious anemia virus, avian infectious laryngotracheitis virus, marek's virus, avian infectious bursal disease virus, avian reticuloendotheliosis virus and H9N2 subtype avian influenza virus, and the reaction conditions and reaction system for RT-RAA amplification are the same as those of example 2, namely the corresponding reference strains of the avian infectious bronchitis viruses CH I, CH II, CH III, CH IV, CH V and Mass, namely Y10, 4/91, LDT3-A, CK CH JX JA09-1, TW2575/98 and H120, respectively.
As a result, as shown in FIG. 8, the positive control group showed the normal FAM and HEX fluorescent amplification curves, and the negative control group showed no amplification curve. The infectious bronchitis viruses of CH I type, CH II type, CH III type, CH IV type, CH V type and Mass type have FAM fluorescence amplification curves, and no HEX fluorescence amplification curve, and the amplification curves of avian leukemia virus, newcastle disease virus, avian infectious anemia virus, avian infectious laryngotracheitis virus, marek's disease virus, avian infectious bursal disease virus, avian reticuloendotheliosis virus and H9N2 subtype avian influenza virus do not appear.
The result shows that the kit can specifically detect the avian infectious bronchitis viruses of CH I type, CH II type, CH III type, CH IV type, CH V type and Mass type, has a FAM fluorescent amplification curve, specifically detects the avian infectious bronchitis virus of CH VI type, has a HEX fluorescent amplification curve, and has no cross reaction with avian leukemia virus, newcastle disease virus, avian infectious anemia virus, avian infectious laryngotracheitis virus, marek's disease virus, avian infectious bursal disease virus, avian reticuloendotheliosis virus and H9N2 subtype avian influenza virus.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> southern China university of agriculture
<120> RT-RAA primer probe group for detecting avian infectious bronchitis virus and genotyping, kit and application thereof
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ataagtgtgt tgactataat atatatgg 28
<210> 2
<211> 33
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
aagaccatag ctgccctgta caacaaagac atc 33
<210> 3
<211> 50
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
taggccaagg ttttattact aatgtgactg attctgctgc taattttagt 50
<210> 4
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tttgttacac attgttttaa aaatggac 28
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
taaatttact ataactagaa gtggtaactg 30
<210> 6
<211> 48
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
taaattaagg gagggtgata ttcgtattgg tgttctagat agtagtgg 48
<210> 7
<211> 164
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ataagtgtgt tgactataat atatatggca gagtaggcca aggttttatt actaatgtga 60
ctgattctgc tgctaatttt agttatttag cagatggtgg gttagctatt ttagatactt 120
cgggtgccat agatgtcttt gttgtacagg gcagctatgg tctt 164
<210> 8
<211> 148
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tttgttacac attgttttaa aaatggacaa ggaatatgtc ccttgacagg taaattaagg 60
gagggtgata ttcgtattgg tgttctagat agtagtggta attctatttt taataaaaca 120
gttaccactt ctagttatag taaattta 148
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gatggctctc gtatacagac ta 22
<210> 10
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gcctactctg ccatatatat tatag 25
<210> 11
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
aacggagccc ttagtattaa tgcaac 26
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tgagtgcgta ttgcttgtgt ttatt 25
<210> 13
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
ataatcaaca cacctatcta aaaccacatt 30
<210> 14
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
tagcccaggc agtcgcatat ttacttctga 30
Claims (10)
1. An RT-RAA primer probe group for detecting avian infectious bronchitis viruses is characterized By comprising at least one of a Vi primer probe group and a By primer probe group; the nucleotide sequence of the positive primer and the negative primer of the Vi primer in the Vi primer probe group is shown as SEQ ID NO.1-2, and the nucleotide sequence of the Vi probe is shown as SEQ ID NO. 3; the nucleotide sequence of the positive primer and the negative primer of the By primer in the By primer probe group is shown as SEQ ID NO.4-5, and the nucleotide sequence of the By probe is shown as SEQ ID NO. 6.
2. The application of the primer probe group in the preparation of products for detecting the avian infectious bronchitis viruses in claim 1.
3. The use of the primer probe set of claim 1 for the preparation of a chicken infectious bronchitis virus genotyping product.
4. A method for detecting avian infectious bronchitis virus for non-diagnostic purposes, comprising the steps of: extracting RNA of a sample to be detected, taking the RNA of the sample to be detected as a template, carrying out RT-RAA reaction by using the primer probe set of claim 1, wherein if a fluorescence amplification curve appears, the peak time is less than or equal to 20min or the Ct value is less than or equal to 30, the sample to be detected is positive by the avian infectious bronchitis virus, and if no fluorescence amplification curve appears, the peak time is more than 20min or the Ct value is more than 39, the sample to be detected is negative by the avian infectious bronchitis virus.
5. The method of claim 4, wherein when the Vi primer probe set of claim 1 is used for RT-RAA reaction, if the result is positive, the sample to be tested is avian infectious bronchitis virus of CH I-CH V type or Mass type; when the By primer probe set of claim 1 is used to perform RT-RAA reaction, if the result is positive, the sample to be tested is the infectious bronchitis virus CH VI.
6. The method according to claim 4, wherein when the two primer probe sets of claim 1 are used for RT-RAA reaction, if the two primer probe sets have positive results, the sample to be tested is avian infectious bronchitis virus of CH I-CH VI type or Mass type; if the result of the Vi primer probe group is positive and the result of the By primer probe group is negative, the sample to be detected is the infectious bronchitis virus of CH I-CH V type or Mass type; if the result of the By primer probe group is positive and the result of the Vi primer probe group is negative, the sample to be detected is the CH VI type avian infectious bronchitis virus; and if the results of the two groups of primer probe sets are negative, the sample to be detected is negative to the avian infectious bronchitis virus.
7. The method of claim 4, wherein the RT-RAA reaction is performed by: 60s at 40 ℃; 30s at 40 ℃ for 40 cycles.
8. A kit for detecting infectious bronchitis virus or genotyping infectious bronchitis virus, comprising the primer probe set of claim 1.
9. The kit according to claim 8, wherein the concentration ratio of the primers to the probes in the kit is 1, the volume ratio of the Vi primer to the By primer is 1:1-2, and the volume ratio of the Vi probe to the By probe is 2:3.
10. The kit of claim 8, further comprising a positive control and a negative control, wherein the positive control comprises a nucleic acid having a nucleotide sequence shown in SEQ ID No.7 and SEQ ID No.8, and the negative control comprises ddH 2 O。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210778469.2A CN115323075B (en) | 2022-06-30 | 2022-06-30 | RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210778469.2A CN115323075B (en) | 2022-06-30 | 2022-06-30 | RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN115323075A true CN115323075A (en) | 2022-11-11 |
| CN115323075B CN115323075B (en) | 2023-05-09 |
Family
ID=83917352
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210778469.2A Active CN115323075B (en) | 2022-06-30 | 2022-06-30 | RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115323075B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116121461A (en) * | 2023-02-21 | 2023-05-16 | 华南农业大学 | Primer pair and kit for detecting CHV-type chicken infectious bronchitis virus and application of primer pair and kit |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241261A (en) * | 2019-06-20 | 2019-09-17 | 中国动物卫生与流行病学中心 | A kind of RT-RAA detection method of avian infectious bronchitis virus |
| CN110283938A (en) * | 2019-06-20 | 2019-09-27 | 华南农业大学 | A kind of dual RT-RAA detection primer group, kit and the application of PEDV and PDCoV |
| CN110453014A (en) * | 2019-08-20 | 2019-11-15 | 河北农业大学 | The primer and probe combination of detection avian infectious bronchitis virus and kit and detection method |
| CN111979304A (en) * | 2020-09-08 | 2020-11-24 | 韩山师范学院 | Method for detecting new coronavirus based on real-time fluorescence RT-RAA |
| CN113005229A (en) * | 2021-04-20 | 2021-06-22 | 河北农业大学 | Primer and probe for detecting avian infectious bronchitis virus, detection method and application |
| CN113930547A (en) * | 2021-10-25 | 2022-01-14 | 华南农业大学 | RT-RAA fluorescence method detection primer pair, kit and detection method for porcine epidemic diarrhea virus N gene |
| CN113930546A (en) * | 2021-10-25 | 2022-01-14 | 华南农业大学 | RT-RAA fluorescence detection primer pair, kit and detection method for J subtype avian leukosis virus gp85 gene |
-
2022
- 2022-06-30 CN CN202210778469.2A patent/CN115323075B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110241261A (en) * | 2019-06-20 | 2019-09-17 | 中国动物卫生与流行病学中心 | A kind of RT-RAA detection method of avian infectious bronchitis virus |
| CN110283938A (en) * | 2019-06-20 | 2019-09-27 | 华南农业大学 | A kind of dual RT-RAA detection primer group, kit and the application of PEDV and PDCoV |
| CN110453014A (en) * | 2019-08-20 | 2019-11-15 | 河北农业大学 | The primer and probe combination of detection avian infectious bronchitis virus and kit and detection method |
| CN111979304A (en) * | 2020-09-08 | 2020-11-24 | 韩山师范学院 | Method for detecting new coronavirus based on real-time fluorescence RT-RAA |
| CN113005229A (en) * | 2021-04-20 | 2021-06-22 | 河北农业大学 | Primer and probe for detecting avian infectious bronchitis virus, detection method and application |
| CN113930547A (en) * | 2021-10-25 | 2022-01-14 | 华南农业大学 | RT-RAA fluorescence method detection primer pair, kit and detection method for porcine epidemic diarrhea virus N gene |
| CN113930546A (en) * | 2021-10-25 | 2022-01-14 | 华南农业大学 | RT-RAA fluorescence detection primer pair, kit and detection method for J subtype avian leukosis virus gp85 gene |
Non-Patent Citations (1)
| Title |
|---|
| CINTIA HIROMI OKINO ET AL: "Rapid detection and differentiation of avian infectious bronchitis virus:an application of Mass genotype by melting temperature analysis in RT-qPCR using SYBR Green I", J VET MED SCI. * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116121461A (en) * | 2023-02-21 | 2023-05-16 | 华南农业大学 | Primer pair and kit for detecting CHV-type chicken infectious bronchitis virus and application of primer pair and kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN115323075B (en) | 2023-05-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111254228B (en) | Kit for detecting novel coronavirus and influenza virus | |
| CN108060269B (en) | DPO primer group for detecting porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus and porcine rotavirus and application thereof | |
| WO2021175298A1 (en) | Novel coronavirus detection reagent and detection method | |
| CN113462820A (en) | Multiplex RT-PCR primer probe set for real-time fluorescent quantitative detection of four porcine diarrhea viruses, kit and detection method thereof | |
| CN113930547B (en) | RT-RAA fluorescence detection primer pair, kit and detection method for porcine epidemic diarrhea virus N gene | |
| CN115323075B (en) | RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit | |
| CN110656163A (en) | Double-label report fluorescent multiple pathogen nucleic acid detection method | |
| CN113930546A (en) | RT-RAA fluorescence detection primer pair, kit and detection method for J subtype avian leukosis virus gp85 gene | |
| CN111471800B (en) | Kit for detecting novel coronavirus and amplification primer composition thereof | |
| CN103088151B (en) | Kit for hepatitis B virus four-color fluorescence quantitative PCR (polymerase chain reaction) assay and application | |
| CN111893217A (en) | Novel coronavirus composition, kit and detection method thereof | |
| CN112195278A (en) | Six respiratory tract virus nucleic acid detection kit and use method thereof | |
| CN109457049B (en) | Composition, kit and method for genotyping detection of hepatitis B virus | |
| CN111676315A (en) | Primer and probe for detecting novel coronavirus ORF1ab gene, kit and method thereof | |
| CN116445659A (en) | Kit for detecting novel coronavirus and Omicron variant typing and application | |
| CN116254371A (en) | Primer molecular beacon combination for wild type and mutant molecular typing of monkey pox virus and application thereof | |
| CN113817870B (en) | Primer composition for simultaneously detecting seven respiratory tract related viruses and application thereof | |
| CN113278738A (en) | Primer probe composition for parainfluenza virus typing detection and real-time fluorescent quantitative PCR kit | |
| WO2021203448A1 (en) | Multiplex fluorescent rt-pcr detection reagent for detecting coastal input severe acute respiratory syndrome coronavirus 2 | |
| CN109517929B (en) | Primer group and kit for porcine circovirus detection and type2 typing | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof | |
| CN112126713A (en) | Coronavirus and influenza virus combined detection product and application thereof | |
| CN114959120A (en) | Primer probe set and kit for detecting chicken infectious anemia virus by RAA fluorescence method and application of primer probe set and kit | |
| CN111500777A (en) | Kit for detecting novel coronavirus nucleic acid based on fluorescence RT-PCR method | |
| CN110714097A (en) | Method for simultaneously detecting A, B, C three groups of rotaviruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |