CN115322257A

CN115322257A - BCMA (brain cell adhesion antigen) targeted antibody, chimeric antigen receptor and application thereof

Info

Publication number: CN115322257A
Application number: CN202210605705.0A
Authority: CN
Inventors: 赵阳兵; 潘伟
Original assignee: Shanghai Youtijisheng Biomedical Co ltd
Current assignee: Shanghai Youtijisheng Biomedical Co ltd
Priority date: 2021-08-16
Filing date: 2021-08-16
Publication date: 2022-11-11
Anticipated expiration: 2041-08-16
Also published as: CN115322257B

Abstract

The present invention discloses anti-BCMA antibodies and antigen-binding fragments, chimeric antigen receptors ("BCMA CARs") having these anti-BCMA antibodies and antigen-binding fragments, and genetically engineered immune effector cells having these BCMA CARs. The invention also provides polynucleotides encoding anti-BCMA antibodies and antigen binding fragments, and BCMA CARs. The invention also provides compositions comprising anti-BCMA antibodies and antigen binding fragments, and a BCMA CAR. The invention also relates to the anti-BCMA antibodies and antigen binding fragments, and the use of genetically engineered immune effector cells having such BCMA CARs in the treatment of cancer.

Description

BCMA (brain cell adhesion antigen) targeted antibody, chimeric antigen receptor and application thereof

1. Field of the invention

The present invention relates to molecular biology, cell biology and immunooncology. In particular, the invention provides anti-BCMA antibodies, chimeric antigen receptors ("BCMA CARs") comprising the anti-BCMA antibodies, genetically engineered immune effector cells expressing the BCMA CARs, and uses thereof in the treatment of tumors or cancers.

2. Background of the invention

B Cell Maturation Antigen (BCMA) is a transmembrane glycoprotein expressed on mature B lymphocytes. BCMA expression is associated with a variety of diseases including cancer and infectious diseases. However, current therapies directed against BCMA, including BCMA binding to Chimeric Antigen Receptors (CARs) and cells expressing such CARs, have met with limited success. Therefore, the selection of other BCMA targeted therapies represents an unmet need. The present invention provides compositions and methods that meet these needs and have other related advantages.

3. Summary of the invention

The present invention provides an antibody or antigen-binding fragment thereof capable of specifically binding to BCMA (e.g., human BCMA), comprising: (a) A light chain variable region (VL) comprising a light chain CDR1 (VL CDR 1), a light chain CDR2 (VL CDR 2), and a light chain CDR3 (VL CDR 3) having the amino acid sequences set forth in

SEQ ID NOs

8, 18, and 28, respectively; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs; and/or (b) a heavy chain variable region (VH) comprising heavy chain CDR1 (VH CDR 1), heavy chain CDR2 (VH CDR 2), and heavy chain CDR3 (VH CDR 3) having the amino acid sequences shown in SEQ ID NOs: 39, 51, and 63, respectively; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the antibodies and antigen-binding fragments provided herein comprise a VL CDR1, a VL CDR2, a VL CDR3, a VH CDR1, a VH CDR2, and a VH CDR3, wherein (a) the VL CDR1, CDR2, and CDR3 have the amino acid sequences set forth in

SEQ ID NOs

8, 18, and 28, respectively; and (b) said VH CDR1, CDR2 and CDR3 have amino acid sequences of

SEQ ID NOs

39, 51 and 63, respectively.

The antibodies or antigen-binding fragments thereof provided herein are capable of specifically binding BCMA (e.g., human BCMA), comprising: (a) A VL having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to the amino acid sequence set forth in SEQ ID No. 75; and/or (b) a VH having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 87.

In some embodiments, the antibodies and antigen-binding fragments provided herein comprise a VL and a VH, wherein the VL and VH have the amino acid sequences set forth in SEQ ID NOs 75 and 87, respectively.

The invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA) comprising (a) a VL comprising a VL CDR1, CDR2, and CDR3, wherein the VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 75, and/or (b) a VH comprising a VH CDR1, CDR2, and CDR3, wherein the VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID No. 87.

In some embodiments, the invention provides that an antibody or antigen binding fragment competes with an antibody or antigen binding fragment described herein for binding to BCMA.

In some embodiments, the antibodies or antigen binding fragments provided herein are monoclonal antibodies or antigen binding fragments. In some embodiments, the antibodies or antigen-binding fragments provided herein are bispecific or multispecific antibodies. In some embodiments, the antibodies provided herein are bispecific T cell engagers (bites). In some embodiments, the antibodies provided herein are selected from the group consisting of IgG1 antibodies, igG2 antibodies, igG3 antibodies, and IgG4 antibodies. In some embodiments, the invention provides an antibody or antigen binding fragment selected from the group consisting of Fab, fab ', F (ab') ₂ 、Fv、scFv、(scFv) ₂ Single domain antibodies (sdabs) and heavy chain antibodies (hcabs). In some embodiments, the antibodies or antigen-binding fragments provided herein are scFv.

In some embodiments, the antibodies or antigen-binding fragments provided herein are chimeric antibodies or antigen-binding fragments, humanized antibodies or antigen-binding fragments, or human antibodies or antigen-binding fragments. In some embodiments, the antibodies or antigen binding fragments provided herein are human antibodies or antigen binding fragments.

The invention also provides polynucleotides encoding the antibodies or antigen-binding fragments of the invention. In some embodiments, the polynucleotide is messenger RNA (mRNA). In some embodiments, the invention provides a vector comprising a polynucleotide of the invention. In some embodiments, the invention provides a host cell comprising a polynucleotide of the invention or a vector of the invention.

The invention also provides a Chimeric Antigen Receptor (CAR) that specifically binds BCMA, comprising, from N-terminus to C-terminus: (a) A BCMA binding domain comprising an antibody or antigen binding fragment of the invention; (b) a transmembrane domain; and (c) a cytoplasmic domain. In some embodiments, the transmembrane domain is derived from CD8, CD28, CD3 ζ, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, TCR α chain, TCR β chain, or TCR ζ chain, CD3 epsilon, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, or CD154.

In some embodiments of the CARs provided herein, the transmembrane domain comprises a CD8 transmembrane region or a CD28 transmembrane region. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 ζ, fcR γ, fc γ RIIa, fcR β, CD3 γ, CD3 δ, CD3 epsilon, CD5, CD22, CD79a, CD79b, DAP10, DAP12, or any combination thereof. In some embodiments, the cytoplasmic domain further comprises a costimulatory domain derived from CD28, 4-1BB (CD 137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, GITR, TLR, DR3, CD43, or any combination thereof, in some embodiments the cytoplasmic domain comprises a CD3 zeta signaling domain and a 4-1BB costimulatory domain. In some embodiments, the cytoplasmic domain comprises a CD3 zeta signaling domain and a CD28 costimulatory domain.

In some embodiments, the CARs provided herein further comprise a CD8 hinge, the CD8 hinge being located between the antibody or antigen-binding fragment and the transmembrane domain.

In some embodiments, the CARs provided herein that specifically bind BCMA include the amino acid sequence set forth in SEQ ID NO: 138.

The invention also provides a polynucleotide encoding a CAR of the invention. In some embodiments, the polynucleotide is mRNA. The invention also provides a vector comprising a polynucleotide of the invention or a vector of the invention.

In some embodiments, the cells provided herein are immune effector cells. In some embodiments, the cells are derived from cells isolated from peripheral blood or bone marrow. In some embodiments, the cells are derived from cells differentiated in vitro from stem or progenitor cells selected from the group consisting of T cell progenitors, hematopoietic stem/progenitors, hematopoietic multipotent progenitors, embryonic stem cells, and induced pluripotent cells. In some embodiments, the cell is a T cell or an NK cell. In some embodiments, the cell is a cytotoxic T cell, a helper T cell, a γ δ T cell, a CD4+/CD8+ double positive T cell, a CD4+ T cell, a CD8+ T cell, a CD4/CD8 double negative T cell, a CD3+ T cell, a naive T cell, an effector T cell, a helper T cell, a memory T cell, a regulatory T cell, a Th0 cell, a Th1 cell, a Th2 cell, a Th3 (Treg) cell, a Th9 cell, a Th17 cell, a Th α β helper cell, a TEM cell, a stem cell memory TSCM cell, a central memory TCM cell, an effector memory cell, or an effector memory TEMRA cell. In some embodiments, the cell is a cytotoxic T cell.

In some embodiments, the invention provides a cell population of the cells of the invention, wherein the cell population is derived from Peripheral Blood Mononuclear Cells (PBMCs), peripheral Blood Lymphocytes (PBLs), tumor Infiltrating Lymphocytes (TILs), cytokine-induced killer Cells (CIKs), lymphokine-activated killer cells (LAKs), or bone marrow infiltrating lymphocytes (mls).

In some embodiments, the invention provides a pharmaceutical composition comprising a therapeutically effective amount of an antibody or antigen-binding fragment of the invention, and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical compositions provided herein comprise a therapeutically effective amount of a cell or population of cells described herein, and a pharmaceutically acceptable carrier.

In some embodiments, the invention provides the use of an antibody or antigen-binding fragment of the invention, a cell or population of cells of the invention, or a pharmaceutical composition of the invention in the treatment of cancer. In some embodiments, the invention provides the use of an antibody or antigen-binding fragment of the invention, a cell or population of cells of the invention, or a pharmaceutical composition of the invention in the manufacture of a medicament for the treatment of cancer. In some embodiments, the cell, cell population, or pharmaceutical composition is used in combination with an additional therapy.

In some embodiments, the invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an antibody or antigen-binding fragment of the invention, or a pharmaceutical composition of the invention.

In some embodiments, the present invention provides a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a cell or population of cells described herein. In some embodiments, the cell population is a cell population that is autologous to the subject. In some embodiments, the methods provided herein further comprise obtaining T cells from the subject. In some embodiments, the methods provided herein further comprise administering an additional treatment to the subject.

In some embodiments, the subject is a human.

In some embodiments of the uses or methods provided herein, the cancer is a BCMA-expressing cancer. In some embodiments, the cancer is a solid tumor or a hematologic cancer. In some embodiments, the cancer is a B cell malignancy. In some embodiments, the cancer is a lymphoma, leukemia, or plasma cell malignancy. In some embodiments, the cancer is Multiple Myeloma (MM), fahrenheit macroglobulinemia, hodgkin's lymphoma or non-hodgkin's lymphoma. In some embodiments, the cancer is MM. In some embodiments, the MM is non-secretory multiple myeloma, or smoldering multiple myeloma.

The invention also provides a method of making a cell capable of expressing a CAR that specifically binds BCMA, comprising transferring a polynucleotide of the invention into the cell. In some embodiments, the cell is selected from the group consisting of a T cell, an NK cell, an NKT cell, a macrophage, a neutrophil, and a granulocyte. In some embodiments, the polynucleotide is transferred by electroporation. In some embodiments, the polynucleotide is transferred by viral transduction. In some embodiments, the methods provided herein comprise viral transduction using a lentivirus, retrovirus, adenovirus, or adeno-associated virus. In some embodiments, the polynucleotide is transferred by a transposon system. In some embodiments, the transposon system is Sleeping Beauty (Sleeping Beauty) or PiggyBac. In some embodiments, the polynucleotide is transferred by gene editing. In some embodiments, the polynucleotide is transferred by a CRISPR-Cas system, a ZFN system, or a TALEN system.

4. Description of the drawings

FIGS. 1A-1B provide flow cytometry data for anti-BCMA CAR-T cells stained with CD19-Fc (FIG. 1A) or BCMA-Fc (FIG. 1B).

Figure 2A provides the frequency of CAR + cells in T cells transduced with the indicated BCMA CARs.

Figure 2B provides the Mean Fluorescence Intensity (MFI) of CAR expression in T cells transduced with the indicated BCMA CARs.

Figure 3 provides the frequency of CAR + CD8 cells in T cells transduced with the indicated BCMA CARs.

Figure 4 provides phenotypes of designated CART cells characterized by CCR7 expression and CD45RO expression.

FIGS. 5A-5B provide for BCMA expression in tumor cell lines. Fig. 5A provides FACS results. Fig. 5B provides relative expression levels compared to a549 cells.

FIGS. 6A-6B provide ELISA results showing the production of INF-gamma and IL-2 by designated CART cells. FIG. 6A shows the production of INF- γ. FIG. 6B shows IL-2 production.

FIGS. 7A-7D provide results of tumor killing assays showing cytolytic activity of designated CART cells against Jeko-1 cells at different E (T cell): T (tumor cell) ratios. FIG. 7A: e: t =0.1:1; FIG. 7B: e: t =0.5:1; FIG. 7C: e: t =2:1; FIG. 7D: e: t =2:1 (enlarged view).

Figures 8A-8E provide tumor killing assay results showing the cytolytic activity of indicated CART cells against RPMI-8226 cells. Fig. 8a; fig. 8b; fig. 8c; fig. 8 d; fig. 8 e.

5. Detailed description of the preferred embodiments

Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments set forth herein, and that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

B-cell maturation antigen (BCMA), also known as tumor necrosis factor receptor superfamily member 17 (TNFRSF 17), is a member of the TNF-receptor superfamily. BCMA is preferentially expressed in mature B lymphocytes, playing an important role in B cell development and autoimmune response. BCMA has been shown to bind specifically to the tumor necrosis factor (ligand) superfamily member 13B (TNFSF 13B/TALL-1/BAFF) and cause activation of NF-. Kappa.b and MAPK 8/JNK. BCMA has also been shown to bind to a variety of TRAF family members and transduce signals for cell survival and proliferation.

BCMA overexpression and activation is associated with human tumors such as Multiple Myeloma (MM), shah et al, leukemia,34, 985-1005 (2020), MM is a hematologic malignancy characterized by uncontrolled proliferation of plasma cells in the bone marrow. There are about 16 new diagnosed cases annually worldwide, and 11 ten thousand patient deaths. The disease is incurable, although survival is increasing as new treatments develop.

The present invention provides novel antibodies, including antigen-binding fragments, that specifically bind BCMA (e.g., human BCMA). In addition, the invention also provides Chimeric Antigen Receptors (CARs) comprising such antibodies or antigen binding fragments that specifically bind BCMA (e.g., human BCMA), as well as genetically engineered immune effector cells (e.g., T cells) and cell populations whose cells are cells that recombinantly express a CAR that specifically binds BCMA (e.g., human BCMA) (e.g., CART). Also disclosed are pharmaceutical compositions comprising a therapeutically effective amount of such antibodies or antigen-binding fragments, as well as pharmaceutical compositions comprising a therapeutically effective amount of a cell or cell population. The invention also discloses the use of such pharmaceutical compositions in the treatment of diseases and disorders associated with BCMA expression (e.g., BCMA expressing cancer) and related methods of treatment.

5.1 definition of

Unless defined otherwise, scientific and technical terms used herein shall have the meanings that are commonly understood by one of ordinary skill in the art. Furthermore, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. Generally, the nomenclature used herein and the techniques related to cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization are those well known and commonly employed in the art.

The present invention provides novel antibodies, including antigen-binding fragments that specifically bind BCMA (e.g., human BCMA). The term "BCMA" includes any variant or subtype of BCMA that is naturally expressed by a cell. Thus, the antibodies of the invention are capable of cross-reacting with BCMA of a species other than human (e.g., cynomolgus BCMA). Alternatively, the antibody can be specific for human BCMA without any cross-reactivity with other species. BCMA, or any variant or subtype thereof, can be either isolated from the cells or tissues in which they are naturally expressed or can be produced recombinantly using techniques well known in the art and/or described herein.

The term "antibody" and grammatical equivalents thereof as used herein refers to an immunoglobulin molecule that recognizes and specifically binds a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combination of any of the above, through at least one antigen binding site, which is typically within a variable region of the immunoglobulin molecule. As used herein, the term includes intact polyclonal antibodies, intact monoclonal antibodies, single domain antibodies (sdabs, e.g., camel antibodies, alpaca antibodies), single chain Fv (scFv) antibodies, heavy chain antibodies (HCAbs), light chain antibodies (LCAbs), multispecific antibodies, bispecific antibodies, monospecific antibodies, monovalent antibodies, and any other modified immunoglobulin molecule (e.g., a dual variable region immunoglobulin molecule) that comprises an antigen binding site, so long as the antibody exhibits the desired biological activity. The antibodies also include, but are not limited to, mouse antibodies, camelid antibodies, chimeric antibodies, humanized antibodies, and human antibodies. The antibody may be any one of five major immunoglobulins: igA, igD, igE, igG, and IgM or subclasses (isotypes) thereof (e.g., igG1, igG2, igG3, igG4, igA1, and IgA 2) are based on the identity of their heavy chain constant regions (referred to as α, δ, ε, γ, and μ, respectively). The term "antibody" as used herein includes "antigen-binding fragments" of intact antibodies, unless specifically indicated otherwise. The term "antigen-binding fragment" as used herein refers to an epitope that is part or fragment of an intact antibody, i.e., an intact antibody. Examples of antigen binding fragments include, but are not limited to, fab ', F (ab') 2, fv, linear antibodies, single chain antibody molecules (e.g., scFv), heavy chain antibodies (HCAbs), light chain antibodies (LCAbs), disulfide linked scFv (dsscFv), diabodies, triabodies, tetrabodies, minibodies, diabodies (DVDs), single variable region antibodies (sdabs, e.g., camel antibodies, alpaca antibodies), and single variable regions of heavy chain antibodies (VHHs), and bi-or multispecific antibodies formed from antibody fragments.

The term "humanized antibody" as used herein refers to a form of non-human (e.g., mouse) antibody that is a specific immunoglobulin chain, a chimeric immunoglobulin, or a fragment thereof containing minimal non-human sequences. Typically, the humanized antibody is a human immunoglobulin. In some cases, fv framework region residues of the human immunoglobulin are replaced by corresponding residues in antibodies from non-human species. In some cases, the CDR residues are replaced with CDR residues from a non-human species (e.g., mouse, rat, hamster, camel) that have the desired specificity, affinity, and/or binding capacity. The humanized antibodies may be further modified by the substitution of additional residues in the Fv framework regions and/or substituted non-human residues to refine and optimize antibody specificity, affinity, and/or binding capacity. The term "human antibody" as used herein refers to an antibody produced by a human or an antibody having an amino acid sequence corresponding to an antibody produced by a human, wherein the antibody produced by a human can be made using any technique known in the art.

When used in reference to an antibody, the term "heavy chain" refers to an about 50-70kDa polypeptide chain in which the amino terminal portion comprises a variable region of about 120-130 or more amino acids and the carboxy terminal portion comprises a constant region. Depending on the amino acid sequence of the heavy chain constant region, the constant region can be one of five different types, called alpha (a), delta (δ), epsilon (ε), gamma (γ), and mu (μ). The different heavy chains vary in size: alpha, delta, and gamma comprise about 450 amino acids, while mu and epsilon comprise about 550 amino acids. When combined with light chains, these different types of heavy chains produce five well-known classes of antibodies, igA, igD, igE, igG, and IgM, respectively, including four subclasses of IgG, referred to as IgGl, igG2, igG3, and IgG4. The heavy chain may be a human heavy chain.

The term "light chain" when used in reference to an antibody refers to an about 25kDa polypeptide chain, wherein the amino terminal portion comprises a variable region of about 100 to about 110 or more amino acids and the carboxy terminal portion comprises a constant region. The light chain is about 211 to 217 amino acids in length. Depending on the amino acid sequence of the constant region, there are two different types of light chains, called kappa (κ) and lambda (λ). The amino acid sequence of light chains is well known in the art. The light chain may be a human light chain.

The term "variable domain" or "variable region" refers to a portion of a light or heavy chain of an antibody, which is typically located at the amino terminus of the light or heavy chain, and has a length of about 120 to 130 amino acids in the heavy chain and a length of about 100 to 110 amino acids in the light chain, which is used for the binding and specificity of each particular antibody for its particular antigen. The variable domains differ greatly in sequence between different antibodies. The variability of the sequence is concentrated in the CDRs, and the less variable portions of the variable domains are called Framework Regions (FRs). The CDRs of the light and heavy chains are primarily responsible for the interaction between the antibody and the antigen. Amino acid position numbering as used herein is according to the EU index, kabat et al, (1991) Sequences of proteins of immunological interest, (U.S. department of Health and Human Services, washington, D.C.) 5 the. The variable region may be a human variable region.

One CDR refers to one of the three hypervariable regions (H1, H2 or H3) in the non-framework region of the β -sheet framework in an immunoglobulin (Ig or antibody) VH, or one of the three hypervariable regions (L1, L2 or L3) in the non-framework region of the β -sheet framework of an antibody VL. Thus, a CDR is a variable region sequence interspersed within a framework region sequence. CDR regions are well known to those skilled in the art and have been defined by a variety of methods/systems. These systems and/or definitions have been developed and perfected over the years and include Kabat, chothia, IMGT, abM, and Contact. For example, kabat defines the region of highest variability within the variable (V) domain of an antibody ((Kabat et Al, J.biol.chem.252:6609-6616 (1977); the definition of Kabat, adv. Prot. Chem.32:1-75 (1978)). Chothia defines the CDR region sequences as those residues that do not belong to a conserved beta-sheet framework based on the positions of the structural loop regions, thereby enabling adaptation to different conformations (Chothia and Lesk, j. Mol. Biol.196:901-917 (1987)). Both terms are well known in the art. Furthermore, the IMGT system is based on sequence variability and positions within the variable region structure. AbM definition is a compromise between Kabat and Chothia.

For example, CDRs defined according to Kabat (high variability) or Chothia (structure) nomenclature are listed in the following table.

	Kabat ¹	Chothia ²	Loop Location
				VH CDRl	31-35	26-32	linking B and C strands
VH CDR2	50-65	53-55	linking C’and C”strands
				VH CDR3	95-102	96-101	linking F and G strands
VL CDRl	24-34	26-32	linking B and C strands
				VL CDR2	50-56	50-52	linking C’and C”strands
VL CDR3	89-97	91-96	linking F and G strands

¹ Residue numbering follows the nomenclature of Kabat et al, supra

² Residue numbering follows the nomenclature of Chothia et al, supra

One or more CDRs may also be covalently or non-covalently incorporated into the molecule, making it an immunoadhesin. Immunoadhesins can have CDRs as part of a larger polypeptide chain, can covalently link CDRs to another polypeptide chain, or can non-covalently bind CDRs. The CDRs enable the immunoadhesin to bind to a specific antigen. CDR regions can be accessed, for example, through the abysis website (http:// abysis.org/) And (6) carrying out analysis.

Thus, unless otherwise specified, a CDR or separately designated CDRs (e.g., VL CDR1, VL CDR2, VL CDR 3), e.g., variable regions thereof, of a given antibody or region thereof is understood to comprise any (or particular) complementarity determining region of the above-described protocol or other known protocols. For example, when it is stated that a particular CDR (e.g., VH CDR 3) comprises the amino acid sequence of the corresponding CDR in a given VH or VL region, it is understood that such CDR has the sequence of the corresponding CDR (e.g., CDR-H3) within the variable region, as defined in any of the schemes above or other known schemes. In some embodiments, although specific CDR sequences are specified, it is understood that the provided antibodies can include CDRs according to the above-described or other numbering schemes known to those skilled in the art. Likewise, unless otherwise specified, a FR or FR designated individually (e.g., VH FRl, VH FR2, VH FR3, VH FR 4) for a given antibody or region thereof (e.g., a variable region thereof) is understood to include a (or particular) framework region as defined by any known protocol.

The terms "epitope" and "antigenic determinant" are used interchangeably herein to refer to a site on the surface of a target molecule to which an antibody or antigen-binding fragment binds, e.g., a localized region on the surface of an antigen. The target molecule may comprise a protein, peptide, nucleic acid, carbohydrate or lipid. An immunologically active epitope is a portion of a target molecule that induces an immune response in an animal. An epitope of a target molecule having antigenic activity is the portion of the target molecule to which an antibody binds, as determined by any method known in the art, including, for example, by immunoassay. An antigenic epitope need not be immunogenic. Epitopes usually consist of chemically active surface groups of molecules such as amino acids or sugar side chains, with specific three-dimensional structural characteristics and specific charge characteristics. The term "epitope" includes linear epitopes and conformational epitopes. A region of a target molecule (e.g., a polypeptide) that can be an epitope can be contiguous amino acids of the polypeptide, or can be from an aggregation of two or more non-contiguous regions of the target molecule. The epitope may or may not be a three-dimensional surface feature of the target molecule. Epitopes formed by contiguous amino acids (also known as linear epitopes) are typically retained when the protein is denatured, while epitopes formed by tertiary folding (also known as conformational epitopes) are typically lost when the protein is denatured. An epitope typically comprises at least 3, more typically at least 5, 6, 7 or 8-10 amino acids in a unique spatial conformation.

The term "specifically binds" as used herein refers to a polypeptide or molecule that is bound to an epitope, protein or target molecule as compared to other substances (including phase)Related and unrelated proteins) to interact more frequently and more rapidly with longer duration, greater affinity, or a combination thereof. Binding moieties (e.g., antibodies) that specifically bind to a target molecule (e.g., an antigen) can be determined, for example, by immunoassay, ELISA, SPR (e.g., biacore), or other techniques known to those skilled in the art. Typically, the specified response is at least twice that of the background signal or noise, and may be more than 10 times that of the background. See, e.g., paul, ed.,1989,Fundamental Immunology Second Editionraven Press, new York at pages 332-336, a discussion of antibody specificity. A binding moiety that specifically binds a target molecule, which can have a higher affinity for the target molecule than for other molecules. In some embodiments, a binding moiety that specifically binds to a target molecule may have at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, or at least 100-fold greater affinity for the target molecule than for other molecules. In some embodiments, a binding moiety that specifically binds a particular target molecule binds to other molecules with such low affinity that binding is undetectable by assays described herein or known in the art. In some embodiments, "specific binding" means, e.g., that the binding moiety has a K of about 0.1mM or less _D The values bind to the molecular target. In some embodiments, "specifically binds" means that the polypeptide or molecule has a K of about 10. Mu.M or less, or about 1. Mu.M or less _D The values bind to the target. In some embodiments, "specifically binds" means that the polypeptide or molecule has a K of about 0.1 μ M or less, about 0.01 μ M or less, or about 1nM or less _D The values bind to the target. Due to sequence identity between homologous proteins in different species, specific binding may include polypeptides or molecules that recognize proteins or targets in multiple species. Likewise, due to homology within certain regions of the polypeptide sequences of different proteins, specific binding may include polypeptides or molecules that recognize multiple proteins or targets. It is understood that in some embodiments, a binding moiety (e.g., an antibody) that specifically binds a first target molecule may or may not bind a second target. Thus, "specificityBinding "is not necessarily (although it may include) binding alone, i.e. binding to a single target. Thus, in some embodiments, a binding moiety (e.g., an antibody) can specifically bind multiple targets. For example, in certain instances, an antibody may comprise two identical antigen binding sites, each site specifically binding to the same epitope on two or more proteins. In certain alternative embodiments, the antibody may be bispecific and include at least two antigen binding sites with different specificities.

The term "binding affinity" as used herein generally refers to the strength of the sum of non-covalent interactions between a binding moiety and a target molecule (e.g., an antigen). Binding of the binding moiety to the target molecule is a reversible process, and the affinity of the binding is generally reported as the equilibrium dissociation constant (K) _D )。K _D Is the dissociation rate (k) _off Or k _d ) And the rate of binding (k) _on Or k _a ) Is measured in the measurement. K of a binding pair _D The lower the affinity, the higher. A variety of methods for measuring binding affinity are known in the art, any of which may be used in the present invention. Specific illustrative embodiments include the following. In some embodiments, "K _D "or" K _D The value "can be determined by assays known in the art, for example by binding. K _D Can be measured in a radiolabeled antigen binding assay (RIA) (Chen, et al, (1999) J.mol Biol 293. Said K _D Or K _D Values may also be analyzed by surface plasmon resonance using Biacore, for example using BIAcore TM-2000 or BIAcore TM-3000 (Biacore, inc., piscataway, NJ) or using biolayer interferometry, for example the OctetQK384 system (ForteBio, menlo Park, calif.).

The term "variant" as used herein in relation to a protein or polypeptide having a particular sequence feature ("reference protein" or "reference polypeptide"), refers to a different protein or polypeptide having one or more (e.g., about 1 to about 25, about 1 to about 20, about 1 to about 15, about 1 to about 10, or about 1 to about 5) amino acid substitutions, deletions, and/or additions as compared to the reference protein or reference polypeptide. The change in amino acid sequence may be an amino acid substitution. Changes in amino acid sequence may be conservative amino acid substitutions. A functional fragment or functional variant of a protein or polypeptide retains the basic structural and functional properties of the reference protein or polypeptide.

The terms "polypeptide", "peptide", "protein" and grammatical equivalents thereof, as used interchangeably herein, refer to a polymer of amino acids of any length, which may be linear or branched. It may include non-natural or modified amino acids, or be interrupted by non-amino acids. The polypeptide, peptide or protein may also be modified, for example by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification.

The terms "polynucleotide", "nucleic acid" and grammatical equivalents thereof, used interchangeably herein, refer to a polymer of nucleotides of any length, including DNA and RNA. The nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or may be bound to any substrate in the polymer by DNA or RNA polymerase.

The term "identity," percent "identity," and grammatical equivalents thereof, as used herein in the context of two or more polynucleotides or polypeptides, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, regardless of any conservative amino acid substitutions as part of sequence identity, when compared and aligned (gaps introduced, if necessary) to obtain maximum correspondence. The percentage of sequence can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software that can be used to obtain an amino acid or nucleotide sequence alignment are well known in the art. These algorithms or software include, but are not limited to, BLAST, ALIGN, megalign, bestFit, GCG Wisconsin Package, and variants thereof. In some embodiments, the two polynucleotides or polypeptides provided herein are substantially identical, meaning that they have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, and in some embodiments at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% nucleotide or amino acid residue identity when compared and aligned for maximum correspondence using a sequence comparison algorithm or by visual inspection. In some embodiments, there is identity over a region of an amino acid sequence that is at least about 10 residues, at least about 20 residues, at least about 40-60 residues, at least about 60-80 residues, or any integer value therebetween in length. In some embodiments, identity exists over a region that is longer than 60-80 residues, e.g., at least about 80-100 residues, and in some embodiments, the sequences are substantially identical over the entire length of the sequences compared, e.g., the coding region of the protein or antibody of interest. In some embodiments, identity exists over a region of a nucleotide sequence that is at least about 10 bases in length, at least about 20 bases in length, at least about 40-60 bases in length, at least about 60-80 bases in length, or any integer value in length between the two. In some embodiments, identity exists over a region that is longer than 60-80 bases, e.g., at least about 80-1000 bases or more, and in some embodiments, the sequences are substantially identical over the entire length of the sequences being compared (e.g., nucleotide sequences encoding the proteins of interest).

The term "vector" and its grammatical equivalents as used herein refers to a vector for carrying genetic material (e.g., a polynucleotide sequence) that can be introduced into a host cell where it can be replicated and/or expressed. Vectors that can be used include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which can include a selection sequence or marker operable for stable integration into the chromosome of the host cell. In addition, the vector may include one or more selectable marker genes and appropriate expression control sequences. The selectable marker gene that may be included can, for example, provide resistance to antibiotics or toxins, supplement auxotrophy, or provide key nutrients not present in the culture medium. The expression control sequences may include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like, which are well known in the art. When two or more polynucleotides are to be co-expressed, both polynucleotides may be inserted, for example, in a single expression vector or in separate expression vectors. For single vector expression, the encoding polynucleotides may be operably linked to a common expression control sequence, or may be linked to different expression control sequences, such as an inducible promoter and a constitutive promoter. Introduction of the polynucleotide into the host cell can be confirmed using methods well known in the art. One skilled in the art understands that a polynucleotide is expressed in sufficient quantity to produce a desired product (e.g., as described herein including an anti-CD 40BCMA antibody or antigen binding fragment thereof has), and further understands that the expression level can be optimized to obtain sufficient expression using methods well known in the art.

The term "chimeric antigen receptor" or "CAR" as used herein refers to an artificially constructed hybrid protein or polypeptide that contains a binding moiety (e.g., an antibody) linked to an immune cell (e.g., a T cell) signaling or activation domain. In some embodiments, the CAR is a synthetic receptor capable of retargeting T cells to tumor surface antigens (Sadelain et al, nat. Rev. Cancer.3 (1): 35-45 (2003); sadelain et al, cancer Discovery 3 (4): 388-398 (2013)). The CAR can provide antigen binding and immune cell activation functions for immune cells (e.g., T cells). CARs are able to redirect T cell specificity and reactivity to selected targets in a non-MHC-restricted manner, taking advantage of the antigen binding properties of monoclonal antibodies. non-MHC restricted antigen recognition may enable CAR-expressing T cells to have antigen recognition capabilities independent of antigen processing, thereby avoiding tumor escape mechanisms.

The term "genetic engineering" or grammatical equivalents thereof, when used in reference to a cell, means an alteration of the genetic material of the cell that is not normally present in a naturally occurring cell. Genetic alterations include, for example, modifications introduced into the expressible polynucleotide, other additions, mutations/alterations, deletions and/or other functional disruptions of the cellular gene. Such modifications can be made, for example, in the coding region of the gene and functional fragments thereof. Additional modifications can be made, for example, in non-coding regulatory regions, wherein the modification alters expression of the gene.

The terms "transfer," "transduction," "transfection," and grammatical equivalents thereof, as used herein, refer to the process of introducing an exogenous polynucleotide into a host cell. A "transferred," "transfected" or "transduced" cell refers to a cell that has been transferred, transduced or transfected with an exogenous polynucleotide. The cells include primary recipient cells and their progeny. Polynucleotides may be "transferred" into a host cell using any type of method known in the art, including chemical, physical, or biological methods. Polynucleotides are typically "transduced" into a host cell using a virus. In contrast, polynucleotides are typically "transfected" into host cells using non-viral methods. These terms are sometimes used interchangeably and, when used in context, their meanings are readily understood by one of ordinary skill in the art.

As used herein, the term "encode" and grammatical equivalents thereof refer to the inherent nature of a particular nucleotide sequence in a polynucleotide or nucleic acid, such as a gene, cDNA, or mRNA, that serves as a template for the synthesis of other polymers and macromolecules having a particular nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a particular amino acid sequence in a biological process, and the biological properties resulting therefrom. Thus, if transcription and translation of the mRNA corresponding to the gene produces a protein, the gene encodes the protein. Unless otherwise indicated, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate with respect to one another or that encode the same amino acid sequence. Nucleotide sequences encoding proteins and RNAs may include introns.

An "isolated" polypeptide, peptide, protein, antibody, polynucleotide, vector, cell, or composition is in the form of a polypeptide, peptide, protein, antibody, polynucleotide, vector, cell, or composition not found in nature. An isolated polypeptide, protein, antibody, polynucleotide, vector, cell or composition includes those polypeptides, peptides, proteins, antibodies, polynucleotides, vectors, cells or compositions that have been purified to an extent that they no longer exist in the form found in nature. In some embodiments, the isolated polypeptide, peptide, protein, antibody, polynucleotide, vector, cell, or composition is substantially purified.

As used herein and as understood in the art, "immune effector cell" refers to a cell that has hematopoietic origin and plays a direct role in an immune response against a target, such as a pathogen, cancer cell, or foreign substance. Immune effector cells include T cells, B cells, natural Killer (NK) cells, NKT cells, macrophages, granulocytes, neutrophils, eosinophils, mast cells, and basophils.

As used herein, the term "treating" and grammatical equivalents thereof, in relation to a disease or disorder, or a subject having a disease or disorder, refers to the act of inhibiting, eliminating, reducing, and/or ameliorating symptoms, symptom severity, and/or symptom frequency associated with the disease or disorder being treated. For example, when referring to a cancer or tumor, the term "treating" and grammatical equivalents thereof, refers to the act of reducing the severity of, or delaying or slowing the progression of, the cancer or tumor, including (a) inhibiting the growth or arresting the development of the cancer or tumor, (b) causing regression of the cancer or tumor, or (c) delaying, ameliorating, or minimizing one or more symptoms associated with the presence of the cancer or tumor.

The term "administration" and grammatical equivalents thereof as used herein refers to the act of delivering or causing the delivery of a therapeutic agent or pharmaceutical composition to the body of a subject by the methods described herein or other methods known in the art. The therapeutic agent may be a compound, polypeptide, cell, or population of cells. Administering the therapeutic agent or pharmaceutical composition comprises prescribing delivery of one of the therapeutic agent or pharmaceutical composition to the subject. Typical forms of administration include oral dosage forms such as tablets, capsules, syrups, suspensions; injectable dosage forms, such as Intravenous (IV), intramuscular (IM), or Intraperitoneal (IP); transdermal dosage forms, including creams, gels, powders or patches; an oral dosage form; inhalation powders, sprays, suspensions, and rectal suppositories.

As used herein, the terms "effective amount," "therapeutically effective amount," and grammatical equivalents thereof, refer to an amount administered to a subject alone or as part of a pharmaceutical composition, in a single dose, or as part of a series of doses, that is capable of having any detectable positive effect on any symptom, aspect, or feature of a disease, disorder, or condition when administered. A therapeutically effective amount can be determined by measuring the relevant physiological effects. The exact amount required will vary from subject to subject, depending on the age, weight and general condition of the subject, the severity of the condition being treated, the judgment of the clinician, and the like. An appropriate "effective amount" in any individual case can be determined by one of ordinary skill in the art using routine experimentation.

The term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to a material suitable for administration to an individual with an active agent without causing undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition.

The term "subject" as used herein refers to any animal (e.g., a mammal), including but not limited to humans, non-human primates, dogs, felines, rodents, etc., which is the animal to be subjected to a particular treatment. The subject may be a human. The subject may be a patient suffering from a particular disease or disorder.

The term "autologous" as used herein refers to any material that is derived from the same individual and subsequently reintroduced into the individual.

The term "allogenic" as used herein refers to grafts derived from different individuals of the same species.

The range is as follows: throughout this disclosure, various aspects of the present invention may be presented in a range format. It is to be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention.

Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, describing a range from 1 to 6 should be considered to have disclosed sub-ranges, such as from 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within that range, such as 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.

Exemplary genes and polypeptides are described herein with reference to GenBank accession numbers, GI accession numbers, and/or SEQ ID NOs. It is understood that homologous sequences can be readily identified by one skilled in the art by reference to sequence sources including, but not limited to, genBank (ncbi.

5.2 anti-BCMA antibodies and antigen binding fragments

The invention provides antibodies or antigen-binding fragments thereof that specifically bind BCMA (e.g., human BCMA). In some embodiments, the invention provides anti-BCMA antibodies. In some embodiments, the antibody is an IgA, igD, igE, igG, or IgM antibody. In some embodiments, the antibody is an IgA antibody. In some embodiments, the antibody is an IgD antibody. In some embodiments, the antibody is an IgE antibody. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgM antibody. In some embodiments, the antibodies provided herein can be IgG1 antibodies, igG2 antibodies, igG3 antibodies, or IgG4 antibodies. In some embodiments, the antibody is an IgG1 antibody. In some embodiments, the antibody is an IgG2 antibody. In some embodiments, the antibody is an IgG3 antibody. In some embodiments, the antibody is an IgG4 antibody.

In some embodiments, the invention provides antigen binding fragments of anti-BCMA antibodies. In some embodiments, the antigen-binding fragments provided herein can be single domain antibodies (sdabs), heavy chain antibodies (hcabs), fabs, fab ', F (ab') ₂ Fv, single chain variable fragment (scFv) or (scFv) ₂ . In some embodiments, the antigen-binding fragment of the anti-BCMA antibody is a single domain antibody (sdAb). In some embodiments, the antigen-binding fragment of the anti-BCMA antibody is a heavy chain antibody (HCAb). In some embodiments, the antigen binding fragment of the anti-BCMA antibody is a Fab. In some embodiments, the antigen binding fragment of the anti-BCMA antibody is a Fab'. In some embodiments, the antigen binding fragment of an anti-BCMA antibody is F (ab') ₂ . In some embodiments, the antigen-binding fragment of the anti-BCMA antibody is an Fv. In some embodiments, theThe antigen-binding fragment of the anti-BCMA antibody is scFv. In some embodiments, the antigen-binding fragment of the anti-BCMA antibody is a disulfide-linked scFv [ (scFv) ₂ ]. In some embodiments, the antigen-binding fragment of an anti-BCMA antibody is a bispecific antibody (dAb).

In some embodiments, the anti-BCMA antibodies or antigen-binding fragments provided by the present invention include recombinant antibodies or antigen-binding fragments. In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the present invention comprise monoclonal antibodies or antigen binding fragments. In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the invention include polyclonal antibodies or antigen binding fragments. In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the invention include camelidae (e.g., camel, dromedary, and llama) antibodies or antigen binding fragments. In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the invention include chimeric antibodies or antigen binding fragments. In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the present invention include humanized antibodies or antigen binding fragments. In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the present invention comprise human antibodies or antigen binding fragments. In some embodiments, the invention provides human scFv against BCMA.

In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the invention are isolated antibodies or antigen binding fragments. In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the invention are substantially purified.

In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the invention include multispecific antibodies or antigen binding fragments. In some embodiments, the anti-BCMA antibodies or antigen-binding fragments provided by the present invention include bispecific antibodies or antigen-binding fragments. In some embodiments, the invention provides a bispecific T cell engager (BiTE). BiTE is a bispecific antibody that binds to a T cell antigen (e.g., CD 3) and a tumor antigen. BiTE has been shown to induce targeted lysis of targeted tumor cells, providing a vast potential therapy for cancer and other diseases. In some embodiments, the invention provides BiTE that specifically binds CD3 and BCMA. In some embodiments, the BiTE comprises an anti-BCMA antibody or antigen binding fragment provided by the invention. In some embodiments, the BiTE comprises an scFv against BCMA provided by the invention.

In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the present invention comprise a monovalent antigen binding site. In some embodiments, the anti-BCMA antibody or antigen binding fragment comprises a monospecific binding site. In some embodiments, the anti-BCMA antibody or antigen binding fragment comprises a bivalent binding site.

In some embodiments, the anti-BCMA antibody or antigen binding fragment is a monoclonal antibody or antigen binding fragment. Monoclonal antibodies can be prepared by any method known to those skilled in the art. One exemplary method is to screen protein expression libraries, such as phage or ribosome display libraries. Phage display is described, for example, in Ladner et al, U.S. Pat. nos. 5,223,409; smith (1985) Science 228; and WO 92/18619. In some embodiments, recombinant monoclonal antibodies are isolated from phage display libraries capable of expressing the variable regions or CDRs of the desired species. Screening of phage libraries can be accomplished by a variety of techniques known in the art.

In some embodiments, monoclonal antibodies are prepared using hybridoma methods known to those of skill in the art. For example, using the hybridoma method, mice, rats, rabbits, hamsters or other suitable host animals are immunized as described above. In some embodiments, the lymphocytes are immunized in vitro. In some embodiments, the immunizing antigen is a human protein or fragment thereof. In some embodiments, the immunizing antigen is a human protein or fragment thereof.

Following immunization, lymphocytes are isolated and fused with a suitable myeloma cell line using, for example, polyethylene glycol. Hybridoma cells are selected using specialized media known in the art, and unfused lymphocytes and myeloma cells do not survive the selection process. Hybridomas that produce monoclonal antibodies to a selected antigen can be identified by a variety of methods, including but not limited to immunoprecipitation, immunoblotting, and in vitro binding assays (e.g., flow cytometry, FACS, ELISA, SPR (e.g., biacore), and radioimmunoassay). Once hybridoma cells producing the desired specificity, affinity, and/or activity antibodies are identified, the clones may be subcloned by limiting dilution or other techniques. Hybridomas can be propagated in vitro in culture using standard methods, or in vivo as in animal ascites tumors. The monoclonal antibodies can be purified from the culture medium or ascites fluid according to standard methods in the art, including but not limited to affinity chromatography, ion exchange chromatography, gel electrophoresis, and dialysis.

In some embodiments, monoclonal antibodies are prepared using recombinant DNA techniques known to those skilled in the art. For example, polynucleotides encoding the antibody are isolated from mature B cells or hybridoma cells, and the genes encoding the heavy and light chains of the antibody are specifically amplified by, e.g., RT-PCR using oligonucleotide primers and their sequences determined using standard techniques. The isolated polynucleotides encoding the heavy and light chains are then cloned into a suitable expression vector that produces monoclonal antibodies when transfected into a host cell such as e.coli, simian COS cells, chinese Hamster Ovary (CHO) cells, or myeloma cells, but otherwise does not produce immunoglobulins.

In some embodiments, the monoclonal antibodies are modified by using recombinant DNA techniques to generate surrogate antibodies. In some embodiments, the light and heavy chain constant regions of the mouse monoclonal antibody are replaced with the constant regions of a human antibody to produce a chimeric antibody. In some embodiments, the constant regions are truncated or removed to generate antibody fragments of the desired monoclonal antibody. In some embodiments, site-directed or high-density mutagenesis of the variable regions is used to optimize the specificity and/or affinity of the monoclonal antibody.

In some embodiments, the anti-BCMA antibody or antigen binding fragment is a humanized antibody or antigen binding fragment. Various methods for making humanized antibodies are known in the art. Methods for achieving high affinity binding to humanized antibodies are known in the art. One non-limiting example of such a method is the hypermutation of the variable region and the selection of cells expressing such high affinity antibodies (affinity maturation). In addition to the use of display libraries, specific antigens (e.g., recombinant BCMA or epitopes thereof) can be used to immunize non-human animals, e.g., rodents. In certain embodiments, rodent antigen-binding fragments (e.g., mouse antigen-binding fragments) can be prepared and isolated using methods known in the art and/or disclosed herein. In some embodiments, the mouse may be immunized with an antigen (e.g., recombinant BCMA or an epitope thereof).

In some embodiments, the anti-BCMA antibody or antigen binding fragment is a human antibody or antigen binding fragment. Human antibodies can be made using various techniques known in the art. In some embodiments, the human antibody is produced by immortalized human B lymphocytes immunized in vitro. In some embodiments, the human antibody is produced by lymphocytes isolated from an immunized individual. In any case, cells producing antibodies against the target antigen can be prepared and isolated. In some embodiments, the human antibody is selected from a phage library, wherein the phage library expresses the human antibody. Alternatively, phage display technology can be used to produce human antibodies and antibody fragments in vitro from immunoglobulin variable region gene libraries from unimmunized donors. Techniques for generating and using antibody phage libraries are well known in the art. Once antibodies are identified, affinity maturation techniques known in the art can be used to produce higher affinity human antibodies, including but not limited to chain replacement and site-directed mutagenesis. In some embodiments, human antibodies are produced in transgenic mice containing human immunoglobulin loci. After immunization, these mice are capable of producing fully human antibodies without endogenous immunoglobulin production.

The specific CDR sequences defined in the present invention are generally based on the combination defined by Kabat and Chothia. However, it is understood that reference to one or more heavy chain CDRs, and/or one or more light chain CDRs, of a specific antibody includes all CDR definitions known to those skilled in the art.

The anti-BCMA antibody or antigen binding fragment provided by the invention comprises the following clones: BCMA31. The sequence characteristics are as follows.

In some embodiments, the anti-BCMA antibody or antigen binding fragment provided by the invention comprises one, two, three, four, five, and/or six CDRs of any one of the antibodies described herein. In some embodiments, the anti-BCMA antibodies or antigen-binding fragments provided by the present invention comprise a VL comprising one, two, and/or three VL CDRs of table 1. In some embodiments, the anti-BCMA antibodies or antigen-binding fragments provided by the present invention comprise a VH comprising one, two, and/or three VH CDRs of table 2. In some embodiments, the anti-BCMA antibodies or antigen binding fragments provided by the invention comprise one, two, and/or three VL CDRs from table 1 and one, two, and/or three VH CDRs from table 2.

TABLE 1 amino acid sequence of light chain variable region CDR (VL CDR) of BCMA31

TABLE 2 amino acid sequence of heavy chain variable region CDR (VH CDR) of BCMA31

In some embodiments, the anti-BCMA antibody or antigen-binding fragment thereof comprises a humanized antibody or antigen-binding fragment. In some embodiments, the anti-BCMA antibody or antigen binding fragment thereof comprises VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and/or VH CDR3 of the antibody or antigen binding fragment of the invention. In some embodiments, the anti-BCMA antibody or antigen-binding fragment thereof comprises a variant of the antibody or antigen-binding fragment of the invention. In some embodiments, the variant of the anti-BCMA antibody or antigen binding fragment comprises a substitution, addition and/or deletion of 1 to 30 amino acids in the anti-BCMA antibody or antigen binding fragment. In some embodiments, the variant of the anti-BCMA antibody or antigen binding fragment comprises a substitution, addition and/or deletion of 1 to 25 amino acids in the anti-BCMA antibody or antigen binding fragment. In some embodiments, the variant of the anti-BCMA antibody or antigen binding fragment comprises a substitution, addition and/or deletion of 1 to 20 amino acids in the anti-BCMA antibody or antigen binding fragment. In some embodiments, the variant of the anti-BCMA antibody or antigen binding fragment comprises a substitution, addition and/or deletion of 1 to 15 amino acids in the anti-BCMA antibody or antigen binding fragment. In some embodiments, the variant of the anti-BCMA antibody or antigen binding fragment comprises a substitution, addition and/or deletion of 1 to 10 amino acids in the anti-BCMA antibody or antigen binding fragment. In some embodiments, the variant of the anti-BCMA antibody or antigen-binding fragment comprises a substitution, addition, and/or deletion of 1 to 5 conserved amino acids in the anti-BCMA antibody or antigen-binding fragment. In some embodiments, the variant of the anti-BCMA antibody or antigen binding fragment comprises a substitution, addition and/or deletion of 1 to 3 amino acids in the anti-BCMA antibody or antigen binding fragment. In some embodiments, the substitution, addition, and/or deletion of an amino acid is a conservative amino acid substitution. In some embodiments, the conservative amino acid substitution is in a CDR of the antibody or antigen-binding fragment. In some embodiments, the conservative amino acid substitution is not in a CDR of the antibody or antigen-binding fragment. In some embodiments, the substitution of a conserved amino acid is in a framework region of the antibody or antigen-binding fragment.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising a light chain variable region (VL) comprising (1) a light chain CDR1 (VL CDR 1) having the amino acid sequence set forth in SEQ ID NO: 8; (2) A light chain CDR2 (VL CDR 2) having an amino acid sequence set forth in SEQ ID NO: 18; or (3) a light chain CDR3 (VL CDR 3) having an amino acid sequence set forth in SEQ ID NO: 28; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VL CDR. In some embodiments, the variant has substitutions, additions and/or deletions of about 5 amino acids in the VL CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising a VL comprising (1) a VL CDR1 having an amino acid sequence set forth in SEQ ID NO: 8; (2) VL CDR2 having an amino acid sequence shown by SEQ ID NO. 18; and (3) a VL CDR3 having an amino acid sequence set forth by SEQ ID NO. 28; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VL CDR. In some embodiments, the variant has a substitution, addition, and/or deletion of up to about 5 amino acids in the VL CDR.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising a heavy chain variable region (VH) comprising (1) heavy chain CDR1 (VH CDR 1) having the amino acid sequence set forth in SEQ ID NO: 39; (2) Heavy chain CDR2 (VH CDR 2) having an amino acid sequence set forth in SEQ ID NO: 51; or (3) a heavy chain CDR3 (VH CDR 3) having an amino acid sequence set forth in SEQ ID NO: 63; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VH CDRs. In some embodiments, the variant has up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising a VH comprising (1) a VH CDR1 having the amino acid sequence shown by SEQ ID NO: 39; (2) VH CDR2 having an amino acid sequence shown by SEQ ID NO: 51; and (3) a VH CDR3 having an amino acid sequence shown by SEQ ID NO: 63; or a variant thereof having up to about 3, about 5, about 8, about 10, about 12, or about 15 amino acid substitutions, additions and/or deletions in the VH CDRs. In some embodiments, the variant has up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising (a) a VL comprising (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID NO: 8; (2) VL CDR2 having an amino acid sequence shown by SEQ ID NO. 18; and (3) a VL CDR3 having an amino acid sequence shown by SEQ ID NO 28; or a variant thereof having substitutions, additions and/or deletions of up to about 5 amino acids; and (b) a VH comprising (1) a VH CDR1 having an amino acid sequence shown by SEQ ID NO: 39; (2) VH CDR2 having an amino acid sequence consisting of SEQ ID NO 51; and (3) a VH CDR3 having an amino acid sequence shown by SEQ ID NO: 63; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA) having a VL, wherein the VL comprises VL CDR1, CDR2, and CDR3, wherein the VL CDR1, CDR2, and CDR3 have the amino acid sequences set forth in

SEQ ID NOs

8, 18, and 28, respectively; or a variant thereof having up to about 3, 5, 8, 10, 12, or 15 amino acid substitutions, additions, and/or deletions in the VL CDRs. In some embodiments, the variant has a substitution, addition, and/or deletion of up to about 5 amino acids in the VL CDR.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA) having a VH, wherein the VH comprises VH CDR1, CDR2, and CDR3, the VH CDR1, CDR2, and CDR3 having the amino acid sequences set forth in

SEQ ID NOs

39, 51, and 63, respectively; or a variant thereof having up to about 3, 5, 8, 10, 12, or 15 amino acid substitutions, additions, and/or deletions in the VH CDRs. In some embodiments, the variant has up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), having a VL and a VH. In some embodiments, the VL and VH are connected by a linker. The linker may be a flexible linker or a rigid linker. In some embodiments, the linker has an amino acid sequence of (GGGGS) n, n =1, 2, 3, 4 or 5 (SEQ ID NO: 155). In some embodiments, the linker has an amino acid sequence of (EAAAK) n, n =1, 2, 3, 4, or 5 (SEQ ID NO: 156). In some embodiments, the linker has an amino acid sequence of (PA) nP, n =1, 2, 3, 4, or 5 (SEQ ID NO: 157). In some embodiments, the linker has the amino acid sequence GGGGSGGGGSGGGS (SEQ ID NO: 158).

In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind BCMA (e.g., human BCMA) have a VL and a VH, wherein (a) the VL comprises a VL CDR1, CDR2, and CDR3, the VL CDR1, CDR2, and CDR3 having the amino acid sequences set forth in

SEQ ID NOs

8, 18, and 28, respectively; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDRs; and (b) the VH comprises VH CDR1, CDR2 and CDR3, the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NO:39, 51 and 63 respectively; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA) having a VL and a VH, wherein the VL comprises a VL CDR1, CDR2, and CDR3, and the VH comprises a VH CDR1, CDR2, and CDR3, wherein the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 have the amino acid sequences set forth in

SEQ ID NOs

8, 18, 28, 39, 51, and 63, respectively; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in these CDRs.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA) having a VL that comprises (1) VL CDR1 having the amino acid sequence set forth in SEQ ID No. 8, (2) VL CDR2 having the amino acid sequence set forth in SEQ ID No. 18, or (3) VL CDR3 having the amino acid sequence set forth in SEQ ID No. 28. The VL can have a VL CDR1, a VL CDR2, and a VL CDR3, the VL CDR1, VL CDR2, and VL CDR3 having amino acid sequences shown in

SEQ ID NOs

8, 18, and 28, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA) having a VH comprising (1) a VH CDR1 having the amino acid sequence set forth in SEQ ID NO: 39; (2) VH CDR2 having an amino acid sequence shown as SEQ ID NO. 51; or (3) VH CDR3 having an amino acid sequence shown in SEQ ID NO: 63. The VH may have VH CDR1, VH CDR2 and VH CDR3, the VH CDR1, VH CDR2 and VH CDR3 having amino acid sequences shown in

SEQ ID Nos

39, 51 and 63, respectively. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising (a) VL comprising VL CDR1, VL CDR2, and VL CDR3, said VL CDR1, VL CDR2, and VL CDR3 having the amino acid sequences set forth in

SEQ ID NOs

8, 18, and 28, respectively; and (b) a VH comprising a VH CDR1, a VH CDR2 and a VH CDR3, said VH CDR1, VH CDR2 and VH CDR3 having the amino acid sequences shown in

SEQ ID Nos

39, 51 and 63.

In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind BCMA (e.g., human BCMA) provided by the present invention comprise a VL that has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID No. 75. In some embodiments, the antibodies or antigen-binding fragments thereof that specifically bind BCMA (e.g., human BCMA) provided by the present invention comprise a VH having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID No. 87.

TABLE 3 amino acid sequences of BCMA31 light chain variable regions (VLs) and heavy chain variable regions (VHs)

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising: (a) A VL having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to the sequence set forth in SEQ ID NO 75; and (b) a VH having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID No. 87.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA) comprising a VL, wherein the VL has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID No. 75. In some embodiments, the anti-BCMA antibody or antigen-binding fragment thereof comprises a VL having at least 85% sequence identity to the sequence set forth in SEQ ID NO 75. In some embodiments, the anti-BCMA antibody or antigen-binding fragment thereof comprises a VL having at least 90% sequence identity to the sequence set forth in SEQ ID No. 75. In some embodiments, the anti-BCMA antibody or antigen-binding fragment thereof comprises a VL having at least 95% sequence identity to the sequence set forth in SEQ ID NO: 75. In some embodiments, the anti-BCMA antibody or antigen-binding fragment thereof comprises a VL having at least 98% sequence identity to the sequence set forth in SEQ ID No. 75. In some embodiments, the anti-BCMA (e.g., human BCMA) antibodies or antigen-binding fragments thereof provided herein comprise a VL having an amino acid sequence set forth in SEQ ID NO: 75.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA) comprising a VH, wherein said VH has at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in SEQ ID No. 87. In some embodiments, the anti-BCMA antibody or antigen-binding fragment thereof comprises a VH having at least 85% sequence identity to the sequence set forth in SEQ ID NO: 87. In some embodiments, the anti-BCMA antibody or antigen-binding fragment thereof comprises a VH having at least 90% sequence identity to the sequence set forth in SEQ ID NO: 87. In some embodiments, the anti-BCMA antibody or antigen binding fragment thereof comprises a VH having at least 95% sequence identity to the sequence set forth in SEQ ID No. 87. In some embodiments, the anti-BCMA antibody or antigen binding fragment thereof comprises a VH having at least 98% sequence identity to the sequence set forth in SEQ ID No. 87. In some embodiments, the anti-BCMA (e.g., human BCMA) antibodies or antigen binding fragments thereof provided by the invention comprise a VH having the amino acid sequence shown in SEQ ID No. 87.

The anti-BCMA antibody or antigen binding fragment thereof can comprise a combination of any VL disclosed herein and any VH disclosed herein. In some embodiments, the VL and VH are connected by a linker. The linker may be a flexible linker or a rigid linker. In some embodiments, the linker has an amino acid sequence of (GGGGS) n, n =1, 2, 3, 4 or 5 (SEQ ID NO: 155). In some embodiments, the linker has an amino acid sequence of (EAAAK) n, n =1, 2, 3, 4 or 5 (SEQ ID NO: 156). In some embodiments, the linker has an amino acid sequence of (PA) nP, n =1, 2, 3, 4, or 5 (SEQ ID NO: 157). In some embodiments, the linker has the amino acid sequence GGGGSGGGGSGGGS (SEQ ID NO: 158).

In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind BCMA (e.g., human BCMA) include a VL and a VH, wherein the VL and VH have the amino acid sequences set forth in SEQ ID NOs 75 and 87, respectively.

In some embodiments, the antibodies or antigen-binding fragments thereof provided herein that specifically bind BCMA (e.g., human BCMA) include (a) a VL comprising

VL CDRs

1, 2, and 3, the

VL CDRs

1, 2, and 3 derived from a VL having an amino acid sequence set forth in SEQ ID NO: 75; and/or (b) a VH comprising

VH CDRs

1, 2 and 3, said

VH CDRs

1, 2 and 3 derived from a VH having an amino acid sequence set forth by SEQ ID NO: 87. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising a VL, wherein the VL comprises

VL CDRs

1, 2, and 3, the

VL CDRs

1, 2, and 3 derived from a VL having an amino acid sequence set forth in SEQ ID NO: 75. In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising a VH, wherein the VH comprises

VH CDRs

1, 2, and 3, the

VH CDRs

1, 2, and 3 being derived from a VH having the amino acid sequence set forth in SEQ ID NO: 87.

In some embodiments, the invention provides an antibody or antigen-binding fragment thereof that specifically binds BCMA (e.g., human BCMA), comprising a VL and a VH, wherein the VL comprises a VL CDR1, CDR2, and CDR3, the VL CDR1, CDR2, and CDR3 are derived from a VL having the amino acid sequence set forth in SEQ ID No. 75, and the VH comprises a VH CDR1, CDR2, and CDR3, the VH CDR1, CDR2, and CDR3 are derived from a VH having the amino acid sequence set forth in SEQ ID No. 87.

In some embodiments, the anti-BCMA antibodies or antigen binding fragments thereof provided herein are scFv labeled BCMA31 (SEQ ID NO: 123). In some embodiments, the anti-BCMA antibodies or antigen binding fragments thereof provided by the present invention have at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% sequence identity to the sequence set forth in SEQ ID No. 123. In some embodiments, the anti-BCMA antibodies or antigen binding fragments thereof provided herein have a VL derived from BCMA31 (SEQ ID NO: 75). In some embodiments, the anti-BCMA antibodies or antigen binding fragments thereof provided herein have a VH derived from BCMA31 (SEQ ID NO: 87). The anti-BCMA antibody or antigen-binding fragment thereof provided by the present invention may have both VL and VH derived from BCMA 31. In some embodiments, the anti-BCMA antibodies or antigen-binding fragments thereof provided herein have a VL comprising

VL CDRs

1, 2 and 3, said

VL CDRs

1, 2 and 3 being derived from VL from BCMA31 (SEQ ID NO: 75). In some embodiments, the anti-BCMA antibodies or antigen-binding fragments thereof provided by the present invention have a VH comprising

VH CDRs

1, 2, and 3, the

VH CDRs

1, 2, and 3 being derived from the VH from BCMA31 (SEQ ID NO: 87). The anti-BCMA antibodies or antigen-binding fragments thereof provided by the present invention have a VL comprising

VL CDRs

1, 2, and 3 and a VH comprising

VH CDRs

1, 2, and 3, wherein the

VL CDRs

1, 2, and 3, and the

VH CDRs

1, 2, and 3 can be derived from the VL and VH from BCMA31, respectively. In some embodiments, the anti-BCMA antibody or antigen binding fragment thereof provided by the invention is a variant of BCMA 31. The BCMA31 variant can have a VL that is a variant of BCMA31 VL that has up to about 5 amino acid substitutions, additions, and/or deletions in the sequence set forth in SEQ ID No. 75. The BCMA31 variant may have a VH that is a variant of BCMA31 VH having up to about 5 amino acid substitutions, additions and/or deletions in the sequence shown in SEQ ID No. 87. The amino acid substitution, addition and/or deletion may occur in a VH CDR or a VL CDR. In some embodiments, the amino acid substitutions, additions and/or deletions are not in a CDR. In some embodiments, a variant of BCMA31 has up to about 5 conservative amino acid substitutions. In some embodiments, the variant of BCMA31 has up to about 3 conservative amino acid substitutions.

In some embodiments, the invention also provides antibodies or antigen-binding fragments that compete with the antibodies or antigen-binding fragments provided above for binding to BCMA (e.g., human BCMA). An antibody that "competes with another antibody for binding to a target" refers to an antibody that inhibits (partially or completely) the binding of another antibody to the target. Whether two antibodies compete with each other for binding to the target, i.e., whether and to what extent one antibody doesAnd inhibits the binding of another antibody to the target, can be performed using known competition assays (e.g.,

surface Plasmon Resonance (SPR) analysis). In some embodiments, an anti-BCMA antibody or antigen binding fragment competes with another antibody or antigen binding fragment by at least 50%, 60%, 70%, 80%, 90%, or 100% and inhibits binding of the other antibody or antigen binding fragment to BCMA. Competition assays can be performed as described, for example, in Ed Harlow and David Lane, cold Spring Harb protocol; 2006; i.e., l0.H0l/pdb.prot4277 or "Using Antibodies" Chapter 11, cold Spring Harbor Laboratory Press, cold Spring Harbor, NY, USA 1999, written by Ed Harlow and David Lane.

In some embodiments, the invention provides an antibody or antigen binding fragment that competes with BCMA31 for binding to BCMA.

The present invention further contemplates other variants and equivalents that are substantially homologous to the recombinant, monoclonal, chimeric, humanized and human antibodies or antibody fragments thereof described herein. In some embodiments, it is desirable to increase the binding affinity of the antibody. In some embodiments, it is desirable to modulate a biological property of an antibody, including but not limited to specificity, thermostability, expression level, effector function, glycosylation, immunogenicity, and/or solubility. One skilled in the art will appreciate that amino acid changes can alter post-translational processes of the antibody, such as altering the number or position of glycosylation sites or altering membrane anchoring properties.

The variation may be a substitution, deletion or insertion of one or more nucleotides encoding the antibody or polypeptide, which results in a change in the amino acid sequence relative to the native antibody or polypeptide sequence. In some embodiments, the amino acid substitution is the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the substitution of serine for leucine, e.g., a conservative amino acid substitution. Insertions or deletions may range from about 1 to 5 amino acids. In some embodiments, the substitution, deletion, or insertion comprises a substitution of less than 25 amino acids, a substitution of less than 20 amino acids, a substitution of less than 15 amino acids, a substitution of less than 10 amino acids, a substitution of less than 5 amino acids, a substitution of less than 4 amino acids, a substitution of less than 3 amino acids, or a substitution of less than 2 amino acids, relative to the parent molecule. In some embodiments, variations in biologically useful and/or related amino acid sequences can be determined by systematically making insertions, deletions, or substitutions in the sequence, and testing the resulting variant protein for activity as compared to the parent protein.

It is known in the art that the constant regions of antibodies mediate a number of effector functions, and these effector functions may vary depending on the isotype of the antibody. For example, the C1 region of complement binds to the Fc region of IgG or IgM antibodies (binds to antigen) to activate the complement system. Complement activation plays an important role in the opsonization and lysis of cellular pathogens. The activation of complement also stimulates inflammatory responses and is involved in autoimmune hypersensitivity. In addition, the Fc region of an antibody can bind to cells that express Fc receptors (fcrs). There are many Fc receptors that have specificity for different classes of antibodies, including IgG (gamma receptor), igE (epsilon receptor), igA (alpha receptor), and IgM (mu receptor). Binding of antibodies to cell surface Fc receptors triggers a number of important and diverse biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, killing of cells to lyse antibody-coated target cells (known as antibody-dependent cellular cytotoxicity or ADCC), release of inflammatory mediators, placental transfer, and control of immunoglobulin production. In some embodiments, an anti-BCMA antibody or antigen binding fragment according to the invention comprises at least the constant region of a human IgA antibody. In some embodiments, the anti-BCMA antibodies or antigen binding fragments of the invention comprise at least the constant region of a human IgD antibody. In some embodiments, the anti-BCMA antibody or antigen binding fragment of the invention comprises at least the constant region of a human IgE antibody. In some embodiments, the anti-BCMA antibody or antigen binding fragment of the invention comprises at least the constant region of a human IgG antibody. In some embodiments, the anti-BCMA antibodies or antigen binding fragments of the invention comprise at least one constant region of a human IgM antibody. In some embodiments, the anti-BCMA antibody or antigen binding fragment of the invention comprises at least the constant region of a human IgG1 antibody. In some embodiments, the anti-BCMA antibody or antigen binding fragment of the invention comprises at least the constant region of a human IgG2 antibody. In some embodiments, the anti-BCMA antibody or antigen binding fragment of the invention comprises at least the constant region of a human IgG3 antibody. In some embodiments, the anti-BCMA antibody or antigen binding fragment of the invention comprises at least the constant region of a human IgG4 antibody.

In some embodiments, at least one or more constant regions in an anti-BCMA antibody or antigen binding fragment of the invention have been modified or deleted. In some embodiments, the antibody comprises a modification of one or more of the three heavy chain constant regions (CH 1, CH2, or CH 3), and/or a modification of the light chain constant region (CL). In some embodiments, the heavy chain constant region of the modified antibody comprises at least one human constant region. In some embodiments, the heavy chain constant region of the modified antibody comprises more than one human constant region. In some embodiments, the modification to the constant region comprises an addition, deletion or substitution of one or more amino acids in one or more domains. In some embodiments, one or more domains are partially or completely deleted from the constant region of the modified antibody. In some embodiments, the entire CH2 domain (Δ CH2 construct) is removed from the antibody. In some embodiments, the deleted constant region is replaced with a short amino acid spacer region to provide some of the molecular flexibility normally provided by the deleted constant region. In some embodiments, the modified antibody comprises a CH3 domain fused directly to the hinge region of the antibody. In some embodiments, the modified antibody comprises a peptide spacer interposed between the hinge region and the modified CH2 and/or CH3 domain.

In some embodiments, the anti-BCMA antibody or antigen binding fragment comprises an Fc region. In some embodiments, the Fc region is fused by a hinge. The hinge may be an IgG1 hinge, an IgG2 hinge, or an IgG3 hinge. The amino acid sequences of the Fc region of human IgG1, igG2, igG3, and IgG4 are known to those of ordinary skill in the art. In some cases, fc regions with amino acid variations are found in native antibodies. In some embodiments, the modified antibody (e.g., modified Fc region) provides altered effector function, which in turn affects the biological properties of the antibody. For example, in some embodiments, deletion or inactivation of the constant region (by point mutation or other means) reduces binding of the modified antibody to Fc receptors during circulation. In some embodiments, the constant region modification reduces the immunogenicity of the antibody. In some embodiments, the constant region modification increases the serum half-life of the antibody. In some embodiments, the constant region modification reduces the serum half-life of the antibody. In some embodiments, the constant region modification reduces or removes ADCC and/or Complement Dependent Cytotoxicity (CDC) of the antibody. In some embodiments, substitution of specific amino acids in the human IgG1 Fc region with corresponding IgG2 or IgG4 residues reduces effector function (e.g., ADCC and CDC) in the modified antibody. In some embodiments, the antibody does not have one or more effector functions (e.g., a null effector antibody). In some embodiments, the antibody has no ADCC activity and/or no CDC activity. In some embodiments, the antibody does not bind to Fc receptors and/or complement factors. In some embodiments, the antibody has no effector function. In some embodiments, the constant region modification increases or enhances ADCC and/or CDC of the antibody. In some embodiments, the constant region is modified to eliminate disulfide bonds or oligosaccharide moieties. In some embodiments, the constant region is modified to add/replace one or more amino acids, thereby providing one or more cytotoxic, oligosaccharide or carbohydrate attachment sites. In some embodiments, the anti-BCMA antibody or antigen binding fragment comprises a variant Fc region that is genetically engineered by substitution at a particular amino acid position as compared to the native Fc region. In some embodiments, the anti-BCMA antibody or antigen-binding fragment of the invention comprises an IgG1 heavy chain constant region comprising one or more amino acid substitutions selected from the group consisting of K214R, L234A, L235E, G237A, D356E, and L358M (EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of K214R, L234A, L235E, G237A, a330S, P331S, D356E, and L358M (EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of K214R, C226S, C229S, and P238S (EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of K214R, D356E, and L358M (EU numbering). In some embodiments, the IgG1 heavy chain constant region comprises one or more amino acid substitutions selected from the group consisting of S131C, K133R, G137E, G138S, Q196K, I199T, N203D, K214R, C226S, C229S, and P238S (EU numbering).

In some embodiments, a variant may comprise the addition of amino acid residues at the amino and/or carboxy terminus of an antibody or polypeptide. The length of the added amino acid residues can range from one to one hundred or more residues. In some embodiments, the variant comprises an N-terminal methionyl residue. In some embodiments, the variant comprises additional polypeptides/proteins (e.g., fc regions) to produce a fusion protein. In some embodiments, the variant is designed to be detectable, and may include a detectable label and/or protein (e.g., a fluorescent label or an enzyme).

The variant antibodies or antigen-binding fragments of the present invention can be generated using methods known in the art, including but not limited to site-directed mutagenesis, alanine scanning mutagenesis, and PCR mutagenesis.

In some embodiments, the variants of the anti-BCMA antibodies or antigen binding fragments disclosed herein can retain BCMA binding capacity to a similar degree, the same degree, or a higher degree as the parent antibody or antigen binding fragment. In some embodiments, the variant may have at least about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more identity in amino acid sequence to the parent antibody or antigen binding fragment. In some embodiments, the variant of an anti-BCMA antibody or antigen binding fragment comprises the amino acid sequence of a parent anti-BCMA antibody or antigen binding fragment with one or more conservative amino acid substitutions. Conservative amino acid substitutions are known in the art and include those in which one amino acid having a particular physical and/or chemical property is replaced with another amino acid having the same or similar chemical or physical property.

In some embodiments, the variant of an anti-BCMA antibody or antigen binding fragment comprises the amino acid sequence of a parent antibody or antigen binding fragment with one or more non-conservative amino acid substitutions. In some embodiments, a variant of an anti-BCMA antibody or antigen-binding fragment comprises the amino acid sequence of a parent binding antibody or antigen-binding fragment having one or more non-conservative amino acid substitutions, wherein the one or more non-conservative amino acid substitutions do not interfere with or inhibit one or more biological activities (e.g., BCMA binding) of the variant. In certain embodiments, the one or more conservative amino acid substitutions, and/or the one or more non-conservative amino acid substitutions may enhance the biological activity of the variant, such that the biological activity of the functional variant is increased as compared to the parent binding moiety.

In some embodiments, the variant may have 1, 2, 3, 4, or 5 amino acid substitutions in the binding portion of the CDR (e.g., VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, and VL CDR 3).

In some embodiments, the anti-BCMA antibody or antigen binding fragment described herein is chemically modified either naturally or by intervention. In some embodiments, the anti-BCMA antibody or antigen binding fragment is chemically modified by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, and/or attachment to a cellular ligand or other protein. Any of a number of chemical modifications can be made by known techniques. The anti-BCMA antibody or antigen-binding fragment can include one or more amino acid analogs (including, for example, unnatural amino acids), as well as other modifying groups known in the art.

In some implementationsIn a regimen, the anti-BCMA antibody or antigen-binding fragment (e.g., antibody) has a dissociation constant (K) of about 1 μ M or less, about 100nM or less, about 40nM or less, about 20nM or less, about 10nM or less, about 1nM or less, about 0.1nM or less, about 50pM or less, about 10pM or less, or about 1pM or less _D ) Binding to BCMA (e.g., human BCMA). In some embodiments, the anti-BCMA antibody or antigen binding fragment has a K of about 20nM or less _D Binds BCMA (e.g., human BCMA). In some embodiments, the anti-BCMA antibody or antigen binding fragment has a K of about 10nM or less _D Binding to BCMA (e.g., human BCMA). In some embodiments, the anti-BCMA antibody or antigen binding fragment has a K of about 1nM or less _D Binds BCMA (e.g., human BCMA). In some embodiments, the anti-BCMA antibody or antigen binding fragment has a K of about 0.5nM or less _D Binds BCMA (e.g., human BCMA). In some embodiments, the anti-BCMA antibody or antigen binding fragment has a K of about 0.1nM or less _D Binding to BCMA (e.g., human BCMA). In some embodiments, the anti-BCMA antibody or antigen binding fragment has a K of about 50pM or less _D Binding to BCMA (e.g., human BCMA). In some embodiments, the anti-BCMA antibody or antigen binding fragment has a K of about 25pM or less _D Binding to BCMA (e.g., human BCMA). In some embodiments, the anti-BCMA antibody or antigen binding fragment has a K of about 10pM or less _D Binding to BCMA (e.g., human BCMA). In some embodiments, the anti-BCMA antibody or antigen binding fragment has a K of about 1pM or less _D Binds BCMA (e.g., human BCMA). In some embodiments, the dissociation constant of a binding agent (e.g., an antibody) for BCMA is a dissociation constant determined using BCMA protein immobilized on a Biacore chip and a binding agent flowing through the chip. In some embodiments, the dissociation constant of a binding agent (e.g., antibody) for BCMA is a dissociation constant determined using a binding agent captured with an anti-human IgG antibody on a Biacore chip and soluble BCMA flowing through the chip.

The anti-BCMA antibodies or antigen binding fragments of the present invention can be analyzed for physical, chemical, and/or biological properties by a variety of methods known in the art. In some embodiments, an anti-BCMA antibody is tested for its ability to bind BCMA (e.g., human BCMA). Binding assays include, but are not limited to, SPR (e.g., biacore), ELISA, and FACS. In addition, antibodies can be evaluated in terms of solubility, stability, thermostability, viscosity, expression level, quality of expression, and/or purification efficiency.

Epitope identification is a method of identifying a binding site, region or epitope on a target protein to which an antibody binds. Various methods are known in the art for mapping epitopes to target proteins. These methods include mutations including, but not limited to, shotgun mutations, site-directed mutagenesis, and alanine scanning; these methods also include domain or fragment scans; peptide scanning (e.g., pepscan technique); display methods (e.g., phage display, microbial display, and ribosome/mRNA display); methods involving proteolysis and mass spectrometry; structural determination (e.g., X-ray crystallography and NMR). In some embodiments, the anti-BCMA antibodies or antigen binding fragments of the invention are characterized by assays including, but not limited to, N-terminal sequencing, amino acid analysis, HPLC, mass spectrometry, ion exchange chromatography, and papain digestion.

In some embodiments, the anti-BCMA antibody or antigen binding fragment is conjugated to a cytotoxic agent or moiety. In some embodiments, the anti-BCMA antibody or antigen binding fragment is conjugated to a cytotoxic agent to form an ADC (antibody-drug conjugate). In some embodiments, the cytotoxic moiety is a chemotherapeutic agent, including but not limited to methotrexate, doxorubicin (adriamycin/doxorubicin), melphalan, mitomycin C, chlorambucil, duocarmycin (duocarmycin), daunomycin, pyrrole Benzodiazepines (PBDs), or other intercalating agents. In some embodiments, the cytotoxic moiety is a microtubule inhibitor, including but not limited to auristatins, maytansinoids (e.g., DM1 and DM 4), and tubulysins (tubulysins). In some embodiments, the cytotoxic moiety is an enzymatically active toxin or fragment thereof of bacterial, fungal, plant or animal origin, including but not limited to diphtheria a chain, non-binding active fragments of diphtheria toxin, exotoxin a chain, ricin a chain, abrin a chain, modeccin a chain, alpha-sarcin, aleurin, dianthin, phytoalexin, pokeweed (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin (curcin), crotin (crotin), saponaria officinalis (Sapaonaria officinalis) inhibitor, gelonin, serlincomycin, restrictocin, phenomycin, enomycin, and trichothecene compounds (tricothecenes). In some embodiments, the antibody binds to one or more small molecule toxins, such as calicheamicin, maytansinoids, trichothenes, and CC1065.

In some embodiments, the anti-BCMA antibody or antigen binding fragment of the present invention is conjugated to a detectable substance or molecule that enables the agent to be used for diagnosis and/or detection. Detectable substances may include, but are not limited to, enzymes such as horseradish peroxidase, alkaline phosphatase, beta-galactosidase, and acetylcholinesterase; also included are prosthetic groups such as biotin and flavin; fluorescent substances such as umbelliferone, fluorescein Isothiocyanate (FITC), rhodamine, tetramethylrhodamine isothiocyanate (TRITC), dichlorotriazinylamine fluorescein, dansyl chloride, anthocyanine (Cy 3), and phycoerythrin; bioluminescent materials, such as luciferase; radioactive materials, e.g. ²¹² Bi、 ¹⁴ C、 ⁵⁷ Co、 ⁵¹ Cr、 ⁶⁷ Cu、 ¹⁸ F、 ⁶⁸ Ga、 ⁶⁷ Ga、 ¹⁵³ Gd、 ¹⁵⁹ Gd、 ⁶⁸ Ge、 ³ H、 ¹⁶⁶ Ho、 ¹³¹ I、 ¹²⁵ I、 ¹²³ I、 ¹²¹ I、 ¹¹⁵ In、 ¹¹³ In、 ¹¹² In、 ¹¹¹ In、 ¹⁴⁰ La、 ¹⁷⁷ Lu、 ⁵⁴ Mn、 ⁹⁹ Mo、 ³² P、 ¹⁰³ Pd、 ¹⁴⁹ Pm、 ¹⁴² Pr、 ¹⁸⁶ Re、 ¹⁸⁸ Re、 ¹⁰⁵ Rh、 ⁹⁷ Ru、 ³⁵ S、 ⁴⁷ Sc、 ⁷⁵ Se、 ¹⁵³ Sm、 ¹¹³ Sn、 ¹¹⁷ Sn、 ⁸⁵ Sr、 ^99m Tc、 ²⁰¹ Ti、 ¹³³ XE、 ⁹⁰ Y、 ⁶⁹ Yb、 ¹⁷⁵ Yb、 ⁶⁵ Zn; a positron emitting metal; and magnetismA metal ion positron emitting metal; and magnetic metal ions.

The anti-BCMA antibodies or antigen binding fragments of the invention can be linked to a solid support. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride, or polypropylene. In some embodiments, the immobilized anti-BCMA antibody or antigen binding fragment is used in an immunoassay. In some embodiments, the immobilized anti-BCMA antibody or antigen binding fragment is used to purify an antigen of interest (e.g., human BCMA).

5.3CAR, TCR and genetically engineered immune effector cells

The anti-BCMA antibodies or antigen binding fragments described herein can be used as part of a Chimeric Antigen Receptor (CAR) or T Cell Receptor (TCR), which can be expressed in immune effector cells for the treatment of cancer. Thus, the invention also provides CARs and TCRs that specifically bind BCMA (e.g., human BCMA), immune effector cells expressing such CARs or TCRs, and uses of such cells.

5.3.1TCRs

The present invention provides T Cell Receptors (TCRs) that specifically bind BCMA ("BCMA TCRs"). TCRs are antigen-specific molecules responsible for recognizing antigenic peptides present in the context of MHC products on the surface of APCs or on the surface of any nucleated cell. The system confers on T cells, via their TCR, the potential ability to recognize whole intracellular arrays of antigens (including viral proteins) expressed by the cells, which are processed into short peptides, bound to intracellular MHC molecules, and delivered to the surface as peptide-MHC complexes. This system allows foreign proteins (such as mutated cancer antigens or viral proteins) or aberrantly expressed proteins to be targeted by T cells (e.g., davis and Bjorkman (1988) Nature,334,395-402 Davis et al (1998) Annu Rev Immunol,16, 523-544).

The interaction of the TCR and peptide-MHC complexes can drive T cells into different activation states, depending on the affinity (or dissociation rate) of the binding. The TCR recognition process allows T cells to distinguish between normal, healthy cells and cells transformed, for example, by viruses or malignancies, by providing a diverse pool of TCRs, where it is likely that one or more TCRs are present whose binding affinity to foreign peptides bound to MHC molecules is above the threshold for stimulating T cell activity (Manning and Kranz (1999) Immunology Today,20, 417-422).

Wild-type TCRs isolated from human or mouse T cell clones identified by in vitro culture have been shown to have relatively low binding affinity (K) _D =1-300 μm) (Davis et al (1998) Annu Rev Immunol,16, 523-544). This is due, in part, to the fact that T cells developing in the thymus negatively select for self-peptide-MHC ligands (tolerance induction) and thus allow clearance of avidity-overhigh T cells (Starr et al, (2003) Annu Rev Immunol,21, 139-76). To compensate for these relatively low affinities, T cells have evolved a co-receptor system in which the cell surface molecules CD4 and CD8 bind to MHC molecules (class II and class I, respectively) and cooperate with TCRs to mediate signaling activity. CD8 is particularly effective in this process, allowing TCRs with very low affinity (e.g., K) _D =300 μ M) mediates potent antigen-specific activity.

Directed evolution can be used to generate TCRs with higher affinity for a particular peptide-MHC complex. Methods that may be used include yeast display (Holler et al, (2003) Nat Immunol,4,55-62, (2000) Proc Natl Acad Sci U S A,97, 5387-92). Phage display (Li et al (2005) Nat Biotechnol,23, 349-54), and T cell display ((Chervin et al (2008) J Immunol Methods,339, 175-84). All three Methods involve engineering or modifying TCRs that exhibit the normal, low affinity of the wild-type TCR to increase affinity for the cognate peptide-MHC complex (the original antigen specific for T cells).

Also, in some embodiments, the TCRs provided herein comprise an anti-BCMA antibody or antigen binding fragment described herein. The anti-BCMA antibody or antigen binding fragment can be any anti-BCMA antibody or antigen binding fragment described herein. For illustrative purposes, in some embodiments, the TCRs provided herein include anti-BCMA antibodies or antigen-binding fragments, which can have a VL and a VH, wherein the VL includes a VL CDR1, CDR2, and CDR3, and the VH includes a VH CDR1, CDR2, and CDR3, and wherein the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 have the amino acid sequences set forth in

SEQ ID NOs

8, 18, 28, 39, 51, and 63, respectively.

In some embodiments, the TCRs provided herein can include an anti-BCMA antibody or antigen binding fragment that is an scFv labeled as BCMA 31.

In some embodiments, the TCRs provided herein comprise an alpha chain and a beta chain. The constant regions of the α and β chains of the TCR are encoded by TRAC and TRBC, respectively. Human TRAC may have a numbering corresponding to UniProtKB/Swiss-Prot: p01848.2 (accession number: P01848.2 GI: 1431906459). Human TRBC may have an amino acid sequence corresponding to the GenBank sequence (accession number: ALC78509.1 GI: 924924895). In some embodiments, the TCRs provided herein comprise TCR α chains comprising an anti-BCMA antibody or antigen binding fragment provided herein. In some embodiments, the TCRs provided herein comprise a TCR β chain comprising an anti-BCMA antibody or antigen binding fragment provided herein. In some embodiments, the TCR comprises a gamma chain and a delta chain. The constant regions of the TCR γ and δ chains are encoded by TRGC and TRDC, respectively. Human TRGC may have a sequence corresponding to UniProtKB/Swiss-Prot: P0CF51.1 (accession number: P0CF51.1 GI: 294863156), or an amino acid sequence corresponding to UniProtKB/Swiss-Prot: the amino acid sequence of P03986.2 (accession number: P03986.2 GI: 1531253869). Human TRDC may have a base sequence corresponding to UniProtKB/Swiss-Prot: an amino acid sequence of B7Z8K6.2 (accession number: B7Z8K6.2 GI: 294863191). In some embodiments, the TCRs provided herein comprise TCR γ chains comprising an anti-BCMA antibody or antigen binding fragment provided herein. In some embodiments, the TCRs provided herein comprise TCR delta chains comprising an anti-BCMA antibody or antigen binding fragment provided herein.

5.3.2CARs

CARs are engineered receptors that provide antigen binding and immune effector cell activation functions. The CARs can be used to transplant the specificity of an antibody (e.g., a monoclonal antibody) onto an immune effector cell (e.g., a T cell, NK cell, or macrophage). CARs retards immune effector cells (e.g., T cells) to tumor surface antigens in an HLA-independent manner (Sadelain et al, nat. Rev. Cancer.3 (1): 35-45 (2003); sadelain et al, cancer Discovery 3 (4): 388-398 (2013); rafiq and Brentjens (2016); nat Rev Clin Oncol 13 (6): 370-383). Typical structures of CAR molecules include extracellular antigen binding domains (e.g., scFv), transmembrane domains (TM), and intracellular signaling domains. The extracellular antigen-binding domain of a CAR is typically derived from a monoclonal antibody (mAb) or a receptor or ligand thereof. Binding of the CAR to the antigen can trigger phosphorylation of Immunoreceptor Tyrosine Activation Motifs (ITAMs) in the intracellular domain, thereby initiating the signaling cascade required for cytolytic induction, cytokine secretion and proliferation. CAR-expressing T Cells (CART) can be classified into three generations based on the presence of intracellular costimulatory signals.

In some embodiments, the invention provides a CAR that specifically binds BCMA ("BCMA CAR"). In some embodiments, the CAR can be a "first generation", "second generation", or "third generation" CAR (see, e.g., sadelain et al, cancer Discov.3 (4): 388-398 (2013); jensen et al, immunol. Rev.257:127-133 (2014); sharpe et al, dis. Model Mech.8 (4): 337-350 (2015); june et al (2018), science 359 (6382): 1361-1365).

"first generation" CARs typically consist of an extracellular antigen-binding domain, e.g., a single chain variable fragment (scFv), fused to a transmembrane domain, fused to the cytoplasmic/intracellular domain of a T cell receptor chain. "first generation" CARs typically have an intracellular domain from the CD3 zeta-chain, which is the primary transmitter of endogenous T Cell Receptor (TCRs) signals. "first generation" CARs provide de novo antigen recognition and elicit CD4 through the CD3 zeta chain signaling domain in a single fusion molecule ⁺ T cells and CD8 ⁺ T cell activation without relying on HLA-mediated antigen presentation. A "second generation" CAR includes a Cancer antigen binding domain fused to an intracellular signaling domain capable of activating an immune effector cell (e.g., a T cell) and a costimulatory domain intended to enhance immune effector cell (e.g., a T cell) potency and persistence (Sadelain et al, cancer discov.3:388-398 (2013)). 3:388-398(2013) Thus, CAR design can combine antigen recognition and signal transduction, both functions being physiologically assumed by two independent complexes (TCR heterodimer and CD3 complex). "second generation" CARs include intracellular domains from various costimulatory receptors, e.g., CD28, 4-1BB, ICOS, OX40, etc., located at the cytoplasmic tail of the CAR to provide additional signals to the cell. A "second generation" CAR provides both costimulatory (e.g., through the CD28 or 4-1BB domain) and activating (e.g., through the CD3 zeta signaling domain) functions. Studies have shown that "second generation" CARs can enhance the anti-tumor activity of T cells. In 2017, the FDA approved two anti-CD 19 CAR T cell products for the treatment of relapsed B-cell precursor acute lymphoblastic leukemia (B-ALL) and B-cell non-hodgkin's lymphoma. "third generation" CARs provide multiple costimulatory (e.g., by containing both CD28 and 4-1BB domains), as well as activating (e.g., by containing the CD3 δ activation domain) functions.

Thus, provided herein is a CAR that specifically binds BCMA, comprising, from N-terminus to C-terminus: a BCMA binding domain comprising an anti-BCMA antibody or antigen binding fragment provided by the invention, (b) a transmembrane domain, and (c) a cytoplasmic domain. The anti-BCMA antibody or antigen binding fragment can be any anti-BCMA antibody or antigen binding fragment described herein. For illustrative purposes, in some embodiments, the CARs provided herein include can include an anti-BCMA antibody or antigen-binding fragment, which can have a VL and a VH, wherein the VL includes a VL CDR1, CDR2, and CDR3, and the VH includes a VH CDR1, CDR2, and CDR3, and wherein the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 have the amino acid sequences set forth in

SEQ ID NOs

8, 18, 28, 39, 51, and 63, respectively.

In some embodiments, the CARs provided herein can include an anti-BCMA antibody or antigen-binding fragment that is an scFv labeled as BCMA 31.

The transmembrane domain of the CARs provided herein comprises a hydrophobic alpha helix spanning at least a portion of the membrane. Different transmembrane domains lead to different receptor stabilities. Upon antigen recognition, the receptor aggregates and transmits a signal to the cell. In one embodiment, the transmembrane domain of a CAR provided herein can be derived from a protein or polypeptide naturally expressed in an immune effector cell. By a transmembrane domain derived from a protein or polypeptide is meant that the transmembrane domain comprises the entire transmembrane region of the protein or polypeptide or a fragment thereof. In some embodiments, the CAR provided herein can have a transmembrane domain from CD8, CD28, CD3 ζ, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, T Cell Receptor (TCR) α chain, TCR β chain, TCR ζ chain, CD3 epsilon, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, or other polypeptide expressed in an immune effector cell. In some embodiments, the transmembrane domain of a CAR provided herein includes a transmembrane region of CD8, CD28, CD3 zeta, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, T Cell Receptor (TCR) alpha chain, TCR beta chain, TCR zeta chain, CD3 epsilon, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD154, or other polypeptide expressed in an immune effector cell.

In some embodiments, the transmembrane domain of a CAR provided herein is derived from CD8. In some embodiments, the transmembrane domain comprises the transmembrane region of CD8. In some embodiments, the transmembrane domain is derived from CD28. In some embodiments, the transmembrane domain comprises the transmembrane region of CD28. In some embodiments, the transmembrane domain is derived from CD3 ζ. In some embodiments, the transmembrane domain comprises the transmembrane region of CD3 ζ. In some embodiments, the transmembrane domain is derived from CD4. In some embodiments, the transmembrane domain comprises the transmembrane region of CD4. In some embodiments, the transmembrane domain is derived from 4-1BB. In some embodiments, the transmembrane domain comprises the transmembrane region of 4-1BB. In some embodiments, the transmembrane domain is derived from OX40. In some embodiments, the transmembrane domain comprises a transmembrane region of OX40. In some embodiments, the transmembrane domain is derived from ICOS. In some embodiments, the transmembrane domain comprises the transmembrane region of ICOS. In some embodiments, the transmembrane domain is derived from CTLA-4. In some embodiments, the transmembrane domain comprises a transmembrane region of CTLA-4. In some embodiments, the transmembrane domain is derived from PD-1. In some embodiments, the transmembrane domain comprises the transmembrane region of PD-1. In some embodiments, the transmembrane domain is derived from LAG-3. In some embodiments, the transmembrane domain comprises the transmembrane region of a LAG-3. In some embodiments, the transmembrane domain is derived from 2B4. In some embodiments, the transmembrane domain comprises the transmembrane region of 2B4. In some embodiments, the transmembrane domain is derived from BTLA. In some embodiments, the transmembrane domain comprises the transmembrane region of BTLA. In some embodiments, the transmembrane domain is derived from a TCR α chain. In some embodiments, the transmembrane domain comprises a transmembrane region of a TCR a chain. In some embodiments, the transmembrane domain is derived from a TCR β chain. In some embodiments, the transmembrane domain comprises a transmembrane region of a TCR β chain. In some embodiments, the transmembrane domain is derived from a TCR zeta chain. In some embodiments, the transmembrane domain comprises a transmembrane region of a TCR zeta chain. In some embodiments, the transmembrane domain is derived from CD3 epsilon. In some embodiments, the transmembrane domain comprises the transmembrane region of CD3 epsilon. In some embodiments, the transmembrane domain is derived from CD45. In some embodiments, the transmembrane domain comprises the transmembrane region of CD45. In some embodiments, the transmembrane domain is derived from CD5. In some embodiments, the transmembrane domain comprises the transmembrane region of CD5. In some embodiments, the transmembrane domain is derived from CD8. In some embodiments, the transmembrane domain comprises the transmembrane region of CD8. In some embodiments, the transmembrane domain is derived from CD9. In some embodiments, the transmembrane domain comprises the transmembrane region of CD9. In some embodiments, the transmembrane domain is derived from CD16. In some embodiments, the transmembrane domain comprises the transmembrane region of CD16. In some embodiments, the transmembrane domain is derived from CD22. In some embodiments, the transmembrane domain comprises the transmembrane region of CD22. In some embodiments, the transmembrane domain is derived from CD33. In some embodiments, the transmembrane domain comprises the transmembrane region of CD33. In some embodiments, the transmembrane domain is derived from CD37. In some embodiments, the transmembrane domain comprises the transmembrane region of CD37. In some embodiments, the transmembrane domain is derived from CD64. In some embodiments, the transmembrane domain comprises the transmembrane region of CD64. In some embodiments, the transmembrane domain is derived from CD80. In some embodiments, the transmembrane domain comprises the transmembrane region of CD80. In some embodiments, the transmembrane domain is derived from CD86. In some embodiments, the transmembrane domain comprises the transmembrane region of CD86. In some embodiments, the transmembrane domain is derived from CD134. In some embodiments, the transmembrane domain comprises the transmembrane region of CD134. In some embodiments, the transmembrane domain is derived from CD154. In some embodiments, the transmembrane domain comprises the transmembrane region of CD154. Exemplary transmembrane domains are described in more detail below.

In some embodiments, the transmembrane domain may be synthetic, in which case it comprises predominantly hydrophobic residues, such as leucine and valine. Optionally, the transmembrane domain may be derived from a polypeptide that is not naturally expressed in the immune effector cell, so long as the transmembrane domain is capable of transducing a signal from an antigen bound to the CAR to the intracellular signaling domain and/or the co-stimulatory domain. In some embodiments, the transmembrane domain may include a triplet of phenylalanine, tryptophan, and valine at each end. Optionally, a short oligonucleotide or polypeptide linker, preferably between 2 and 10 amino acids in length, can form a link between the transmembrane domain and the cytoplasmic signaling domain of the CAR. Glycine-serine conjugates provide very suitable linkers.

As described above, the cytoplasmic domain of a CAR provided herein can contain a signaling domain that functions in an immune effector cell expressing the CAR. Such signaling domains may, for example, be derived from CD3 ζ, fc receptor γ, fc γ RIIa, fcR β (fcepsilonr 1 b), CD3 γ, CD3 δ, CD3 epsilon, CD79a, CD79b, DAP10, or DAP12. The signaling domain may also be a combination of signaling domains derived from CD3 ζ, fc receptor γ, fc γ RIIa, fcR β (Fc ∈ R1 b), CD3 γ, CD3 δ, CD3 ∈, CD79a, CD79b, DAP10, or DAP12. A signaling domain derived from a protein or polypeptide refers to a domain of a protein or polypeptide that is responsible for activating immune effector cells (e.g., T cells), or a fragment thereof that retains its activating function. Generally, the signaling domain induces persistence, transport and/or effector functions in transduced immune effector cells (e.g., T cells) (Sharpe et al, dis. Model Mech.8:337-350 (2015); finney et al, J.Immunol.161:2791-2797 (1998); krause et al, J.exp. Med.188:619-626 (1998)). The signaling domain of a protein or polypeptide can be an intracellular domain of the protein or polypeptide. In some embodiments, the signaling domain comprises an intracellular domain of CD3 ζ, fcR γ, fcyriia, fcR β, CD3 γ, CD3 δ, CD3 epsilon, CD5, CD22, CD79a, CD79b, DAP10, DAP12, or any combination thereof.

In some embodiments, the cytoplasmic domain of a CAR provided herein includes a signaling domain derived from CD3 ζ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 ζ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from FcR γ. In some embodiments, the signaling domain comprises the intracellular domain of FcR γ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from Fc γ RIIa. In some embodiments, the signaling domain comprises an intracellular domain of Fc γ RIIa. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from FCR β. In some embodiments, the signaling domain comprises the intracellular domain of FCR β. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 γ. In some embodiments, the signaling domain comprises the intracellular domain of CD3 γ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 δ. In some embodiments, the signaling domain comprises an intracellular domain of CD3 δ. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD3 epsilon. In some embodiments, the signaling domain comprises an intracellular domain of CD3 epsilon. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD 5. In some embodiments, the signaling domain comprises the intracellular domain of CD 5. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD 22. In some embodiments, the signaling domain comprises the intracellular domain of CD 22. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD79 a. In some embodiments, the signaling domain comprises the intracellular domain of CD79 a. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from CD79 b. In some embodiments, the signaling domain comprises the intracellular domain of CD79 b. In some embodiments, the cytoplasmic domain comprises a signaling domain derived from DAP 10. In some embodiments, the signaling domain comprises an intracellular domain of DAP 10. In some embodiments, the cytoplasmic domain includes a signaling domain derived from DAP 12. In some embodiments, the signaling domain comprises the intracellular domain of DAP 12. Exemplary signaling domains are described in more detail below.

In some embodiments, the cytoplasmic domain of a CAR provided herein further comprises a costimulatory domain. In some embodiments, the cytoplasmic domain of a CAR provided herein further comprises two co-stimulatory domains. Such co-stimulatory domains may provide enhanced activation of immune effector cells (e.g., T cells). The co-stimulatory signaling domain may be derived, for example, from CD28, 4-1BB (CD 137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, TIGIT, GITR, TLR, DR3, or CD43. A co-stimulatory domain derived from a protein or polypeptide refers to a domain of a protein or polypeptide that is responsible for providing enhanced activation of immune effector cells (e.g., T cells), or a fragment that retains its activation function. In some embodiments, the CAR co-stimulatory domain provided by the invention comprises the intracellular domain of CD28, 4-1BB (CD 137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, TIGIT, GITR, TLR, DR3, or CD43. In some embodiments, the CAR cytoplasmic domain provided herein includes a co-stimulatory domain derived from CD 28. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 28. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from 4-1 BB. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 4-1 BB. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from OX 40. In some embodiments, the co-stimulatory domain comprises an intracellular domain of OX 40. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from ICOS. In some embodiments, the co-stimulatory domain comprises the intracellular domain of ICOS. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from DAP 10. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DAP 10. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from 2B 4. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 2B 4. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from CD 27. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 27. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from CD 30. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 30. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from CD 40. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 40. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from CD 2. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 2. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from CD 7. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD 7. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from LIGHT. In some embodiments, the co-stimulatory domain comprises the intracellular domain of LIGHT. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from TIGIT. In some embodiments, the co-stimulatory domain comprises the intracellular domain of TIGIT. In some embodiments, the cytoplasmic domain comprises a costimulatory domain derived from GITR. In some embodiments, the co-stimulatory domain comprises an intracellular domain of GITR. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from a TLR. In some embodiments, the co-stimulatory domain comprises an intracellular domain of a TLR. In some embodiments, the cytoplasmic domain includes a co-stimulatory domain derived from DR 3. In some embodiments, the co-stimulatory domain comprises an intracellular domain of DR 3. In some embodiments, the cytoplasmic domain comprises a co-stimulatory domain derived from CD43. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD43. Exemplary co-stimulatory domains are described in more detail below.

CARs have been described that comprise an intracellular domain comprising a co-stimulatory domain derived from 4-1BB, ICOS, or DAP-10 (see U.S.7,446,190, which is incorporated herein by reference, which also describes representative sequences of 4-1BB, ICOS, and DAP-10). In some embodiments, the cytoplasmic domain of the CAR can include two costimulatory domains derived from two costimulatory receptors, e.g., CD28 and 4-1BB (see, sadelain et al, cancer discov.3 (4): 388-398 (2013)), or a combination of CD28 and OX40, or other costimulatory ligands disclosed herein.

The extracellular domain of the CAR can be fused to a leader peptide or signal peptide that directs the nascent protein into the endoplasmic reticulum and subsequent transport to the cell surface. It will be appreciated that once a polypeptide containing a signal peptide is expressed on the cell surface, the signal peptide will generally have been proteolytically removed during processing and transport of the polypeptide in the endoplasmic reticulum to the cell surface. Thus, a polypeptide, such as a CAR, is typically expressed on the cell surface as a mature protein lacking a signal peptide, while the precursor form of the polypeptide includes the signal peptide. If the CAR is to be glycosylated and/or anchored in the cell membrane, a signal peptide or a leader peptide may be necessary. The signal sequence or leader is a peptide sequence, usually present at the N-terminus of a newly synthesized protein, that directs the protein into the secretory pathway. The signal peptide is covalently linked to the N-terminus of the extracellular antigen-binding domain of the CAR to form a fusion protein. Any suitable signal peptide, as is well known in the art, may be applied to the CAR to provide cell surface expression in immune cells (see, gierasch, biochem.28:923-930 (1989); von Heijne, J. Mol. Biol.184 (1): 99-105 (1985)). Particularly useful signal peptides can be derived from cell surface proteins provided by the invention that are naturally expressed in immune cells, including any signal peptide of the polypeptides disclosed herein. Thus, any suitable signal peptide may be utilized to direct the expression of the CAR on the cell surface of the immune effector cells provided by the present invention.

In some embodiments, the CAR may further comprise a spacer or sequence that interconnects the domains of the CAR. For example, a spacer may be included between the signal peptide and the antigen binding domain, between the antigen binding domain and the transmembrane domain, between the transmembrane domain and the intracellular domain, and/or between domains within the intracellular domain, e.g., between the stimulatory domain and the co-stimulatory domain. The spacer may be flexible enough to allow interaction of the various domains with other polypeptides, e.g., to allow flexibility in the orientation of the antigen binding domain to facilitate antigen recognition. The spacer may be, for example, from the hinge region of IgG, CH of an immunoglobulin ₂ CH ₃ (constant) region, and/or a portion of CD3 (cluster of differentiation 3) or some other sequence suitable as a spacer. In some embodiments, the disclosed CARs include a hinge domain connecting the BCMA binding domain and the transmembrane domain. In some embodiments, the hinge domainIncluding CD8 hinge structures. In some embodiments, the hinge domain comprises a CD28 hinge structure.

Some exemplary molecules are provided below from which the domains of the CARs provided by the invention can be derived.

CD3ζCD3 ζ contains 3 immunoreceptor tyrosine-based activation motifs (ITAMs) and transmits an activation signal to cells, e.g., cells of the lymphoid lineage, such as T cells, upon antigen binding. The CD3 ζ polypeptide may have an amino acid sequence corresponding to the sequence of GenBank accession number NP-932170.1 (NP-932170.1, GI 37595565; shown below), or a fragment thereof. In some embodiments, the CD3 zeta signaling domain has the sequence of amino acids 52 through 164 of the CD3 zeta polypeptide sequence provided below, or a fragment thereof sufficient for signaling activity. See GenBank NP _932170 for reference to a domain within CD3 ζ, such as a signal peptide of amino acids 1-21; an extracellular domain of amino acids 22-30; a transmembrane region of amino acids 31-51; an intracellular domain of amino acids 52-164. In some embodiments, the CAR can have a transmembrane domain derived from CD3 ζ. The transmembrane domain may include a transmembrane region of CD3 ζ (e.g., amino acids 31 to 51 of the following sequence) or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD3 ζ. In some embodiments, the signaling domain of CD3 ζ may comprise an intracellular domain of CD3 ζ (e.g., amino acids 52 to 164 of the following sequence), or a fragment thereof. It is understood that a CD3 zeta sequence that is shorter or longer than a particular described domain may be included in the CAR, if desired.

FcRγ，Activation of the Fc γ R class of IgG receptors forms multimeric complexes comprising the Fc receptor γ chain (FcR γ) containing cellsAn Internal Tyrosine Activation Motif (ITAM), the activation of which triggers reactive oxygen burst, cytokine release, phagocytosis, antibody-dependent cell-mediated cytotoxicity, and degranulation. The FcR gamma polypeptide may have an amino acid sequence having the amino acid sequence of NCBI reference sequence NP-004097.1 (GI: 4758344) or a fragment thereof. See GenBank NP _004097 for reference to domains within FcR γ, e.g., such as a signal peptide of amino acids 1-18; an extracellular domain of amino acids 19-23; a transmembrane domain of amino acids 24-44; an intracellular domain of amino acids 45-86. In some embodiments, the CAR may comprise a transmembrane domain derived from FcR γ. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of FcR γ, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from FcR γ. In some embodiments, the signaling domain comprises an intracellular domain of FcR γ or a fragment thereof. It is understood that FcR γ sequences shorter or longer than the particular described domain may be included in the CAR if desired.

FcγRiiaAre cell surface receptors found on phagocytic cells such as macrophages and neutrophils, which are involved in the phagocytosis and clearance of immune complexes. By binding to IgG, it initiates a cellular response to pathogens and soluble antigens. Fc γ RIIa also promotes phagocytosis of regulatory antigens. The Fc γ RIIa polypeptide can have an amino acid sequence that corresponds to a sequence having NCBI reference sequence NP _001129691.1 or a fragment thereof. See NCBI reference sequence NP _001129691.1 for domains within Fc γ RIIa, e.g., signal peptides of amino acids 1-33; an extracellular domain of amino acids 34-217; a transmembrane domain of amino acids 218-240; an intracellular domain of amino acids 241-317. In some embodiments, the CAR may comprise a transmembrane domain derived from Fc γ RIIa. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of Fc γ RIIa or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from Fc γ RIIa. In some embodiments, the signaling domain comprises an intracellular domain of Fc γ RIIa or a fragment thereof. It is understood that shorter or longer than the particular drawing, if desired The Fc γ RIIa sequence of the domain may be included in the CAR.

FcRβ(FcεR1b)Is a high affinity receptor that binds to the Fc region of immunoglobulin epsilon. Intact mast cell responses require aggregation of the FcR β by multivalent antigens, including de novo production by degranulation to release preformed mediators (such as histamine) as well as lipid mediators and cytokines. FcR β also mediates secretion of important lymphokines. Binding of the allergen to receptor-bound IgE leads to cell activation and release of mediators responsible for the manifestation of the allergy. The FcR β polypeptide may have an amino acid sequence corresponding to the amino acid sequence having NCBI reference sequence NP _000130.1 or a fragment thereof. See NCBI reference sequence: NP-000130.1 for reference to domains within FcR β, such as the intracellular domains at amino acids 1-59, 118-130, and 201-244; a transmembrane domain of amino acids 60-79, 98-117, 131-150, and 181-200; an extracellular domain of amino acids 80-97 and 151-180. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from FcR β. In some embodiments, the signaling domain comprises an intracellular domain of FcR β or a fragment thereof. It is understood that FcR β sequences shorter or longer than the particular described domain may be included in the CAR if desired.

CD3 gamma (T cell surface glycoprotein CD3 gamma chain)Is part of the TCR-CD3 complex present on the surface of T lymphocytes and plays an important role in adaptive immune responses. The cytoplasmic domain of CD3 γ contains Immunoreceptor Tyrosine Activation Motifs (ITAMs). In addition to the role of signal transduction in T cell activation, CD3 γ also plays an important role in the dynamic regulation of TCR expression on cell surfaces. The CD3 γ polypeptide may have an amino acid sequence corresponding to a polypeptide having NCBI reference sequence: NP-004097.1 (GI: 4758344) or a fragment thereof. See GenBank NP _004097 for reference to domains within CD3 γ, such as signal peptides of amino acids 1-22; an extracellular domain of amino acids 23-116; a transmembrane region of amino acids 117-137; an intracellular domain of amino acids 138-182. In some embodiments, the CAR may comprise a transmembrane domain derived from CD3 γ. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD3 γ, or a fragment thereof. In a 1In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD3 γ. In some embodiments, the signaling domain comprises an intracellular domain of CD3 γ or a fragment thereof. It is understood that CD3 γ sequences shorter or longer than the particular described domain may be included in the CAR if desired.

CD3 delta (T cell surface glycoprotein CD3 delta chain)Is part of the TCR-CD3 complex on the surface of T lymphocytes and plays an important role in adaptive immune responses. The cytoplasmic domain of CD3 δ contains Immunoreceptor Tyrosine Activation Motifs (ITAMs). In addition to the signal transduction role in T cell activation, CD3 δ plays an important role in thymocyte differentiation and is involved in the proper assembly and surface expression of the TCR-CD3 complex within cells. CD3 δ interacts with CD4 and CD8 and thus serves to establish a functional link between TCR and CD4 and CD8 co-receptors, which is required for CD4 or CD 8T cell activation and positive selection. The CD3 δ polypeptide may have an amino acid sequence corresponding to the amino acid sequence having NCBI reference sequence NP _000723.1 or a fragment thereof. See BCBI reference sequence: NP-000723.1 to reference a domain within CD 3. Delta., such as the signal peptide of amino acids 1-21; an extracellular domain of amino acids 22-105; a transmembrane region of amino acids 106 to 126; an intracellular domain of amino acids 127-171. In some embodiments, the CAR may include a transmembrane domain derived from CD3 δ. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD3 δ, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD3 δ. In some embodiments, the signaling domain comprises an intracellular domain of CD3 δ or a fragment thereof. It is understood that a CD3 δ sequence that is shorter or longer than a particular described domain may be included in a CAR if desired.

CD3 epsilon (T cell surface glycoprotein CD3 epsilon chain)Is part of the TCR-CD3 complex present on the surface of T lymphocytes and plays an important role in adaptive immune responses. The cytoplasmic domain of CD3 epsilon contains Immunoreceptor Tyrosine Activation Motifs (ITAMs). In addition to the signal transduction effects in T cell activation, CD3 epsilon is involved in the correct development of T cellsPlays an important role. CD3 epsilon triggers the assembly of the TCR-CD3 complex by forming two heterodimers, CD3 delta/CD 3 gamma and CD3 gamma/CD 3 gamma. The CD3 epsilon polypeptide may have an amino acid sequence corresponding to the amino acid sequence having NCBI reference sequence NP _000724.1 or a fragment thereof. See BCBI reference sequence: NP-000724.1 to reference a domain within CD3 ε, such as the signal peptide of amino acids 1-22; an extracellular domain of amino acids 23-126; a transmembrane region of amino acids 127 to 152; an intracellular domain of amino acids 153-207. In some embodiments, the CAR can include a transmembrane domain derived from CD3 epsilon. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD3 epsilon or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD3 epsilon. In some embodiments, the signaling domain comprises an intracellular domain of CD3 epsilon or a fragment thereof. It is understood that a CD3 epsilon sequence shorter or longer than the particular described domain may be included in the CAR if desired.

CD79a (B-cell antigen receptor complex associated protein alpha chain)Required for the following process: in concert with CD79B, a signaling cascade is initiated, activated by binding of antigen to the B-cell antigen receptor complex (BCR), which results in complex internalization, translocation to endosomes, and antigen presentation. CD79a stimulates SYK autophosphorylation and activation. CD79a also binds to BLNK, brings BLNK into proximity with SYK and phosphorylates BLNK with SYK, and interacts with some Src family tyrosine kinases, increasing its activity. The CD79a polypeptide may have an amino acid sequence corresponding to the amino acid sequence having NCBI reference sequence NP _001774.1 or a fragment thereof. See NCBI reference sequence: NP _001774.1 to reference a domain within CD79a, such as a signal peptide of amino acids 1-32; an extracellular domain of amino acids 33-143; a transmembrane region of amino acids 144-165; an intracellular domain of amino acids 166-226. In some embodiments, the CAR may comprise a transmembrane domain derived from CD79 a. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD79a, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD79 a. In some embodiments, the signaling junction is a junction of a pair of electrodes The domain includes the intracellular domain of CD79a or a fragment thereof. It is understood that CD79a sequences shorter or longer than the particular described domain may be included in the CAR if desired.

CD79B (B-cell antigen receptor complex associated protein beta chain)Required for the following process: in concert with CD79a, a signaling cascade is initiated that is activated by binding of antigen to the B-cell antigen receptor complex (BCR), which results in complex internalization, transport to endosomes (late endosomes), and antigen presentation. CD79b promotes phosphorylation of CD79 a. The CD79b polypeptide may have an amino acid sequence corresponding to the amino acid sequence having NCBI reference sequence NP _000617.1 or a fragment thereof. See NCBI reference sequence: NP-000617.1 to reference a domain within CD79b, e.g., a signal peptide of amino acids 1-28; an extracellular domain of amino acids 29-159; a transmembrane region of amino acids 160 to 180; an intracellular domain of amino acids 181-229. In some embodiments, the CAR may comprise a transmembrane domain derived from CD79 b. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD79b, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from CD79 b. In some embodiments, the signaling domain comprises an intracellular domain of CD79b or a fragment thereof. It is understood that a CD79b sequence that is shorter or longer than a particular described domain may be included in a CAR, if desired.

DAP10DAP10, also known as a hematopoietic cell signal transducer, is a signal subunit associated with a large family of receptors in hematopoietic cells. The DAP10 polypeptide may have an amino acid sequence corresponding to the sequence of GenBank No. NP-055081.1 (GI: 15826850), or a fragment thereof. See GenBank NP _055081 for reference to domains within DAP10, such as the signal peptide of amino acids 1-18; an extracellular domain of amino acids 19-48; a transmembrane region of amino acids 49-69; an intracellular domain of amino acids 70-93. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from DAP 10. In some embodiments, the signaling domain comprises an intracellular domain of DAP10 or a fragment thereof. In some embodiments of the present invention, the substrate is,the cytoplasmic domain includes a costimulatory domain derived from DAP 10. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DAP10 or a fragment thereof. It is understood that DAP10 sequences shorter or longer than a particular described domain may be included in a CAR if desired.

DAP12，DAP12 is present in myeloid lineage cells, such as macrophages and granulocytes, where it is associated with, for example, a trigger receptor expressed on myeloid lineage cell members (TREMs) and MDL1 (myeloid DAP 12-related lectin 1/CLEC 5A), both of which are involved in inflammatory responses against pathogens, such as viruses and bacteria. In lymphoid lineage cells, DAP12 is expressed in NK cells and is associated with activating receptors (e.g., C-type lectin receptor NKG 2C), natural cytotoxic receptor NKp44, brachyury-type KIR3DS1 and KIR2DS1/2/5, respectively. In particular, NGK2C is the major activating NK cell receptor used to control CMV infection in humans and mice. It was found that sufficient activation signal was generated in NK cells after cross-linking the DAP 12-containing CAR with its Ag.

et al, J Immunol 194. The DAP12 polypeptide may have an amino acid sequence corresponding to the sequence of GenBank No. AAD09437.1 (GI: 2905996) or a fragment thereof. See GenBank No. aad09437.1 for reference to domains within DAP12, such as signal peptides of amino acids 1-21; an extracellular domain of amino acids 22-40; a transmembrane region of amino acids 41 to 61; an intracellular domain of amino acids 62-113. In some embodiments, the CAR cytoplasmic domain can include a signaling domain derived from DAP 12. In some embodiments, the signaling domain comprises an intracellular domain of DAP12 or a fragment thereof. In some embodiments, the cytoplasmic domain includes a costimulatory domain derived from DAP 12. In some embodiments, the co-stimulatory domain comprises the intracellular domain of DAP12 or a fragment thereof. It is understood that DAP12 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

CD28，Cluster of differentiation 28 (CD 28) is expressed on T cellsProvides co-stimulatory signals for activation and survival of T cells. CD28 is a receptor for CD80 (B7.1) and CD86 (B7.2) proteins. The CD28 polypeptide may have an amino acid sequence corresponding to a sequence having GenBank No. P10747 (P10747.1, GI: 115973) or NP 006130 (NP 006130.1, GI 5453611) or a fragment thereof as described below. See GenBank NP _006130 for reference to domains within CD28, e.g., the signal peptide of amino acids 1 to 18; an extracellular domain of amino acids 19 to 152; a transmembrane domain of amino acids 153 to 179; an intracellular domain of amino acids 180-220. In some embodiments, the CAR may comprise a hinge domain derived from CD28 (e.g., amino acids 114 to 152 of the following sequence), or a fragment thereof. In some embodiments, the CAR may comprise a transmembrane domain derived from CD 28. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD28 (e.g., amino acids 153 to 179 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 28. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD28 (e.g., amino acids 180 to 220 of the following sequence) or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD28, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD28, and the CAR includes amino acids 153 to 220 of CD 28. In some embodiments, the CAR may comprise three domains derived from CD28, a transmembrane domain, a hinge domain, and a costimulatory signaling domain. In another embodiment, the CAR comprises amino acids 114 to 220 of CD 28. It is understood that CD28 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

4-1BB，4-1BB, also known as TNF receptor superfamily member 9, can be used as TNF ligand and has stimulating activity. The 4-1BB polypeptide may have an amino acid sequence corresponding to a sequence having GenBank No. P41273 (P41273.1, GI: 728739) or NP 001552 (NP 001552.2, GI 5730095) or a fragment thereof. See GenBank NP-001552 for reference to a domain within 4-1BB, e.g., a signal peptide of amino acids 1-17; an extracellular domain of amino acids 18-186; a transmembrane domain of amino acids 187 to 213; an intracellular domain of amino acids 214-255. In some embodiments, the CAR can include a transmembrane domain derived from 4-1 BB. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of 4-1BB (e.g., amino acids 187 to 213 of the following sequence), or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from 4-1 BB. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 4-1BB (e.g., amino acids 214 to 255 of the following sequence), or a fragment thereof. In some embodiments, the CAR may comprise two domains derived from 4-1BB, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence comprising the transmembrane domain and the intracellular domain of 4-1BB, and the CAR comprises amino acids 187 to 255 of 4-1 BB. It is understood that 4-1BB sequences shorter or longer than the particular described domain can be included in the CAR, if desired.

OX40，OX40, also known as tumor necrosis factor receptor superfamily member 4 precursor or CD134, is a member of the TNFR-receptor superfamily. The OX40 polypeptide can have an amino acid sequence corresponding to a sequence having GenBank No. P43489 (P43489.1, GI: 1171933) or NP-003318 (NP-003318.1, GI 4507579), or a fragment thereof. See GenBank NP _003318 for reference to a domain in OX40, e.g., a signal peptide of amino acids 1-28; an extracellular domain of amino acids 29 to 214; a transmembrane domain of amino acids 215-235; an intracellular domain of amino acids 236-277. It is understood that OX40 sequences that are shorter or longer than the particular described domain can include, if desired, a sequence that is complementary to the sequence of OX40In CAR. In some embodiments, the CAR can include a transmembrane domain derived from OX 40. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of OX40, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from OX 40. In some embodiments, the co-stimulatory domain comprises an intracellular domain of OX40 or a fragment thereof. In some embodiments, the CAR may comprise two domains derived from OX40, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence comprising the transmembrane domain and the intracellular domain of OX40, and the CAR comprises amino acids 215 to 277 of OX 40. It is understood that OX40 sequences shorter or longer than the particular described domain can be included in the CAR if desired.

ICOS，Inducible T cell costimulatory precursor (ICOS), also known as CD278, is a CD28 superfamily of costimulatory receptors expressed on activated T cells. The ICOS polypeptide may have an amino acid sequence corresponding to a sequence having GenBank No. NP 036224.1 (NP 036224.1, gi. See GenBank NP 036224 for reference to domains within ICOS, such as signal peptides of amino acids 1-20; an extracellular domain of amino acids 21-140; a transmembrane domain of amino acids 141-161; an intracellular domain of amino acids 162-199. In some embodiments, the CAR can include a transmembrane domain derived from ICOS. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of ICOS, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from ICOS. In some embodiments, the co-stimulatory domain comprises the intracellular domain of ICOS or a fragment thereof. In some embodiments, the CAR may comprise two domains derived from ICOS, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence comprising the transmembrane domain and the intracellular domain of ICOS, and the CAR comprises amino acids 141 to 199 of ICOS. It is understood that ICOS sequences shorter or longer than the particular described domain can be included in the CAR if desired.

2B42B4 (CD 244) is a co-stimulatory receptor expressed on both NK cells and CD8+ T cells. Their targets are hematopoietic cells (including B-cells and T-cells) and non-MHC like molecules expressed on activated monocytes and granulocytes (CD 48). 2B4 is activated by binding of its ligand to the target cell, resulting in NK (or T cell) activation and killing of the target cell. The 2B4 polypeptide can have an amino acid sequence corresponding to a sequence having accession numbers q9bzw8.2 (NP _001160135.1, gi 47605541) or a fragment thereof. See GenBank NP _001160135.1 for reference to a domain within 2B4, e.g., a signal peptide of amino acids 1-21; an extracellular domain of amino acids 22-229; a transmembrane domain of amino acids 230-250; an intracellular domain of amino acids 251-370. In some embodiments, the CAR can include a transmembrane domain derived from 2B 4. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of 2B4 or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from 2B 4. In some embodiments, the co-stimulatory domain comprises the intracellular domain of 2B4 or a fragment thereof. In some embodiments, the CAR may include two domains derived from 2B4, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of 2B4, and the CAR includes amino acids 230 to 370 of 2B 4. It is understood that 2B4 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

CD27: CD27 (TNFRSF 7) is a transmembrane receptor, expressed on human CD8+, CD4+ T cell subsets, NKT cells, NK cell subsets and hematopoietic progenitor cells, and induced in FOXP3+ CD4T cells and B cell subsets. Previous studies found that CD27 can actively provide co-stimulatory signals in vivo, increasing human T cell survival and anti-tumor activity. (see Song and Powell; oncoimmunology 1, no.4 (2012): 547-549). The CD27 polypeptide may have an amino acid sequence corresponding to a sequence having UniProtKB/Swiss-Prot No.: P26842.2 (GenBank NP _001233.1, gi 269849546) or a fragment thereof. See GenBank NP-001233 for reference to domains within CD27, e.g., amino acids 1-19Peptide no; an extracellular domain of amino acids 20-191; a transmembrane domain of amino acids 192-212; an intracellular domain of amino acids 213-260. In some embodiments, the CAR can include a transmembrane domain derived from CD 27. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD27, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 27. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD27 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD27, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of CD27, and the CAR includes amino acids 192 to 260 of CD 27. It is understood that a CD27 sequence that is shorter or longer than a particular described domain may be included in a CAR, if desired.

CD30: CD30 and its ligand (CD 30L) belong to members of the Tumor Necrosis Factor Receptor (TNFR) and Tumor Necrosis Factor (TNF) superfamily, respectively. CD30 behaves in many ways similar to Ox40 and enhances TCR-stimulation-induced proliferation and cytokine production (Goronzy and Weyand, arthritis, research)&therapy 10, no. S1 (2008): S3). The CD30 polypeptide may have an amino acid sequence corresponding to the sequence of GenBank No.: AAA51947.1 (GenBank NP _001234.3, gi 180096) or a fragment thereof. See GenBank NP _001234.3 for reference to domains within CD30, e.g., signal peptides of amino acids 1-18; an extracellular domain of amino acids 19-385; a transmembrane domain of amino acids 386 to 406; an intracellular domain of amino acids 407-595. In some embodiments, the CAR can include a transmembrane domain derived from CD 30. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD30, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 30. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD30 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD30, a costimulatory signaling domain and a transmembrane domain. In a 1 In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of CD30, and the CAR includes amino acids 386 to 595 of CD 30. It is understood that a CD30 sequence that is shorter or longer than a particular described domain may be included in a CAR, if desired.

CD40: CD40 is a 48kD transmembrane glycoprotein surface receptor and is one of the members of the Tumor Necrosis Factor Receptor Superfamily (TNFRSF). Exemplary amino acid sequences of human CD40 are described, for example, in accession numbers: ALQ33424.1, genBank NP-001241.1, GI 957949089.CD40 was originally thought to be a costimulatory receptor expressed on APCs, playing a central role in B cell and T cell activation. The ligand CD154 of CD40 (also known as TRAP, T-BAM, CD40 ligand or CD 40L) is a type II integral membrane protein. See GenBank NP _001241.1 for reference to domains within CD40, e.g., signal peptides of amino acids 1-20; an extracellular domain of amino acids 21-193; a transmembrane domain of amino acids 194-215; an intracellular domain of amino acids 216-277. In some embodiments, the CAR can include a transmembrane domain derived from CD 40. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD40, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 40. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD40 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD40, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of CD40, and the CAR includes amino acids 194 to 277 of CD 40. It is understood that CD40 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

CD2The binding of the CD2 molecule to its ligand CD58 co-stimulates the proliferation, cytokine production and effector function of the T cells, particularly the CD28 deficient T cell subset. CD58 is widely expressed on APCs, including dendritic cells. Binding of CD2 to CD28 ^- CD8 ⁺ The TCR signal was amplified in T cells, indicating that the CD2-CD58 interaction has a true co-stimulatory effect.CD28 stimulation by CD2 signaling ^- CD8 ⁺ Control of viral infection by T cells, but may also promote CD28 ^- CD8 ⁺ Continued expansion of T cells under chronic stimulation with persistent Ag (Judith Leitner Jet et al, immunol,2015, 195 (2) 477-487). The CD2 polypeptide may have an amino acid sequence corresponding to the sequence of seq id no: NP _ 001758.2gi. See GenBank NP _001758.2 for reference to domains within CD2, e.g., signal peptides of amino acids 1-24; an extracellular domain of amino acids 25-209; a transmembrane domain of amino acids 210-235; an intracellular domain of amino acids 236-351. In some embodiments, the CAR can include a transmembrane domain derived from CD 2. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD2, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from CD 2. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD2 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD2, a costimulatory transduction domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of CD2, and the CAR includes amino acids 210 to 351 of CD 2. It is understood that CD2 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

LIGHTTNF superfamily member 14 (also known as LTg, CD258, HVEML, and LIGHT) is a costimulatory receptor involved in cellular immune responses. LIGHT can act as a co-stimulatory factor to activate lymphoid cells and as a block to herpes virus infection. LIGHT has been shown to stimulate T cell proliferation, triggering apoptosis in a variety of tumor cells. LIGHT is present in T cells and stromal cells. LIGHT is expressed on immature Dendritic Cells (DCs) produced by human PBMCs. LIGHT is involved in co-stimulating human T cell proliferation, amplifying the NF-. Kappa.B signaling pathway, and preferentially inducing the production of IFN-. Gamma.rather than IL-4 in the presence of antigen signaling. (Tamada Ket al., J Immunol,2000,164 (8) 4105-4110). The LIGHT polypeptide can have an amino acid sequence identical to the accession number: NP _001363816.1GI:1777376047 or its amino acid sequenceAnd (3) fragment. See GenBank NP _001363816.1 for reference to domains within LIGHT, such as the intracellular domain of amino acids 1-37; a transmembrane domain of amino acids 38-58; an extracellular domain of amino acids 59-240. In some embodiments, the CAR cytoplasmic domain can include a co-stimulatory domain derived from LIGHT. In some embodiments, the co-stimulatory domain comprises the intracellular domain of LIGHT, or a fragment thereof. It is understood that LIGHT sequences shorter or longer than the particular described domain can be included in the CAR if desired.

GITR，TNF receptor superfamily member 18 (also known as TNFRSF18, AITR, GITR; CD357; GITR-D; ENERGEN) is increased in expression upon T cell activation. Stimulation of T cells by GITR can enhance immunity to tumor and viral pathogens and exacerbate autoimmune disease. The effect of stimulation by GITR is generally thought to be due to a reduction in the effector activity of immunosuppressive CD4+ CD25+ regulatory T (TReg) cells. (Shevach, E. And Stephens, G.Nat Rev Immunol 6,613-618 (2006)). The LIGHT polypeptide can have an amino acid sequence similar to accession number: AAI52382.1, genBank NP-004186.1, GI:158931986 or a fragment thereof. See GenBank NP _004186.1 for reference to domains within GITR, e.g., signal peptides of amino acids 1-25; an extracellular domain of amino acids 26-162; a transmembrane domain of amino acids 163-183; an intracellular domain of amino acids 184-241. In some embodiments, the CAR can include a transmembrane domain derived from GITR. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of GITR, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from GITR. In some embodiments, the co-stimulatory domain comprises an intracellular domain of GITR or a fragment thereof. In some embodiments, the CAR may include two domains derived from GITR, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence comprising the transmembrane domain and the intracellular domain of GITR, and the CAR comprises amino acids 163 to 241 of GITR. It is understood that, if desired, GITR sequences shorter or longer than the particular described domain may be included in the CAR.

DR3TNF receptor superfamily member 25 (also known as DR3, TR3, DDR3, LARD, APO-3, TRAMP, WSL-1, GEF720, WSL-LR, PLEKHG5, or TNFRSF 12) is preferentially expressed in lymphocyte-rich tissues and plays a role in regulating lymphocyte homeostasis. This receptor stimulates NF-. Kappa.B activation and regulates apoptosis. The signal transduction of this receptor is mediated by various adaptor-containing death domains. This gene has been reported to encode multiple alternatively spliced transcript variants of different isoforms, most of which are potential secreted molecules. The selective splicing of this gene in B and T cells, which mainly produces full-length membrane-bound subtypes and is involved in controlling T cell activation-induced lymphocyte proliferation, encounters programmed changes upon T cell activation. The DR3 polypeptide can have accession number: AAI17190.1, genBank NP _003781.1gi, 109658976, or a fragment thereof. See GenBank NP _003781.1 for reference to domains within DR3, e.g., signal peptides of amino acids 1-24; an extracellular domain of amino acids 25-199; a transmembrane domain of amino acids 200-220; an intracellular domain of amino acids 221-417. In some embodiments, the CAR can include a transmembrane domain derived from DR 3. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of DR3 or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from DR 3. In some embodiments, the co-stimulatory domain comprises an intracellular domain of DR3 or a fragment thereof. In some embodiments, the CAR may include two domains derived from DR3, a costimulatory signaling domain and a transmembrane domain. In one embodiment, the CAR has an amino acid sequence that includes a transmembrane domain and an intracellular domain of DR3, and the CAR includes amino acids 200 to 417 of DR 3. It is understood that DR3 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

CD43，CD43 (also known as SPN sialoprotein, LSN, GALGP, GPL 115) is a highly sialylated glycoprotein with antigen-specific T cell activation function, present in thymocytes, T lymphocytes, monocytes, granulocytes and certain B lymphocytesThe cell surface. It comprises a mucin-like extracellular domain, a transmembrane region and a carboxy-terminal intracellular region. In stimulated immune effector cells, the extracellular domain of certain cell types undergoes proteolytic cleavage, releasing soluble extracellular fragments. The CD43 polypeptide may have an amino acid sequence that is homologous to GenBank NP _003114.1, accession No.: EAW80016.1 GI:119600422 or a fragment thereof. See GenBank NP _003114.1 for reference to domains within CD43, such as signal peptides of amino acids 1-19; an extracellular domain of amino acids 20-253; a transmembrane domain of amino acids 254 to 276; an intracellular domain of amino acids 277-400. In some embodiments, the CAR can include a transmembrane domain derived from CD 43. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD43, or a fragment thereof. In some embodiments, the CAR cytoplasmic domain can include a costimulatory domain derived from CD 43. In some embodiments, the co-stimulatory domain comprises the intracellular domain of CD43 or a fragment thereof. In some embodiments, the CAR may include two domains derived from CD43, a costimulatory signaling domain and a transmembrane domain. In some embodiments, the CAR has an amino acid sequence that includes the transmembrane domain and the intracellular domain of CD43, and the CAR includes amino acids 254 to 400 of CD 43. It is understood that CD43 sequences shorter or longer than the particular described domain may be included in the CAR if desired.

CD4，Cluster of differentiation 4 (CD 4), also known as T cell surface glycoprotein CD4, is a glycoprotein present on the surface of immune cells such as helper T cells, monocytes, macrophages and dendritic cells. In some embodiments, the CAR can include a transmembrane domain derived from CD 4. CD4 exists in several isoforms. It will be appreciated that any isomer may be selected to achieve the desired function. Exemplary isomers include isomer 1 (NP — 000607.1, gi 10835167), isomer 2 (NP — 001181943.1, gi. See GenBank NP _000607.1 for reference to domains within CD4, e.g., such as the signal peptide of amino acids 1-25; extracellular knot of amino acids 26-396A domain; a transmembrane domain of amino acids 397-418; an intracellular domain of amino acids 419-458. In some embodiments, the CAR can include a transmembrane domain derived from CD 4. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD4, or a fragment thereof. It is understood that additional sequences of CD4 beyond the transmembrane domain of amino acids 397 to 418 may be included in the CAR if desired. It is further understood that a CD4 sequence that is shorter or longer than a particular described domain may be included in a CAR, if desired.

CD8，Cluster of differentiation 8 (CD 8) is a transmembrane glycoprotein that acts as a co-receptor for T Cell Receptors (TCRs). CD8 binds to Major Histocompatibility Complex (MHC) molecules and is specific for MHC class I proteins. In some embodiments, the CAR can include a transmembrane domain derived from CD 8. The CD8 polypeptide may have an amino acid sequence corresponding to the sequence provided below with GenBank No. NP-001139345.1 (GI: 225007536) or a fragment thereof. See GenBank NP _001139345.1 for reference to a domain within CD8, e.g., a signal peptide such as amino acids 1-21; an extracellular domain of amino acids 22-182; a transmembrane domain of amino acids 183-203; an intracellular domain of amino acids 204-235. In some embodiments, the CAR can include a hinge domain derived from CD 8. In some embodiments, the hinge domain can include amino acids 137-182 of the CD8 polypeptide provided below. In some embodiments, the CAR can include a transmembrane domain derived from CD 8. In some embodiments, the CAR transmembrane domain comprises the transmembrane region of CD8 (e.g., amino acids 183 to 203 of the following sequence), or a fragment thereof. In another embodiment, the CAR can include amino acids 137-203 of the CD8 polypeptide provided below. In yet another embodiment, the CAR can include amino acids 137-209 of the CD8 polypeptide provided below. It is understood that additional CD8 sequences, in addition to the hinge domain of amino acids 137 to 182 and the transmembrane domain of amino acids 183 to 203, may be included in the CAR if desired. It is further understood that CD8 sequences shorter or longer than the particular described domain may be included in the CAR, if desired.

Thus, for exemplary purposes, a disclosed CAR can include, from N-terminus to C-terminus, an anti-BCMA antibody or antigen binding fragment (e.g., a scFv disclosed herein), a hinge (e.g., a CD8 hinge or a CD28 hinge), a transmembrane region (e.g., a CD8 transmembrane region or a CD28 transmembrane region), a costimulatory domain (e.g., the intracellular region of 4-1BB, CD28, or both), and a signaling domain (e.g., the T cell signaling domain of CD3 ζ).

5.4 Polynucleotide and vectors

The invention also provides polynucleotides encoding the polypeptides described herein (e.g., anti-BCMA antibodies or antigen-binding fragments or CARs that specifically bind BCMA). The term "polynucleotide encoding a polypeptide" encompasses: a polynucleotide comprising only the coding sequence for the polypeptide; and polynucleotides comprising additional coding and/or non-coding sequences. The polynucleotide of the present invention may be in the form of RNA or in the form of DNA. The DNA may be cDNA, genomic DNA, or synthetic DNA, and may be double-stranded or single-stranded. The single-stranded DNA may be a coding strand or a non-coding (antisense) strand. The polynucleotides disclosed herein may be mRNA.

The present invention specifically contemplates polynucleotides encoding any of the anti-BCMA antibodies or antigen-binding fragments disclosed herein. For illustrative purposes, in some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen-binding fragment comprising (a) a VL comprising (1) a VL CDR1 having the amino acid sequence set forth in SEQ ID NO: 8; (2) VL CDR2 having an amino acid sequence shown by SEQ ID NO. 18; and (3) a VL CDR3 having an amino acid sequence shown by SEQ ID NO 28; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDR; and/or, (b) a VH comprising (1) a VH CDR1 having an amino acid sequence shown by SEQ ID NO: 39; (2) VH CDR2 having an amino acid sequence shown by SEQ ID NO: 51; and (3) a VH CDR3 having an amino acid sequence shown by SEQ ID NO: 63; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs. In some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen-binding fragment comprising (a) a VL having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID No. 75; and/or, (b) a VH having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 87. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen-binding fragment disclosed herein, which antibody or antigen-binding fragment comprises a VL and a VH, wherein the VL comprises a VL CDR1, CDR2, and CDR3, and the VH comprises a VH CDR1, CDR2, and CDR3, and wherein the VL CDR1, VL CDR2, VL CDR3, VH CDR1, VH CDR2, and VH CDR3 have the amino acid sequences set forth in

SEQ ID NOs

8, 18, 28, 39, 51, and 63, respectively; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the CDRs. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen-binding fragment as disclosed herein, comprising a VL and a VH, wherein the VL and VH have the amino acid sequences set forth in SEQ ID NOs 75 and 87, respectively. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the VL and VH are connected by a linker. The linker may be a flexible linker or a rigid linker. In some embodiments, the linker has an amino acid sequence of (GGGGS) n, n =1, 2, 3, 4, or 5 (SEQ ID NO: 155). In some embodiments, the linker has an amino acid sequence of (EAAAK) n, n =1, 2, 3, 4, or 5 (SEQ ID NO: 156). In some embodiments, the linker has an amino acid sequence of (PA) nP, n =1, 2, 3, 4, or 5 (SEQ ID NO: 157). In some embodiments, the linker has the amino acid sequence GGGGSGGGGSGGGS (SEQ ID NO: 158).

In some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen binding fragment disclosed herein, which comprises a VL having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID No. 75. In some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen-binding fragment disclosed herein, which comprises a VL having the amino acid sequence set forth in SEQ ID NO: 75.

In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 99. The present invention also provides a polynucleotide that hybridizes with the polynucleotide having the nucleotide sequence set forth in SEQ ID NO. 99. In some embodiments, hybridization is performed under high stringency conditions known to those skilled in the art. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen-binding fragment disclosed herein, which antibody or antigen-binding fragment comprises a VH having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID No. 87. In some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen binding fragment disclosed herein, which comprises a VH having the amino acid sequence shown by SEQ ID No. 87.

In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 111. The present invention also provides a polynucleotide which hybridizes with the polynucleotide having the nucleotide sequence represented by SEQ ID NO 111. In some embodiments, the hybridization is performed under highly stringent conditions known to those skilled in the art. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

The invention also provides variants of the polynucleotides of the invention, wherein the variants encode, for example, fragments, analogs and/or derivatives of the anti-BCMA antibodies or antigen binding fragments of the invention. In some embodiments, the invention provides a polynucleotide having at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity to a polynucleotide sequence encoding an anti-BCMA antibody or antigen binding fragment as described herein.

In some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen binding fragment which is an scFv labelled as BCMA 31. In some embodiments, the polynucleotides provided herein encode an anti-BCMA antibody or antigen binding fragment having the amino acid sequence shown by SEQ ID NO 123.

The invention also provides polynucleotides encoding the disclosed TCRs. In some embodiments, the invention provides polynucleotides encoding TCR α chains comprising an anti-BCMA antibody or antigen binding fragment of the invention. In some embodiments, the invention provides polynucleotides encoding TCR β chains comprising an anti-BCMA antibody or antigen binding fragment of the invention. In some embodiments, the invention provides polynucleotides encoding TCR γ chains comprising the anti-BCMA antibodies or antigen binding fragments of the invention. In some embodiments, the invention provides polynucleotides encoding TCR δ chains comprising an anti-BCMA antibody or antigen binding fragment of the invention. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

The invention also provides polynucleotides encoding the disclosed CARs. In some embodiments, the invention provides a polynucleotide encoding a CAR that specifically binds BCMA, the CAR comprising, from N-terminus to C-terminus: a BCMA binding domain comprising an anti-BCMA antibody or antigen binding fragment provided by the invention, (b) a transmembrane domain, and (c) a cytoplasmic domain. The transmembrane and cytoplasmic domains can be any of the transmembrane and cytoplasmic domains disclosed herein. For illustrative purposes, provided herein, for example, are polynucleotides encoding a CAR that specifically binds BCMA, the CAR comprising, from N-terminus to C-terminus: a BCMA binding domain comprising (a) a scFv against BCMA provided by the invention, (b) a transmembrane domain comprising the CD28 transmembrane region, and (c) a cytoplasmic domain comprising a CD3 zeta signaling domain and a 4-1BB co-stimulatory domain. The polynucleotide may be in the form of DNA. The polynucleotide may be in the form of an mRNA.

In some embodiments, the polynucleotides provided herein encode an anti-BCMA CAR having at least 85%, at least 90%, at least 95%, at least 98%, or 100% sequence identity to the amino acid sequence set forth by SEQ ID No. 138. In some embodiments, the polynucleotides provided herein encode an anti-BCMA CAR having an amino acid sequence in the group consisting of SEQ ID NO: 138.

In some embodiments, the polynucleotides provided herein have a nucleotide sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the sequence set forth in SEQ ID No. 150. The present invention also provides a polynucleotide that hybridizes to a polynucleotide having the nucleotide sequence set forth in SEQ ID NO. 150. In some embodiments, the hybridization is performed under highly stringent conditions known to those skilled in the art.

As used herein, the phrase "a polynucleotide having a nucleotide sequence that is at least about 95% identical to a polynucleotide sequence" means that the nucleotide sequence of the polynucleotide is identical to the reference sequence, except that up to 5 point mutations may be included in every 100 nucleotides of the reference sequence. In other words, to obtain a polynucleotide whose sequence has at least 95% identity to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or replaced with other nucleotides, or up to 5% of the total number of nucleotides in the reference sequence may be inserted into the reference sequence. These mutations of the reference sequence can occur at the 5 'or 3' terminal sites of the reference nucleotide sequence or anywhere between these terminal sites, interspersed individually between nucleotides in the reference sequence or in one or more contiguous groups in the reference sequence.

The polynucleotide variants may comprise alterations at coding regions, non-coding regions, or both. In some embodiments, a polynucleotide variant comprises an alteration that produces a silent substitution, addition, or deletion, but does not alter the property or activity of the encoded polypeptide. In some embodiments, a polynucleotide variant comprises silent substitutions (due to the degeneracy of the genetic code) that result in no alteration of the amino acid sequence of the polypeptide. Polynucleotide variants are produced for a variety of reasons, such as, for example, optimizing codon expression for a particular host (e.g., changing codons in human mRNA to codons preferred by bacteria, such as e. In some embodiments, a polynucleotide variant comprises at least one silent mutation in a non-coding region or a coding region of a sequence.

In some embodiments, polynucleotide variants are prepared to modulate or alter the expression (or level of expression) of the encoded polypeptide. In some embodiments, polynucleotide variants are prepared to increase expression of the encoded polypeptide. In some embodiments, polynucleotide variants are prepared to reduce expression of the encoded polypeptide. In some embodiments, the polynucleotide variant increases expression of the encoded polypeptide compared to the parent polynucleotide sequence. In some embodiments, the polynucleotide variant reduces the expression of the encoded polypeptide compared to the parent polynucleotide sequence.

In some embodiments, the polynucleotide comprises a coding sequence for a polypeptide (e.g., a CAR or an antibody) fused in the same reading frame to a polynucleotide that facilitates expression and secretion of the polypeptide from the host cell (e.g., a leader sequence that is a secretory sequence that controls transport of the polypeptide). The polypeptide may have a leader sequence which is cleaved by the host cell to form a "mature" polypeptide form.

In some embodiments, a polynucleotide includes a coding sequence for a polypeptide (e.g., a CAR or an antibody) fused in the same reading frame to a tag or label sequence. For example, in some embodiments, the tag sequence is a hexa-histidine tag (HIS-tag), which allows for efficient purification of polypeptides fused to the tag. In some embodiments, when a mammalian host (e.g., COS-7 cells) is used, the marker sequence is a Hemagglutinin (HA) tag derived from an influenza hemagglutinin protein. In some embodiments, the tag sequence is a FLAGTM tag. In some embodiments, the label may be used in combination with other labels or tags.

In some embodiments, the polynucleotide is isolated. In some embodiments, the polynucleotide is substantially purified.

The invention also provides vectors and cells comprising the polynucleotides of the invention. In some embodiments, vectors comprising a polynucleotide provided herein are provided. The vector may be an expression vector. In some embodiments, the invention provides vectors comprising polynucleotides encoding the anti-BCMA antibodies or antigen binding fragments of the invention. In some embodiments, the vectors provided herein comprise a polynucleotide encoding a polypeptide that is part of an anti-BCMA antibody or antigen binding fragment of the invention. In some embodiments, the invention provides a vector comprising a polynucleotide encoding a CAR or TCR of the invention. In some embodiments, the invention provides a vector comprising a polynucleotide encoding a polypeptide that is part of a CAR or TCR of the invention.

In some embodiments, the invention provides recombinant expression vectors that can be used to amplify and express a polynucleotide encoding a CAR/TCR of the invention that specifically binds BCMA or the anti-BCMA antibody or antigen-binding fragment. For example, the recombinant expression vector can be a replicable DNA construct comprising a DNA fragment, synthetic or derived from a cDNA, encoding a polypeptide chain of a CAR/TCR or anti-BCMA antibody, operably linked to suitable transcriptional and/or translational regulatory elements derived from a mammalian, microbial, viral or insect gene. In some embodiments, a viral vector is used. DNA regions are "operably linked" when they are functionally related to each other. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or is operably linked to a coding sequence if the position of the ribosome binding site allows translation. In some embodiments, the structural elements intended for certain expression systems include a leader sequence that enables the host cell to secrete the translated protein extracellularly. In some embodiments, the polypeptide may include an N-terminal methionine residue in the absence of a leader or transport sequence for expression of the recombinant protein.

Various combinations of expression hosts/vectors may be used. Expression vectors useful for eukaryotic hosts include, for example, vectors containing expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Expression vectors useful for bacterial hosts include known bacterial plasmids, such as those from E.coli, including pCR1, pBR322, pMB9, and derivatives thereof, as well as a broader host range of plasmids, such as M13 and other filamentous single stranded DNA phages.

In some embodiments, the CAR/TCR of the invention or the anti-BCMA antibody or antigen binding fragment is expressed in one or more vectors. Suitable host cells for expression include prokaryotes, yeast cells, insect cells, or higher eukaryotic cells under the control of an appropriate promoter. Suitable cloning and expression vectors for bacterial, fungal, yeast and mammalian cell hosts, as well as methods of protein production, including antibody production, are well known in the art.

Examples of suitable mammalian host cell lines include, but are not limited to, COS-7 (derived from monkey kidney), L-929 (derived from murine fibroblast), C127 (derived from murine breast tumor), 3T3 (derived from murine fibroblast), CHO (derived from Chinese hamster ovary), heLa (derived from human cervical cancer), BHK (derived from hamster kidney fibroblast), HEK-293 (derived from human embryonic kidney) cell lines, and variants thereof. Mammalian expression vectors can include non-transcribed elements (e.g., origins of replication), suitable promoters and enhancers for linkage to the gene to be expressed, and other 5 'or 3' flanking non-transcribed and 5 'or 3' untranslated sequences (e.g., necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and transcriptional termination sequences). Expression of recombinant proteins in insect cell culture systems (e.g., baculovirus) also provides a powerful method for producing properly folded and biologically functional proteins. Baculovirus systems for the production of heterologous proteins in insect cells are well known to those skilled in the art.

The invention also provides a host cell comprising a polypeptide of the invention, a polynucleotide encoding a polypeptide of the invention, or a vector comprising such a polynucleotide. In some embodiments, the invention also provides a host cell comprising a vector comprising a polynucleotide disclosed herein. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide encoding an anti-BCMA antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide encoding a polypeptide that is part of an anti-BCMA antibody or antigen-binding fragment of the invention. In some embodiments, the invention provides host cells comprising a polynucleotide encoding an anti-BCMA antibody or antigen-binding fragment of the invention. In some embodiments, the cell produces an anti-BCMA antibody or antigen binding fragment of the invention. In some embodiments, the invention provides a host cell comprising a vector comprising a polynucleotide encoding a CAR or TCR of the invention. In some embodiments, the host cells provided herein comprise a vector comprising a polynucleotide molecule encoding a polypeptide that is part of a CAR or TCR described herein. In some embodiments, the invention provides a host cell comprising a polynucleotide encoding a CAR or TCR of the invention. In some embodiments, the host cell produces a BCMA CAR or TCR of the invention.

5.5 cells

The invention provides cells comprising a polynucleotide disclosed herein. In some embodiments, the invention provides a cell comprising a polynucleotide encoding a polypeptide disclosed herein. In some embodiments, the invention provides a cell comprising a vector comprising a polynucleotide disclosed herein. In some embodiments, the invention provides cells capable of recombinantly expressing a polypeptide disclosed herein. The polypeptide may be an anti-BCMA antibody or antigen binding fragment. The polypeptide can be a BCMA CAR. The polypeptide may be a BCMA TCR.

In some embodiments, the cells provided herein are immune effector cells. In some embodiments, the immune effector cell is selected from the group consisting of a T cell, a B cell, a Natural Killer (NK) cell, an NKT cell, a macrophage, a granulocyte, a neutrophil, an eosinophil, a mast cell, and a basophil. In some embodiments, the immune effector cells provided herein are selected from the group consisting of T cells, NK cells, NKT cells, macrophages, neutrophils, and granulocytes. In some embodiments, the immune effector cells provided herein are T cells. In some embodiments, the immune effector cells provided herein are NK cells. In some embodiments, the immune effector cells provided herein are NKT cells. In some embodiments, the immune effector cell provided by the invention is a macrophage. In some embodiments, the immune effector cells provided herein are neutrophils. In some embodiments, the immune effector cells provided herein are granulocytes.

In some embodiments, the immune effector cells provided by the present invention may be genetically engineered. In some embodiments, the genetically engineered immune effector cells provided herein are isolated. In some embodiments, the genetically engineered immune effector cells provided herein are substantially purified.

Thus, in some embodiments, the invention provides immune effector cells capable of recombinantly expressing a polypeptide (e.g., an antibody or CAR) disclosed herein. The invention also provides an immune effector cell (e.g., a T cell) comprising a polynucleotide encoding a polypeptide (e.g., an antibody or CAR) disclosed herein or a vector comprising a polynucleotide disclosed herein. In some embodiments, the invention provides immune effector cells (e.g., T cells) comprising a polynucleotide encoding an anti-BCMA antibody or antigen binding fragment disclosed by the invention. In some embodiments, the invention provides immune effector cells (e.g., T cells) capable of recombinantly expressing an anti-BCMA antibody or antigen-binding fragment disclosed herein. In some embodiments, the invention provides immune effector cells comprising a polynucleotide encoding a BCMA CAR disclosed herein. In some embodiments, the invention provides immune effector cells (e.g., T cells; e.g., BCMA CART cells) capable of recombinantly expressing a BCMA CAR disclosed herein. In some embodiments, the invention provides immune effector cells comprising a polynucleotide encoding a BCMA TCR as disclosed herein. In some embodiments, the invention provides immune effector cells (e.g., T cells; e.g., BCMA TCRT cells) capable of recombinantly expressing a BCMA TCR as disclosed herein.

In some embodiments, the immune effector cells provided herein are T cells. The T cell may be a cytotoxic T cell, a helper T cell, or a γ δ T, CD4+/CD8+ double positive T cell, CD4+ T cell, CD8+ T cell, CD4/CD8 double negative T cell, CD3+ T cell, naive T cell, effector T cell, cytotoxic T cell, helper T cell, memory T cell, regulatory T cell, th0 cell, th1 cell, th2 cell, th3 (Treg) cell, th9 cell, th17 cell, th α β helper cell, tfh cell, stem cell-like central memory TSCM cell, central memory TCM cell, effector memory TEM cell, effector memory tea cell, or γ δ T cell. In some embodiments, the T cell is a cytotoxic T cell. In some embodiments, the T cell is genetically engineered. In some embodiments, the T cells provided herein are isolated. In some embodiments, the T cells provided herein are substantially purified.

In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from a subject. As used herein, a genetically engineered cell "derived from" a source cell refers to a genetically engineered cell obtained by obtaining a source cell and genetically manipulating the source cell. The source cell may be from a natural source. For example, the source cell can be a primary cell isolated from a subject. The subject may be an animal or a human. The source cell may also be a cell that has been passaged or genetically manipulated in vitro.

In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from a human. Immune effector cells (e.g., T cells) can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, T cell lines available in the art may be used. In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from peripheral blood. In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from bone marrow. In some embodiments, the genetically engineered cells provided herein are derived from cells isolated from Peripheral Blood Mononuclear Cells (PBMCs).

In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from stem cells or progenitor cells. In some embodiments, the stem or progenitor cells are selected from the group consisting of T cell progenitors, hematopoietic stem/progenitors, hematopoietic multipotent progenitors, embryonic stem cells, and induced pluripotent cells. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from T cell progenitors. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from hematopoietic stem/progenitor cells. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from hematopoietic pluripotent progenitor cells. In some embodiments, the genetically engineered cells provided herein are derived from cells differentiated in vitro from embryonic stem cells. In some embodiments, the genetically engineered cells provided herein are derived from cells that induce the differentiation of pluripotent cells in vitro.

In some embodiments, the invention provides a population of cells comprising a cell disclosed herein. The cells disclosed herein can comprise a polynucleotide encoding, or recombinantly express, a polypeptide disclosed herein. The polypeptide can be an anti-BCMA antibody or antigen binding fragment, BCMA CAR, or BCMA TCR. The cell population may be a homogenous cell population. The cell population may be a heterogeneous cell population. In some embodiments, the cell population can be a heterogeneous cell population comprising any combination of the presently disclosed cells. In some embodiments, the population of cells is derived from Peripheral Blood Mononuclear Cells (PBMCs), peripheral Blood Lymphocytes (PBLs), tumor Infiltrating Lymphocytes (TILs), cytokine-induced killer Cells (CIKs), lymphokine-activated killer cells (LAKs), or bone Marrow Infiltrating Lymphocytes (MILs). In some embodiments, the cell populations provided herein are derived from PBMCs. In some embodiments, the cell populations provided herein are derived from PBLs. In some embodiments, the cell populations provided herein are derived from TIL. In some embodiments, the cell populations provided herein are derived from CIK. In some embodiments, the cell population provided herein is derived from LAK. In some embodiments, the cell populations provided herein are derived from MILs. The population of cells can be genetically engineered to recombinantly express the disclosed polypeptides (e.g., antibodies or CARs). In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding a polypeptide (e.g., an antibody or CAR) disclosed herein or a vector bearing a polynucleotide disclosed herein. In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding an anti-BCMA antibody or antigen binding fragment disclosed by the invention. In some embodiments, the invention provides a population of cells recombinantly expressing an anti-BCMA antibody or antigen binding fragment disclosed herein. In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding a BCMA CAR disclosed herein. In some embodiments, the invention provides a population of cells (e.g., BCMA CART cells) that are capable of recombinantly expressing the disclosed BCMA CARs. In some embodiments, the invention provides a population of cells comprising a polynucleotide encoding a BCMA TCR as disclosed herein. In some embodiments, the invention provides a population of cells (e.g., BCMA TCRT cells) that recombinantly express the disclosed BCMA TCRs.

5.6 pharmaceutical compositions

The invention also provides pharmaceutical compositions comprising the anti-BCMA antibodies or antigen binding fragments disclosed herein. The invention also provides a pharmaceutical composition comprising the genetically engineered immune effector cell disclosed by the invention. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of an anti-BCMA antibody or antigen-binding fragment thereof disclosed herein, further comprising a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprises a pharmaceutically effective amount of the genetically engineered cells disclosed herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is useful in immunotherapy. In some embodiments, the pharmaceutical composition is useful in immuno-oncology. In some embodiments, the pharmaceutical composition is useful in inhibiting tumor growth in a subject (e.g., a human patient). In some embodiments, the pharmaceutical composition is useful in treating cancer in a subject (e.g., a human patient).

In some embodiments, the pharmaceutical compositions provided herein comprise an anti-BCMA antibody or antigen-binding fragment provided herein. The anti-BCMA antibody or antigen binding fragment can be present at various concentrations. In some embodiments, the pharmaceutical compositions provided herein comprise 1-1000mg/ml of the soluble anti-BCMA antibody or antigen-binding fragment provided herein. In some embodiments, the pharmaceutical composition comprises a soluble anti-BCMA antibody or antigen-binding fragment provided by the present invention in an amount of 10-500mg/ml, 10-400mg/ml, 10-300mg/ml, 10-200mg/ml, 10-100mg/ml, 20-100mg/ml, or 50-100mg/ml. In some embodiments, the pharmaceutical compositions provided herein comprise an anti-BCMA antibody or antigen-binding fragment provided herein in an amount of about 10mg/ml, about 20mg/ml, about 30mg/ml, about 40mg/ml, about 50mg/ml, about 60mg/ml, about 70mg/ml, about 80mg/ml, about 90mg/ml, about 100mg/ml, about 120mg/ml, about 150mg/ml, about 180mg/ml, about 200mg/ml, about 300mg/ml, about 500mg/ml, about 800mg/ml, or about 1000mg/ml.

Pharmaceutical compositions comprising genetically engineered immune effector cells (e.g., T cells) disclosed herein may comprise purified cell populations. As described herein, the percentage of cells in a cell population can be readily determined by one skilled in the art using a variety of well-known methods. The purity of a population of cells comprising genetically engineered cells provided herein can range from about 20% to about 25%, about 25% to about 30%, about 30% to about 35%, about 35% to about 40%, about 40% to about 45%, about 45% to about 50%, about 55% to about 60%, about 65% to about 70%, about 70% to about 75%, about 75% to about 80%, about 80% to about 85%, about 85% to about 90%, about 90% to about 95%, about 95% to about 100%. In some embodiments, the purity of a cell population comprising immune effector cells provided herein may range from about 20% to about 30%, from about 20% to about 50%, from about 20% to about 80%, from about 20% to about 100%, from about 50% to about 80%, or from about 50% to about 100%. The person skilled in the art can easily adjust the dosage; for example, a decrease in purity may require an increase in dosage.

The invention also provides a kit for preparing a pharmaceutical composition comprising an anti-BCMA antibody or antigen-binding fragment disclosed herein. In some embodiments, the kit comprises an anti-BCMA antibody or antigen binding fragment disclosed herein, in one or more containers, and a pharmaceutically acceptable carrier. In another embodiment, the kit may include an anti-BCMA antibody or antigen binding fragment disclosed herein for administration to a subject. In particular embodiments, the kit includes instructions for the preparation and/or administration of an anti-BCMA antibody or antigen-binding fragment.

The invention also provides kits for preparing the immune effector cells (e.g., T cells) disclosed herein. In one embodiment, the kit comprises one or more vectors for producing genetically engineered cells (e.g., T cells) that express the anti-BCMA antibodies or antigen binding fragments thereof disclosed herein. The kits may be used to generate genetically engineered immune effector cells (e.g., T cells) from autologous or non-autologous cells for administration to a compatible subject.

In some embodiments, the invention provides pharmaceutical compositions comprising an anti-BCMA antibody or antigen binding fragment provided by the invention, wherein the composition is suitable for topical administration. In some embodiments, local administration includes intratumoral injection, peritumoral injection, paratumoral injection, intralesional injection and/or injection into tumor draining lymph nodes, or essentially any tumor-targeted injection in which the antineoplastic agent is expected to leak into primary lymph nodes adjacent to the targeted solid tumor.

Pharmaceutically acceptable carriers that may be used in the compositions provided herein include any and all physiologically compatible materials such as solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. In some embodiments, the vector is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the active ingredient (i.e., the anti-BCMA antibody or antigen binding fragment provided by the present invention, or immune effector cells) may be coated in a material to protect the active ingredient from acids and other natural conditions that may inactivate the active ingredient.

The invention also provides pharmaceutical compositions or formulations that improve the stability of anti-BCMA antibodies or antigen binding fragments to allow long term storage thereof. In some embodiments, the pharmaceutical compositions or formulations disclosed herein comprise: (a) The invention discloses anti-BCMA antibodies or antigen binding fragments; (b) a buffering agent; (c) a stabilizer; (d) a salt; (e) a filler; and/or (f) a surfactant. In some embodiments, the pharmaceutical composition or formulation is stable for at least 1 month, at least 2 months, at least 3 months, at least 6 months, at least 1 year, at least 2 years, at least 3 years, at least 5 years, or longer. In some embodiments, the pharmaceutical composition or formulation is stable when stored at 4 ℃, 25 ℃, or 40 ℃.

A buffer useful in the pharmaceutical compositions or formulations disclosed herein may be a weak acid or weak base for maintaining the acidity (pH) of the solution near a selected value after addition of another acid or base. Suitable buffering agents can maximize the stability of the formulation by maintaining control over the pH of the formulation. Suitable buffers may also ensure physiological compatibility or optimize solubility. Rheology, viscosity and other properties also depend on the pH of the formulation. Common buffers include, but are not limited to, histidine, citrate, succinate, acetate, and phosphate. In some embodiments, the buffer comprises histidine with an isotonic agent (e.g., L-histidine), and the pH may be adjusted with acids or bases known in the art. In certain embodiments, the buffering agent is L-histidine. In certain embodiments, the pH of the formulation is maintained between about 2 to about 10, or about 4 to about 8.

Stabilizers are added to pharmaceutical products to stabilize the product. Such agents may stabilize proteins in different ways. Common stabilizers include, but are not limited to, amino acids (such as glycine, alanine, lysine, arginine, or threonine), carbohydrates (such as glucose, sucrose, trehalose, raffinose, or maltose), polyols (such as glycerol, mannitol, sorbitol, cyclodextrins, or any type and molecular weight of dealkylated species), or PEG. In some embodiments, the stabilizing agent is to maximize the stability of the FIX polypeptide in the lyophilized formulation. In certain embodiments, the stabilizing agent is sucrose and/or arginine.

Fillers may be added to pharmaceutical compositions or formulations to increase the volume and mass of the product, thereby facilitating accurate metering and handling thereof. Common fillers include, but are not limited to, lactose, sucrose, glucose, mannitol, sorbitol, calcium carbonate, or magnesium stearate.

The surfactant is an amphoteric substance having a hydrophilic group and a hydrophobic group. The surfactant may be anionic, cationic, zwitterionic or nonionic. Nonionic surfactants include, but are not limited to, alkyl ethoxylates, nonylphenoxy ethers, ethoxylates, polyethylene oxides, polypropylene oxides, fatty alcohols (such as cetyl alcohol or oleyl alcohol), cocamide MEA, cocamide DEA, polysorbates, or dodecyldimethylamine oxides. In some embodiments, the surfactant is polysorbate 20 or polysorbate 80.

The pharmaceutical compositions disclosed herein may further include one or more of a buffering system, a preservative, a tonicity agent, a chelating agent, a stabilizer, and/or a surfactant, and various combinations thereof. The use of preservatives, isotonicity agents, chelating agents, stabilizers and surfactants in pharmaceutical compositions is well known to those skilled in the art. Can refer to Remington:The Science and Practice of Pharmacy，19 ^th edition，1995。

In some embodiments, the pharmaceutical composition is an aqueous formulation. Such formulations are typically solutions or suspensions, but may also include colloids, dispersions, emulsions, and multiphase materials. The term "aqueous formulation" is defined as a formulation comprising at least 50% w/w water. Likewise, the term "aqueous solution" is defined as a solution comprising at least 50% w/w water, and the term "aqueous suspension" is defined as a suspension comprising at least 50% w/w water.

In some embodiments, the pharmaceutical compositions disclosed herein are lyophilized, and a solvent and/or diluent is added to the composition by the physician or patient prior to use.

The pharmaceutical compositions disclosed herein may also include a pharmaceutically acceptable antioxidant. Examples of pharmaceutically acceptable antioxidants include: examples of pharmaceutically acceptable antioxidants include: (1) Water-soluble antioxidants such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite, and the like; (2) Oil-soluble antioxidants such as ascorbyl palmitate, butyl Hydroxyanisole (BHA), 2, 6-di-tert-butyl-p-cresol (BHT), lecithin, propyl gallate, alpha-tocopherol, etc.; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

Examples of suitable aqueous and nonaqueous carriers that can be used in the pharmaceutical compositions or formulations of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters (such as ethyl oleate). Proper fluidity can be maintained, for example, by the use of a coating material, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.

These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the presence of microorganisms can be ensured by the sterilization procedures described above and by the addition of various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol sorbic acid, and the like). It may also be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like in the compositions. In addition, prolonged absorption of the injectable pharmaceutical form may be brought about by the addition of agents delaying absorption, such as aluminum monostearate and gelatin.

Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. Such media and agents for pharmaceutically active substances are known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the pharmaceutical compositions of the invention is contemplated. The pharmaceutical composition or formulation may or may not include a preservative. Supplementary active compounds may be incorporated into the compositions.

Pharmaceutical compositions or formulations must generally be sterile and stable under the conditions of manufacture and storage. The compositions may be formulated as solutions, microemulsions, liposomes, or other ordered structures suitable for high antibody concentrations. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, the composition can include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or the composition, or sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by the addition to the compositions of agents delaying absorption, for example, monostearate salts and gelatin.

If desired, sterile injectable solutions can be prepared by incorporating one or more of the ingredients described above in the required amount of active compound in an appropriate solvent and then subjecting to sterile microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients enumerated herein. In the case of sterile powders for the preparation of sterile injectable solutions, some of the methods of preparation are vacuum drying and freeze-drying (lyophilization) that yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

The amount of active ingredient that may be combined with the carrier material in the pharmaceutical compositions or formulations disclosed herein may vary. In some embodiments, the amount of active ingredient that can be combined with the carrier material is that amount that produces a therapeutic effect. Typically, the amount of active ingredient in combination with a pharmaceutically acceptable carrier ranges from about 0.01% to about 99%, from about 0.1% to about 70%, or from about 1% to about 30%, by percent.

The pharmaceutical compositions disclosed herein can be prepared with carriers that protect the active ingredient from rapid release, such as controlled release formulations, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid may be used. Many methods for preparing such formulations have been patented or are generally known to those skilled in the art. See, for example,Sustained and Controlled Release Drug Delivery Systems,J.R.Robinson,ed.,Marcel Dekker,Inc.,New York,1978。

in some embodiments, an anti-BCMA antibody or antigen binding fragment, or immune effector cell (e.g., T cell) as described herein can be formulated to ensure proper distribution in vivo. For example, the Blood Brain Barrier (BBB) excludes many highly hydrophilic compounds. To ensure that the activating components of the invention cross the BBB (if desired, e.g., for brain cancer), they can be formulated, for example, in liposomes. For methods of making liposomes, see U.S. Pat. nos. 4,522,811;5,374,548; and 5,399,331. Liposomes can include one or more groups that selectively transport to a particular cell or organ, thereby enhancing targeted drug delivery (see, e.g., v.v. ranade (1989) j.clin.pharmacol.29: 685). Ranade (1989) j. Clin. Pharmacol.29: 685.) examples of targeting groups include folic acid or biotin (see, e.g., U.S. Pat. No. 5,416,016to Low et al), mannosides (Umezawa et al, (1988) biochem. Biophysis. Res. Commu.153: 1038), antibodies (p.g. bloeman et al (1995) FEBS lett.357:140; m.owas et al, (1995) Antinic. Agents Chemother.39: 180), surfactant protein A receptor (Briscoe et al, (1995) am.J.physiol.1233: 134), pl20 (Schreier et al, (1994) J.biol.chem.269: 9090), also see K.Keinanen; M.L. Laukkanen (1994) FEBS Lett.346:123; killion; i.j. fidler (1994) immunoassays 4.

5.7 methods and uses

The invention also provides the following components disclosed by the invention: an anti-BCMA antibody or antigen binding fragment; a BCMA CAR; a BCMA TCR; polynucleotides encoding such anti-BCMA antibodies or antigen-binding fragments, and BCMA CARs/TCRs; vectors comprising such polynucleotides; a cell expressing the BCMA CAR/TCR; and methods of using pharmaceutical compositions having such cells in the treatment of cancer. Without being bound by theory, the anti-BCMA antibodies or antigen binding fragments disclosed herein, and BCMA CAR/TCR-expressing cells, are capable of specifically targeting BCMA-expressing cancer cells in vivo, thereby achieving therapeutic effects in which they eliminate, lyse, and/or kill cancer cells. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of an anti-BCMA antibody or antigen binding fragment disclosed herein. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a disclosed BCMA CAR-expressing immune effector cell. In one embodiment, the method can comprise administering to a subject in need thereof a therapeutically effective amount of a BCMA CART disclosed herein.

In some embodiments, the invention provides a method of treating a tumor or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an anti-BCMA antibody or antigen binding fragment disclosed herein. In some embodiments, the invention provides the use of an anti-BCMA antibody or antigen binding fragment disclosed herein in the treatment of a tumor or cancer. In some embodiments, the invention provides the use of an anti-BCMA antibody or antigen binding fragment disclosed herein for the manufacture of a medicament for the treatment of a tumor or cancer.

In some embodiments, the invention provides a method of treating a tumor or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an immune effector cell disclosed herein (e.g., BCMA CART). In some embodiments, the invention provides the use of the immune effector cells disclosed herein in the treatment of a tumor or cancer. In some embodiments, the invention provides use of an immune effector cell provided herein in the manufacture of a medicament for the treatment of a tumor or cancer. In some embodiments, the disclosed cell populations comprising immune effector cells are used in therapy. The cell population may be homologous. The cell population may be heterologous.

In some embodiments, the present invention provides a method of treating a tumor or cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition disclosed herein. In some embodiments, the invention provides the use of the disclosed pharmaceutical compositions in the treatment of a tumor or cancer. In some embodiments, the present invention provides the use of a pharmaceutical composition provided herein for the preparation of a medicament for the treatment of a tumor or cancer.

The actual dosage level of the active ingredient in the pharmaceutical compositions of the invention (i.e., the anti-BCMA antibodies or antigen-binding fragments, or immune effector cells, provided by the invention) can be varied to obtain amounts, compositions, and modes of administration of the active ingredient effective to achieve the desired therapeutic response for a particular patient without toxicity to the patient. The selected dosage level will depend upon a variety of pharmacokinetic factors including the activity of the particular composition of the invention, the route of administration, the time of administration, the rate of excretion, the duration of the treatment, other drugs, compounds and/or materials used in conjunction with the particular composition being used, the age, sex, body weight, condition, general health and past medical history of the patient being treated, and like factors well known in the medical arts.

The anti-BCMA antibody or antigen-binding fragment can be administered as a sustained release formulation, in which case frequent administration is not required. The dose and frequency will vary depending on the half-life of the anti-BCMA antibody or antigen binding fragment thereof in the patient. In therapeutic applications, it is sometimes desirable to administer relatively high doses over a relatively short time interval until progression of the disease is reduced or terminated, and until the patient exhibits partial or complete amelioration of the symptoms of the disease.

In some embodiments, the immune effector cells provided herein that are capable of recombinantly expressing the disclosed BCMA CARs or TCRs are useful in the present inventionMethods of treatment are disclosed. When cell therapy is employed, the cells provided by the invention can be administered at a dose per kilogram of cells (cells/kg) based on the body weight of the subject to which the cells are administered. The cell dose may range from about 10 ⁴ To 10 ¹⁰ Individual cells/kg body weight, e.g., about 10 ⁵ To about 10 ⁹ About 10 ⁵ To about 10 ⁸ About 10 ⁵ To about 10 ⁷ Or about 10 ⁵ To about 10 ⁶ Individual cells per kg body weight, depending on the mode and location of administration. Generally, in the case of systemic administration, higher doses are used than for regional administration (administration of the immune effector cells in the tumor region). As noted above, the precise determination of what is an effective dose can be based on individual factors per subject, including their size, age, sex, weight and condition of the particular subject. Dosages can be readily determined by those skilled in the art based on the present disclosure and the present knowledge in the art.

The anti-BCMA antibodies or antigen-binding fragments thereof, immune effector cells, and pharmaceutical compositions provided herein can be administered to a subject by any method known in the art, including, but not limited to, intrathoracic, intravenous, subcutaneous, intranodal administration, intratumoral administration, intramuscular, intradermal, intrathecal, intrapleural, intraperitoneal, intracranial, spinal, or other parenteral route of administration, e.g., by injection or infusion, or thymic direct administration. The phrase "parenteral administration" as used herein refers to modes of administration other than enteral and topical administration, typically by injection, including but not limited to intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intraperitoneal injection and infusion. In some embodiments, subcutaneous administration is employed. In some embodiments, intravenous administration is employed. In some embodiments, oral administration is employed. In one embodiment, the cells provided herein can be delivered locally to a tumor using well known methods, including but not limited to hepatic or aortic pumps; perfusion of limbs, lungs or liver; in the portal vein; by venous shunting; in the lumen or blood vessels near the tumor, etc. In another embodiment, the cells provided herein can be administered systemically. In a preferred embodiment, the cells are administered locally at the tumor site. The cells may also be administered intratumorally, for example, by direct injection of the cells at the tumor site and/or into the tumor vasculature. For example, in the case of malignant pleural disease, mesothelioma or lung cancer, intrapleural administration is preferred (see, adusumili et al, science relative Medicine 6 (261): 261ra151 (2014)). One skilled in the art can select an appropriate mode of administration based on the type and/or location of the tumor to be treated. The cells may be introduced by injection or catheter. In one embodiment, the subject in need thereof is administered intrapleurally, e.g., using an intrapleural catheter. Optionally, the subject can be administered an expansion and/or differentiation agent prior to, during, or after administration of the cells, optionally to increase in vivo cell production provided by the invention.

The proliferation of cells provided by the present invention is typically performed in vitro, and it is also desirable to perform in vivo following administration to a subject (see Kaiser et al, cancer Gene Therapy 22 (2015)). The proliferation of cells should be accompanied by survival of cells to allow expansion and persistence of cells (e.g., T cells).

Diseases that can be treated using the anti-BCMA antibodies or antigen binding fragments, immune effector cells, or pharmaceutical compositions provided herein include any disease or disorder associated with BCMA, as well as any disease or disorder in which BCMA is specifically expressed and/or BCMA is targeted for treatment (collectively referred to as "BCMA-associated disease or disorder"). Cancers associated with BCMA expression include hematological malignancies, such as multiple myeloma, fahrenheit macroglobulinemia, as well as hodgkin lymphoma and non-hodgkin lymphoma. See review for BCMA, cowery et al, crit Rev immunol, 2012,32 (4): 287-305.

In some embodiments, the BCMA-associated disease or disorder is a B cell-associated disorder. In some embodiments, the BCMA-associated disease or disorder is glioblastoma, lymphomatoid granuloma, post-transplant lymphoproliferative disorder, immunomodulatory disease, heavy chain disease (heavy-chain disease), primary or immune cell-associated amyloidosis, or monoclonal gammopathy of undetermined significance.

In certain diseases and disorders, BCMA is expressed on malignant cells and cancers. In some embodiments, the cancer is a solid tumor. In some embodiments, the cancer is a hematologic cancer. In some embodiments, the cancer is a B cell malignancy. In some embodiments, the cancer is a lymphoma, leukemia, or plasma cell malignancy. Lymphomas described herein include, but are not limited to, burkitt's lymphoma (e.g., endemic or sporadic burkitt's lymphoma), non-hodgkin's lymphoma (NHL), hodgkin's lymphoma, fahrenheit macroglobulinemia, follicular lymphoma, small non-dividing cell lymphoma, mucosa-associated lymphoid tissue lymphoma (MALT), marginal zone lymphoma, spleen lymphoma, lymph node monocytic B-cell lymphoma, immunoblastic lymphoma, large cell lymphoma, diffuse mixed cell lymphoma (diffuse mixed cell lymphoma), pulmonary B-cell angiocentric lymphoma (pulmonary B cell and gibacteric lymphoma), small lymphocytic lymphoma, primary mediastinal B-cell lymphoma, lymphoplasmacytic lymphoma (lpmcl), or mantle cell lymphoma (l). The leukemia of the present invention includes, but is not limited to, chronic Lymphocytic Leukemia (CLL), plasma cell leukemia or Acute Lymphocytic Leukemia (ALL).

Plasma cell malignancies described herein include, but are not limited to, multiple Myeloma (MM) and plasmacytoma.

In some embodiments, the anti-BCMA antibodies or antigen binding fragments, immune effector cells, or pharmaceutical compositions provided by the present invention may be used to treat MM. In some embodiments, MM to be treated is non-secretory MM. In some embodiments, the MM is a smoking-type (smoking) MM. In some embodiments, the disease or disorder is relapsed and/or refractory multiple myeloma (R/R MM).

Among these diseases, BCMA-associated disorders or conditions (e.g., BCMA-expressing cancers) that can be treated include, but are not limited to, neuroblastoma, renal cell carcinoma, colon carcinoma, colorectal carcinoma, breast carcinoma, epithelial squamous cell carcinoma, melanoma, myeloma (e.g., multiple myeloma), gastric carcinoma, brain carcinoma, lung carcinoma, pancreatic carcinoma, cervical carcinoma, ovarian carcinoma, liver carcinoma, bladder carcinoma, prostate carcinoma, testicular carcinoma, thyroid carcinoma, uterine carcinoma, adrenal carcinoma, and head and neck carcinoma.

In some embodiments, the method comprises: identifying a subject having, suspected of having, or at risk of having a BCMA-associated disease or disorder. Accordingly, the present invention provides a method for identifying a subject having a disease or disorder associated with increased BCMA expression and selecting it for treatment with an anti-BCMA antibody or antigen binding fragment, immune effector cell, or pharmaceutical composition provided by the invention.

In some embodiments, a subject can be screened for the presence of a disease or disorder associated with increased BCMA expression, e.g., a BCMA-expressing cancer. In some embodiments, the method comprises: screening or detecting the presence of a BCMA-associated disease (e.g. tumour). Thus, in some embodiments, a sample can be obtained from a patient suspected of having a disease or disorder associated with elevated BCMA expression, and the expression level of BCMA can be analyzed. In some embodiments, a subject that detects a BCMA-associated disease or disorder can be selected for treatment by the methods of the invention and a therapeutically effective amount of an anti-BCMA antibody or antigen binding fragment, immune effector cell, or pharmaceutical composition provided by the invention can be administered.

In cancer treatment, the cancer or tumor cells of a subject can be eliminated, but any clinical improvement would be beneficial. The anti-tumor effect can be manifested by a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with the cancer condition. The anti-tumor effect may also be manifested by the ability of the cells or pharmaceutical compositions provided by the invention to prevent tumorigenesis in the first instance. In some embodiments, an "anti-tumor effect" may be manifested by a reduction in cancer-induced immunosuppression. Clinical improvement includes a reduction in the risk or rate of progression or a reduction in the pathological consequences of the cancer or tumor. It is also understood that the method of treating cancer may include any effect that ameliorates a sign or symptom associated with the cancer. Such signs or symptoms include, but are not limited to, reducing tumor burden, including inhibiting tumor growth, slowing tumor growth rate, reducing tumor size, reducing tumor number, eliminating tumors, all of which can be measured using conventional tumor imaging techniques well known in the art. Other signs or symptoms associated with cancer include, but are not limited to, fatigue, pain, weight loss, and other signs or symptoms associated with various cancers.

In some embodiments, the methods or uses provided herein can reduce tumor burden. Thus, administration of the anti-BCMA antibodies or antigen binding fragments, cells or pharmaceutical compositions disclosed herein can reduce the number of tumor cells, reduce tumor size, and/or eradicate the tumor in the subject. Methods for monitoring a patient's response to administration of the disclosed pharmaceutical compositions are known in the art and can be used in accordance with the disclosed methods. In some embodiments, methods known in the art can be used to monitor a patient's response to administration of the disclosed treatment methods.

In the disclosed methods, a therapeutically effective amount of an anti-BCMA antibody or antigen binding fragment thereof, cell, or pharmaceutical composition disclosed herein is administered to a subject in need of cancer treatment. The subject may be a mammal. In some embodiments, the subject is a human. In some embodiments, the individuals do not have clinically measurable tumors. However, they are suspected of being at risk for disease progression, either near the original tumor site or by metastasis. This group can be further subdivided into high risk and low risk individuals. The subdivision is based on features observed before or after the initial processing. These features are known in the clinic and are defined appropriately for different types of cancer. The high risk subgroup is typically characterized by tumor invasion of adjacent tissues, or evidence of lymph node metastasis.

In some embodiments, the subject has sustained or recurrent disease following use of another BCMA-specific antibody and/or BCMA-CART and/or other therapy, including chemotherapy, radiation therapy, and/or Hematopoietic Stem Cell Transplantation (HSCT), e.g., allogeneic HSCT or autologous HSCT. In some embodiments, administration of BCMA is effective to treat a subject despite the subject's resistance to another BCMA-targeted therapy. In some embodiments, the subject is not at risk for relapse, but is determined to be at risk for relapse, e.g., at high risk for relapse, and the compound or composition is therefore administered prophylactically, e.g., to reduce the likelihood of relapse or prevent relapse.

In some embodiments, the subject is a subject eligible for transplantation, e.g., eligible for Hematopoietic Stem Cell Transplantation (HSCT), e.g., allogeneic HSCT or autologous HSCT. In some embodiments, the subject has not previously received a transplant prior to administration of a BCMA binding molecule (including an anti-BCMA antibody or antigen binding fragment, immune effector cell, or pharmaceutical composition provided by the invention), although eligible. In some embodiments, the subject is a subject who is not eligible for transplantation, e.g., is not eligible for Hematopoietic Stem Cell Transplantation (HSCT), e.g., allogeneic HSCT or autologous HSCT.

In some embodiments, the methods provided herein include adoptive cell therapy by administering to a subject a genetically engineered immune effector cell expressing a provided recombinant receptor, wherein the recombinant receptor contains a BCMA-binding molecule (e.g., a BCMA CAR provided herein). Such administration may facilitate activation of cells (e.g., T cell activation) in a manner that targets BCMA, thereby allowing targeted destruction of cells of the disease or disorder. Thus, the methods and uses provided include methods and uses of adoptive cell therapy. In some embodiments, the method comprises administering the cell or a composition comprising the cell to a subject, e.g., a subject having, at risk of having, or suspected of having the disease, disorder or condition. In some embodiments, the cells, cell populations, and compositions are administered to a subject having a particular disease or disorder to be treated by adoptive cell therapy (e.g., adoptive T cell therapy). In some embodiments, the cell or composition is administered to the subject, e.g., a subject having or at risk of likely to have the disease or disorder. In some aspects, the methods thus treat, e.g., ameliorate, one or more symptoms of the disease or disorder, e.g., by reducing tumor burden in a BCMA-expressing cancer.

Methods of cell administration for adoptive cell therapy are known in the art and can be used in conjunction with the provided methods and compositions. For example, adoptive T cell therapies have been described, for example, in U.S. patent application nos. 2003/0170238 to Gruenberg et al; U.S. Pat. Nos. 4,690,915 to Rosenberg; rosenberg (2011) Nat Rev Clin Oncol.8 (10): 577-85). See, e.g., themeli et al, (2013) Nat Biotechnol.31 (10): 928-933; tsukahara et al (2013) Biochem Biophys Res Commun 438 (1): 84-9; davila et al, (2013) PLoS ONE 8 (4): e61338.

In some embodiments, the cell therapy, e.g., adoptive cell therapy (e.g., adoptive T cell therapy), is performed by autologous transplantation, wherein the cells are isolated and/or prepared from the subject to be treated with the cells, or from a sample derived from such subject. Thus, in some embodiments, the cells are derived from a subject (e.g., a patient) in need of treatment, and the cells are administered to the same subject after isolation and treatment.

In some embodiments, the cell therapy, e.g., adoptive cell therapy (e.g., adoptive T cell therapy), is performed by xenotransplantation, wherein the cells are isolated and/or prepared from another subject that is other than the subject (e.g., first subject) that will receive or ultimately receive the cell therapy. In these embodiments, the cells are then administered to a different individual of the same species, e.g., a second subject. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

The anti-BCMA antibodies or antigen binding fragments, cells or pharmaceutical compositions provided by the present invention can be administered in conjunction with medical devices known in the art. For example, in some embodiments, needleless hypodermic injection devices can be used, such as those described in U.S. patent nos.5,399,163;5,383,851;5,312,335;5,064,413;4,941,880;4,790,824; or the device disclosed in 4,596,556. Examples of the use of well known implants and modules described in this invention include: U.S. patent No.4,487,603, which discloses an implantable micro-infusion pump for dispensing a medicament at a controlled rate; U.S. patent No.4,486,194, which discloses a therapeutic device for transdermal drug delivery; U.S. patent No.4,447,233, which discloses a medication infusion pump for delivering medication at a precise infusion rate; U.S. patent No.4,447,224, which discloses a variable flow implantable infusion device for continuous administration; U.S. patent No.4,439,196, which discloses an osmotic drug delivery system having multiple chambers; and U.S. patent No.4,475,196, which discloses an osmotic drug delivery system. These patents are incorporated by reference herein. Many other such implants, delivery systems, and modules are known to those skilled in the art.

Combination therapy with agents of different mechanisms of action may produce additive or synergistic effects. Combination therapy may allow for lower doses of each agent than are used in monotherapy, thereby reducing toxic side effects and/or increasing the therapeutic index of the agents disclosed herein. Combination therapy can reduce the likelihood of drug-resistant cancer cell development. In some embodiments, the additional treatment results in an increase in the therapeutic index of the cells or pharmaceutical composition of the invention. In some embodiments, the additional treatment results in a reduction in toxicity and/or side effects of the cells or pharmaceutical compositions described herein. In some embodiments, the anti-BCMA antibodies or antigen binding fragments thereof, cells, or pharmaceutical compositions described herein can be administered in combination with additional therapy. In some embodiments, the additional treatment may be surgical resection, radiation therapy, or chemotherapy.

The additional therapy may be administered prior to, concurrently with, or subsequent to the administration of the anti-BCMA antibody or antigen binding fragment, cell or pharmaceutical composition thereof according to the invention. Combination administration may include co-administration, either in a single pharmaceutical formulation or using separate formulations, or sequential administration in either order, but typically over a period of time such that all of the active agents can exert their biological activities simultaneously. One skilled in the art can readily determine the appropriate regimen for administration of the pharmaceutical compositions of the present invention and combination adjunctive therapy, including the timing and dosage of the additional agents used in the combination therapy, based on the needs of the subject being treated.

5.8 preparation method

5.8.1 polynucleotides, polypeptides and antibodies

Polynucleotides provided by the invention can be prepared, manipulated and/or expressed using any of the well-established techniques known and available in the art. Many vectors can be used. Examples of vectors are plasmids, autonomously replicating sequences and transposable elements. Typical transposon systems, such as Sleeping Beauty (Sleeping Beauty) and PiggyBac, which can be stably integrated into the genome can be used (e.g., ivics et al, cell,91 (4): 501-510 (1997);

et al.,(2007)Nucleic Acids Research.35(12):e87)。501–510(1997)；

other exemplary vectors include, but are not limited to, plasmids, phages, cosmids, artificial chromosomes (such as Yeast Artificial Chromosomes (YAC), bacterial Artificial Chromosomes (BAC) or P1-derived artificial chromosomes (PAC)), phages (such as lambda phages or M13 phages), and animal viruses. Examples of animal virus species that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), pox viruses, baculoviruses, papilloma viruses, and papovaviruses (e.g., SV 40). Examples of expression vectors are those useful in mammalian cells The pClneo vector (Promega) expressed in cells; plenti4/V5-Dest for lentivirus-mediated gene transduction and expression in mammalian cells ^TM 、Plenti6/V5-Dest ^TM And Plenti6.2/V5-GW/Lacz (Invitrogen).

In some embodiments, the vector is an episomal vector or an extrachromosomal vector. As used herein, the term "episomal" refers to a vector that is capable of replicating without integrating into the chromosomal DNA of a host and without being gradually lost from dividing host cells, and also means that the vector replicates extrachromosomally or in an episomal form. The vector is engineered to contain a sequence encoding a DNA origin of replication or "ori" from a lymphotrophic or gammaherpes virus, adenovirus, SV40, bovine papilloma virus or yeast, in particular an origin of replication of a lymphotrophic or gammaherpes virus corresponding to oriP of EBV. In some embodiments, the lymphoherpesvirus may be Epstein Barr Virus (EBV), kaposi's Sarcoma Herpesvirus (KSHV), herpesvirus Saimiri (HS), or Marek's Disease Virus (MDV). Epstein Barr Virus (EBV) and Kaposi's Sarcoma Herpesvirus (KSHV) are also examples of gamma herpesviruses. Typically, the host cell includes a viral replication transactivator that activates replication.

"expression control sequences", "control elements" or "regulatory sequences" present in an expression vector refer to the untranslated regions of the vector (e.g., origins of replication, selection agents, promoters, enhancers, translational initiation signals (Shine Dalgarno sequence or Kozak sequence), polyadenylation sequences, 5 'and 3' untranslated regions) that interact with host cell proteins for transcription and translation. The strength and specificity of these elements vary. Any number of suitable transcription and translation elements may be used, including ubiquitous promoters and inducible promoters, depending on the vector system and host used.

Illustrative universal expression control sequences useful in the present invention include, but are not limited to, the Cytomegalovirus (CMV) immediate early promoter, the viral monkey virus (SV 40) promoter (e.g., early or late), the moloney murine leukemia virus (MoMLV) LTR promoter, the Rous Sarcoma Virus (RSV) LTR, the Herpes Simplex Virus (HSV) (thymidine kinase) promoter, the H5, P7.5 and P11 promoters from vaccinia virus, the elongation factor 1-alpha (EF 1 a) promoter, the early growth response factor 1 (EGR 1), ferritin H (FerH), ferritin L (FerL), 3-phosphoglycerol aldehyde dehydrogenase (GAPDH), eukaryotic translation initiation factor 4A1 (EIF 4 A1), heat shock 70kDa protein 5 (HSPA 5), heat shock protein 90 β -member 1 (90B 1), heat shock protein 70kDa (HSPA 5), β -kinesin (β -KINs), the human ROSA 26 gene site (irs, nature technology, heat shock protein 90 β -1477B 1), heat shock protein 70kDa (HSP 1), heat shock protein C-kinase (P-kinase) promoter, P-kinase (HSP 1), the P-kinase C promoter, P-kinase (PGK), the P-kinase promoter.

Illustrative examples of inducible promoters/systems include, but are not limited to, steroid-inducible promoters (e.g., promoters of genes encoding glucocorticoid or estrogen receptor (induced by treatment with the corresponding hormone)), metallothionein promoters (induced by treatment with various heavy metals), MX-1 promoters (induced by interferon), "Gene switch" mifepristone-regulatory system (Sirin et al, 2003, gene,323 67), cumate-inducible gene switch (WO 2002/088346), tetracycline-dependent regulatory system, and the like. The anti-BCMA antibodies or antigen-binding fragments thereof described herein can be prepared by any method known in the art, including chemical synthesis and recombinant expression techniques. The practice of the present invention employs, unless otherwise indicated, molecular biology, microbiology, genetic analysis, recombinant DNA, organic chemistry, biochemistry, PCR, oligonucleotide synthesis and modification, nucleic acid hybridization, and related conventional techniques within the art. These techniques are described in the references cited herein and are fully explained in the literature. See, e.g., maniatis et al (1982) Molecular CLONING, A LABORATORY MANUAL, cold Spring Harbor LABORATORY Press; sambrook et al, (1989), molecular CLONING, A Laboratory Manual, second Edition, cold Spring Harbor LABORATORY Press; sambrook et al (2001) Molecular CLONING A Laborary Manual, cold Spring Harbor LABORATORY Press, cold Spring Harbor, NY; ausubel et al, current PROTOCOLS IN MOLECULAR BIOLOGY, john Wiley & Sons (1987 and annual updates); CURRENT PROTOCOLS IN IMMUNOLOGY, john Wiley & Sons (1987 and annual updates) Gait (ed.) (1984) OLIGONUCLEOTIDE SYNTHESIS A PRACTICAL APPROACH, IRL Press; eckstein (ed.) (1991) OLIGONUCLEOTIDES AND ANALOGUES A PRACTICAL APPROACH, IRL Press; birren et al, (eds.) (1999) GENOME ANALYSIS: A LABORATORY MANUAL, cold Spring Harbor LABORATORY Press; borebaeck (ed.) (1995) ANTIBODY Engine, second Edition, oxford University Press; lo (ed.) (2006) ANTIBODY entering: METHODS AND PROTOCOLS (METHODS IN MOLECULAR BIOLOGY); vol.248, humana Press, inc; each of which is incorporated by reference herein in its entirety.

The polypeptides of the invention (e.g., the anti-BCMA antibodies or antigen-binding fragments) can be produced and isolated using methods well known in the art. PEPTIDES can be synthesized in whole or in part using chemical methods (see, e.g., caruthers (1980), nucleic Acids Res. Symp. Ser.215; horns (1980); AND Banga, A.K., THERAPEUTIC PEPTIDES AND PROTEINS, FORMULATION, PROCESSING AND DELIVERY SYSTEMS (1995) technical Publishing Co., lancaster, PA). Peptide synthesis can be performed using various solid phase techniques (see, e.g., roberge Science 269 (1995); merrifield, methods. Enzymol.289:3 (1997)) and automated synthesis can be achieved, e.g., using an ABI 431A peptide synthesizer (Perkin Elmer) according to the manufacturer's instructions. Peptides may also be synthesized using combinatorial approaches. Synthetic residues and polypeptides can be synthesized using various procedures and methods known in the art (see, e.g., ORGANIC synthies COLLECTIVE VOLUMES, gilman, et al (Eds) John Wiley & Sons, inc., NY). Modified polypeptides can be produced by chemical modification methods (see, e.g., belouov, nucleic Acids Res.25:3440 (1997); frenkel, free Radic.biol.Med.19:373 (1995); and Blommers, biochemistry 33 (1994)). Peptide sequence variations, derivatives, substitutions and modifications can also be made using methods such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning and PCR-based mutagenesis. Site-directed mutagenesis (Carter et al, nucleic acids res, 13.

The polypeptides of the invention can be prepared using a variety of techniques known in the art, including the use of hybridoma and recombinant techniques, or a combination thereof. In some embodiments, the recombinant expression vector is used to express a polynucleotide encoding a polypeptide of the invention. For example, a recombinant expression vector can be a replicable DNA construct comprising a synthetic or cDNA-derived DNA segment encoding a polypeptide operably linked to suitable transcriptional and/or translational regulatory elements derived from a mammalian, microbial, viral, or insect gene. In some embodiments, the coding sequence for a polypeptide disclosed herein can be ligated into such an expression vector for expression in a mammalian cell. In some embodiments, a viral vector is used. When DNA regions are functionally related, they are "operably linked". For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; or is operably linked to a coding sequence if the position of the ribosome binding site allows translation. In some embodiments, the structural element intended for use in a yeast expression system comprises a leader sequence that may enable the host cell to secrete the translated protein extracellularly. In some embodiments, the polypeptide may include an N-terminal methionine residue in the absence of a leader or transport sequence for expression of the recombinant protein.

Various combinations of expression hosts/vectors may be used. Suitable host cells for expression include prokaryotes, yeast cells, insect cells or higher eukaryotic cells under the control of an appropriate promoter. Suitable cloning and expression vectors for bacterial, fungal, yeast and mammalian cell hosts, as well as methods of protein production, including antibody production, are well known in the art. Expression vectors useful for bacterial hosts include known bacterial plasmids, such as those from E.coli, including pCR1, pBR322, pMB9, and derivatives thereof, as well as a broader host range of plasmids, such as M13 and other filamentous single stranded DNA phages.

Expression vectors useful for eukaryotic hosts include, for example, vectors containing expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Examples of suitable mammalian host cell lines include, but are not limited to, COS-7 (derived from monkey kidney), L-929 (derived from murine fibroblast), C127 (derived from murine breast tumor), 3T3 (derived from murine fibroblast), CHO (derived from Chinese hamster ovary), heLa (derived from human cervical cancer), BHK (derived from hamster kidney fibroblast), HEK-293 (derived from human embryonic kidney) cell lines, and variants thereof. Mammalian expression vectors can include non-transcribed elements (e.g., origins of replication), suitable promoters and enhancers for linkage to the gene to be expressed, and other 5 'or 3' flanking non-transcribed and 5 'or 3' non-translated sequences (e.g., necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and transcriptional termination sequences). Expression of recombinant proteins in insect cell culture systems (e.g., baculovirus) also provides a powerful method for producing properly folded and biologically functional proteins. Baculovirus systems for the production of heterologous proteins in insect cells are well known to those skilled in the art.

The antibodies and antigen binding fragments thereof provided by the present invention include, but are not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, and antigen binding fragments thereof.

Methods for the preparation of antibodies are well known in the art. See, e.g., harlow et al, ANTIBODIES: A Laboratory Manual, (Cold Spring Harbor LABORATORY Press,2nd ed.1988); hammerling et al, in: MONOCLONAL ANTIBODIES AND T-CELL HYBRIDOMAS 563 681 (Elsevier, N.Y., 1981), each of which is incorporated herein by reference in its entirety. For antibodies used in vivo in humans, it may be preferable to use human antibodies. Fully human antibodies are particularly desirable for therapeutic treatment of human subjects. Human antibodies can be made by a variety of methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences, including improvements to these techniques. See, also, U.S. Pat. Nos. 4,444,887and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated by reference herein in its entirety. A human antibody can also be an antibody in which the heavy and light chains are encoded by nucleotide sequences derived from one or more human DNA sources.

Human antibodies can also be produced using transgenic mice that do not express functional endogenous immunoglobulins, but express human immunoglobulin genes. For example, human heavy and light chain immunoglobulin gene complexes can be introduced into mouse embryonic stem cells at random or by homologous recombination. In addition, human variable, constant and diversity regions can be introduced into mouse embryonic stem cells in addition to human heavy and light chain genes. Mouse heavy and light chain immunoglobulin genes can be introduced into human immunoglobulin gene loci separately or simultaneously by homologous recombination, rendering them non-functional. For example, it is described that homozygous deletion of the antibody heavy chain joining region (JH) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. The modified embryonic stem cells were expanded and microinjected into blastocysts to generate chimeric mice. Chimeric mice are then bred to produce homozygous progeny expressing human antibodies. Transgenic mice are immunized in a normal manner with a selected antigen (e.g., a polypeptide of the invention, in whole or in part). For example, anti-BCMA antibodies against human BCMA antigen can be obtained from immunized transgenic mice using conventional hybridoma techniques. The transgenic mice harbor human immunoglobulin transgenes that undergo rearrangement during B cell differentiation, followed by class switching and somatic mutation. Thus, using such techniques, therapeutically useful IgG, igA, igM, and IgE antibodies, including but not limited to IgG1 (γ 1) and IgG3, can be produced. For a summary of this technology for the production of human antibodies, see Lonberg and huskzar (int. Rev. Immunol., 13. For a detailed discussion of techniques for producing human antibodies and human monoclonal antibodies, and protocols for producing such antibodies, see, e.g., PCT publication Nos. WO 98/24893, WO 96/34096, and WO 96/33735; and U.S. Pat. nos.5,413,923;5,625,126;5,633,425;5,569,825;5,661,016;5,545,806;5,814,318; and 5,939,598, each of which is incorporated by reference herein in its entirety. In addition, abgenix, inc. (Freemont, calif.) and Genpharm (Jose, calif.) can provide human antibodies to selected antigens using methods similar to those described above. For a detailed discussion of transduction of human germline immunoglobulin gene arrays in germline mutant mice see, e.g., jakobovits et al, proc.natl.acad.sci.usa, 90; jakobovits et al, nature, 362; bruggermann et al, year in immunol, 7 (1993); and Duchosal et al, nature, 355.

Human antibodies can also be obtained from phage display libraries (Hoogenboom et al, J.mol.biol.,227 (1991); marks et al, J.mol.biol., 222. Phage display technology (McCafferty et al, nature,348, 552-553 (1990)) can be used to produce human antibodies and antibody fragments in vitro from the immunoglobulin variable (V) region gene repertoire of an unimmunized donor. According to this technique, antibody V region genes are cloned into the framework of the major or minor coat protein genes of filamentous phage, such as M13 or fd, and displayed as functional antibody fragments on the surface of the phage particle. Since the filamentous particle contains copies of the single-stranded DNA of the phage genome, selection based on antibody functionality will also result in selection of genes encoding antibodies with these properties. Thus, the phage mimics certain properties of B cells. Phage display can be performed in a variety of formats; for a review of them, see, e.g., johnson and Chiswell, current Opinion in Structural Biology 3. Several sources of V gene fragments can be used for phage display. A panel of different anti-oxazolone antibodies was isolated from a small random combinatorial library of V genes derived from the spleen of naive mice (1991) Clackson et al, nature, 352. V gene banks can be constructed from non-immunized human donors and antibodies to a variety of antigens, including self-antigens, can be isolated by methods described in Marks et al, j.mol.biol., 222-597 (1991), or Griffith et al, EMBO j., 12. Reference may also be made to U.S. patent nos.5,565,332 and 5,573,905, each of which is incorporated by reference herein in its entirety.

Human antibodies can also be produced by B cells activated in vitro (see, U.S. patent nos.5,567,610 and 5,229,275, each of which is incorporated by reference herein in its entirety). Human antibodies can also be produced in vitro using hybridoma techniques, such as, but not limited to, the techniques described by Roder et al methods enzymol, 121 (1986)).

Alternatively, in some embodiments, non-human antibodies are humanized, wherein specific sequences or regions of the antibody are modified to increase similarity to antibodies naturally occurring in humans. In some embodiments, the antigen binding domain portion is humanized.

<xnotran> , CDR- (, , european Patent No.EP 239,400; No.WO 91/09967; U.S.Pat.Nos.5,225,539,5,530,101,and 5,585,089, ), (veneering) (resurfacing) (, , european Patent Nos.EP 592,106and EP 519,596;Padlan,1991,Molecular Immunology,28 (4/5): 489-498;Studnicka et al.,1994,Protein Engineering,7 (6): 805-814;and Roguska et al.,1994,PNAS,91:969-973, ), (, , U.S.Pat.No.5,565,332, ) U.S.Patent Application Publication No.US2005/0042664,U.S.Patent Application Publication No.US2005/0048617,U.S.Pat.No.6,407,213,U.S.Pat.No.5,766,886,International Publication No.WO 9317105,Tan et al., J.Immunol.,169:1119-25 (2002), caldas et al., protein Eng.,13 (5): 353-60 (2000), morea et al., methods,20 (3): 267-79 (2000), baca et al., J.Biol.Chem.,272 (16): 10678-84 (1997), roguska et al., protein Eng.,9 (10): 895-904 (1996), couto et al., cancer Res.,55 (23 Supp): 5973s-5977s (1995), couto et al., cancer Res.,55 (8): 171722 (1995), sandhu J S, gene,150 (2): 409-10 (1994), and Pedersen et al., J.Mol.Biol.,235 (3): 959-73 (1994) , </xnotran> Each of which is incorporated by reference herein in its entirety. Typically, framework residues in the framework regions may be replaced by corresponding residues from a CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by mimicking the interaction of CDRs with framework residues to identify framework residues important for antigen binding and by sequence comparison to identify framework residues that are aberrant at particular positions. ( See, e.g., queen et al, u.s.pat. No.5,585,089; and Riechmann et al, 1988, nature,332, each of which is incorporated by reference herein in its entirety. )

Humanized antibodies have one or more amino acid residues introduced from a source that is not human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable region. Thus, a humanized antibody comprises one or more CDRs from a non-human immunoglobulin molecule and framework regions from a human. Humanization of antibodies is well known in the art and can be performed essentially according to the methods of Winter and co-workers (Jones et al, nature, 321. In such humanized chimeric antibodies, significantly less than the entire human variable domain is replaced by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are replaced by residues from analogous sites in rodent antibodies. Humanization of antibodies can also be achieved by veneering (tunneling) or resurfacing (EP 592,106.

In making humanized antibodies, human variable domains (including light and heavy chains) are selected to reduce antigenicity. According to the so-called "best-fit" method, the sequence of the variable domains of rodent antibodies is screened against the entire library of known human variable region sequences. The human sequence closest to the rodent sequence was then used as the human Framework (FR) of the humanized antibody (Sims et al, J.Immunol.,151 2296 (1993); chothia et al, J.mol.biol.,196 (1987), the contents of which are hereby incorporated by reference in their entirety. Another approach uses a specific framework derived from the consensus sequence of all human antibodies of a specific subgroup of light or heavy chains. The same framework can be used for several different humanized antibodies (Carter et al, proc. Natl. Acad. Sci. USA, 89.

Antibodies can be humanized and retain high affinity for the antigen of interest and other favorable biological properties. For example, humanized antibodies can be prepared by analyzing the parent sequence and various conceptual humanized products using three-dimensional models of the parent sequence and the humanized sequence. Three-dimensional immunoglobulin models are generally available and familiar to those skilled in the art. The computer program may illustrate and display possible three-dimensional conformational structures of the selected candidate immunoglobulin sequences. Examination of these displays allows analysis of the likely role of the residues in the function of the candidate immunoglobulin sequence, i.e., analysis of residues that affect the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the acceptor and import sequences such that the desired antibody characteristics, such as enhanced affinity for the target antigen, are achieved. Generally, CDR residues are directly and most fundamentally involved in the effect on antigen binding.

"humanized antibodies retain antigen specificity similar to the original antibody, e.g., the ability to bind human BCMA antigen. However, using certain humanization methods, "directed evolution" methods can be used to increase the affinity and/or specificity of an antibody for binding to a particular antigen, which are described in Wu et al, j.mol.biol.,294 (1999), the contents of which are hereby incorporated by reference in their entirety.

5.8.2 genetically engineered immune Effector cells

In some embodiments, the invention provides genetically engineered immune effector cells comprising a polynucleotide encoding a BCMA CAR or TCR disclosed herein. In some embodiments, the invention provides genetically engineered immune effector cells capable of recombinantly expressing a BCMA CAR or TCR disclosed herein. In some embodiments, the invention provides genetically engineered immune effector cells comprising a vector comprising a polynucleotide encoding a BCMA CAR or TCR disclosed herein. In some embodiments, the immune effector cell is a T cell.

5.8.2.1 Gene engineering methods

For the production of cells capable of recombinantly expressing the BCMA CARs or TCRs disclosed herein, one or more polynucleotides encoding the BCMA CARs or TCRs are introduced into a target cell using a suitable expression vector. Transferring one or more polynucleotides encoding a BCMA CAR or TCR to a target immune effector cell (e.g., a T cell). The genetically engineered cells may also express the anti-BCMA antibodies or antigen binding fragments disclosed by the invention.

In some embodiments, the invention provides methods for genetically engineering immune effector cells by transferring polynucleotides provided by the invention to immune effector cells using a non-viral delivery system. The polynucleotide encoding the BCMA CAR or TCR may be mRNA, which allows for transient expression and self-elimination of immune effector cells expressing such BCMA CARs or TCRs. Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. In some embodiments, RNA electroporation (Van Driessche et al, folia histochemica et cytobiologica 43. The method may further comprise preparing mRNA by in vitro transcription of the polynucleotide of the invention. In some embodiments, the invention provides methods of genetically engineering immune effector cells into which polynucleotides encoding anti-BCMA antibodies or antigen binding fragments provided by the invention are transferred using electroporation. In some embodiments, the invention provides methods of genetically engineering immune effector cells into which polynucleotides encoding BCMA CARs or TCRs provided by the invention are transferred by using electroporation.

In some embodiments, DNA transfection and transposons may be used. In some embodiments, a Sleeping Beauty system or a PiggyBac system is used (e.g., ivics et al, cell,91 (4): 501-510 (1997);

et al (2007) Nucleic Acids research.35 (12): e 87). Chemical methods for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, microbeads, and lipid systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Exemplary colloidal systems for use as delivery vehicles in vitro and in vivo are liposomes (e.g., artificial membrane vesicles).

For example, a polynucleotide encoding a BCMA CAR or TCR disclosed herein can be cloned into a suitable vector and introduced into a target cell using well-known MOLECULAR BIOLOGY techniques (see Ausubel et al, CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, john Wiley and Sons, baltimore, MD (1999)). Any vector suitable for expression in cells, particularly human cells, may be used. The vector contains suitable expression elements, such as a promoter, which provides for expression of the encoding nucleic acid in the target cell.

The use of retroviral vectors for expression in T cells or other immune effector cells, including engineered T cells, has been described (see Scholler et al, sci.trans.med.4: 132-153 (2012 parete-Pereira et al, j.biol.methods 1 (2): e7 (1-9) (2014); larmers et al, blood 117 (1): 72-82 (2011); reviere et al, proc.natl.acad.sci.usa 92 In embodiments, the vector is an SGF retroviral vector, such as an SGF γ -retroviral vector, which is a Moloney murine leukemia-based retroviral vector. SGF vectors have been described previously (see, e.g., wang et al, gene Therapy 15. In the case of retroviral vectors, cells can be selectively activated to increase transduction efficiency (see ParentePereira et al, J.biol. Methods 1 (2) e7 (doi 10.14440/jbm.2014.30) (2014); movasssagh et al, hum. Gene Ther.11:1189-1200 (2000); rettig et al, mol. Ther.8:29-41 (2003); agarwal et al, J.Virol.72:3720-3728 (1998); pollok et al, hum. Gene Ther.10:2221-2236 (1998); quinn et al, hum. Gene Ther.9:1457-1467 (1998); and also commercially available methods such as Dynabeads ^TM Human T cell activator product, thermo Fisher Scientific, waltham, mass.). It will be appreciated that any suitable viral vector or non-viral delivery system may be used. Combinations of retroviral vectors and appropriate packaging cell lines are also suitable, where the capsid protein will act to infect human cells. Various cell lines producing tropic viruses (amphotropic viruses) are known, including but not limited to PA12 (Miller et al, mol.cell.biol.5:431-437 (1985)); PA317 (Miller et al, mol.cell.biol.6:2895-2902 (1986)); and CRIP (Danos et al, proc.natl.acad.sci.usa 85. Non-facultative particles are also suitable, for example, with VSVG, RD114 or GALV envelopes and any other pseudotype particles known in the art (Relander et al, mol. Therap.11:452-459 (2005)). Possible transduction methods also include co-culturing the cells directly with producer cells (e.g., bregni et al, blood 80.

Other viral vectors that may be used include, for example, adenovirus, lentivirus and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus derived vectors or herpes viruses such as Epstein-Barr virus (see, for example, miller, hum. Gene Ther.1 (1): 5-14 (1990); friedman, science 244. Retroviral vectors are well developed and have been used clinically (Rosenberg et al, N.Engl. J.Med.323:370 (1990); anderson et al, U.S. Pat.No.5,399, 346). In general, the vectors of choice exhibit high infection efficiency as well as stable integration and expression (see, e.g., cayoutte et al, human Gene Therapy 8 (423-430); kido et al, current Eye Research 15.

The vectors used in the present invention are expressed in a particular host cell using a suitable promoter. The promoter may be an inducible promoter or a constitutive promoter. In some embodiments, the promoter of the expression vector provides expression in a stem cell (e.g., hematopoietic stem cell). In some embodiments, the promoter of the expression vector provides expression in immune effector cells (e.g., T cells). Non-viral vectors may also be used, so long as the vector contains expression elements suitable for expression in the target cell. Some vectors, such as retroviral vectors, may integrate into the host genome.

In some embodiments, the invention provides methods for genetically engineering immune effector cells by transferring polynucleotides provided by the invention into immune effector cells using gene editing. If desired, site-directed integration can be achieved using techniques such as nucleases, transcription activator-like effector nucleases (TALENs), zinc Finger Nucleases (ZFNs), regularly clustered spaced short palindromic repeats (CRISPRs), homologous recombination, non-homologous end joining, microhomology-mediated end joining, homology-mediated end joining (Gersbach et al, nucl. Acids Res.39:7868-7878 (2011); vasiceva, et al. Cell Death Dis.6: 183e 20151 (Jul 23); sonthimer, hum. Gene Ther.26 (7): 413-424 (2015); yao. Cell Research 27 et 801-814 (2017)). In some embodiments, the methods provided herein use ZFN systems. Zinc finger nucleases consist of a DNA recognition domain and a non-specific endonuclease. The DNA recognition domain consists of a series of Cys2-His2 zinc finger proteins in tandem, each zinc finger unit comprising about 30 amino acids for specific binding to DNA. The non-specific endonuclease is a FokI endonuclease, which forms dimers to cleave DNA. In some embodiments, the methods provided herein use TALEN systems. TALENs are one type of transcription activator-like effector nucleases. The TALE proteins are core components of the DNA binding domain and are typically composed of multiple basic repeat units in tandem. The series of units designed and combined can specifically recognize DNA sequences and cut specific DNA sequences by coupling with FokI endonuclease.

In some embodiments, the methods provided herein use CRISPR-Cas systems. The CRISPR-Cas system may be a CRISPR-Cas9 system. The CRISPR/Cas system is a nuclease system, consisting of regularly clustered short palindromic repeats (CRISPR) and CRISPR-binding proteins (i.e., cas proteins), which can cleave almost all genomic sequences adjacent to Protospacer Adjacent Motifs (PAMs) in eukaryotic cells (Cong et al. Science 2013.339. The "CRISPR/Cas system" is used to collectively refer to the transcript of a CRISPR-associated ("Cas") gene, as well as to other elements that relate to its expression or direct its activity, including sequences encoding the Cas gene, tracr (trans-activated CRISPR) sequences (e.g., tracrRNA or active portions of tracrRNA), tracr mate sequences (in the context of endogenous CRISPR systems, covering "direct repeats" and processed portions of direct repeats), guide sequences, or other sequences from CRISPR sites and transcripts. In general, CRISPR systems are characterized by elements (also referred to as pre-spacers in endogenous CRISPR systems) that promote the formation of CRISPR complexes at the site of the target sequence. In general, CRISPR systems are characterized by elements (also referred to as pre-spacers in endogenous CRISPR systems) that promote the formation of CRISPR complexes at the site of the target sequence. Non-limiting examples of Cas proteins include Cas1, cas1B, cas2, cas3, cas4, cas5, cas6, cas7, cas8, cas9 (also known as Csn1 and Csx 12), cas10, csy1, csy2, csy3, cse1, cse2, csc1, csc2, csa5, csn2, csm3, csm4, csm5, csm6, cmr1, cmr3, cmr4, cmr5, cmr6, csb1, csb2, csb3, csx17, csx14, csx10, csx16, csaX, csx3, csx1, csx15, csf1, csf2, csf3, csf4 homologs, or modified forms thereof. In some embodiments, the Cas protein is a Cas9 protein (gasitunas, barrangou et al.2012; jinek, chylinki et al.2012; deltcheva, chylinski et al.2011; makarova, grishin et al. (2006)). The amino acid sequence of Cas9 proteins is known in the art. Example sequences can be found, for example, under the SwissProt database, accession number Q99ZW2, under the UniProt database, accession numbers A1IQ68, Q03LF7, or J7RUA5.

Vectors and constructs can optionally be designed to include a reporter. For example, the vector can be designed to express a reporter protein that can be used to identify a cell that contains the vector or a polynucleotide provided on the vector (e.g., a polynucleotide that has integrated into the host chromosome). In one embodiment, the reporter may be expressed with an anti-BCMA antibody or antigen binding fragment, or, a BCMA CAR or TCR as a bicistronic or polycistronic expression construct. Exemplary reporter proteins include, but are not limited to, fluorescent proteins such as mCherry, green Fluorescent Protein (GFP), blue fluorescent proteins (e.g., EBFP2, azurite, and mKalama 1), cyan fluorescent proteins (e.g., ECFP, cerulean, and CyPet), and yellow fluorescent proteins (e.g., YFP, citrine, venus, and YPet).

Transduction efficiency can be determined experimentally using conventional molecular biology techniques. If a marker (e.g., a fluorescent protein) is included in the construct, gene transfer efficiency can be monitored by FACS analysis to quantify the proportion of transduced (e.g., GFP +) immune effector cells (e.g., T cells), and/or by quantitative PCR. Using a mature co-culture system (Gade et al., cancer Res.65:9080-9088 (2005); gong et al., neoplasia 1. The effect of CD80 and/or 4-1BBL on T cell survival, proliferation and efficacy can be assessed. T cells can be exposed to repeated stimulation of cancer antigen-positive target cells and it can be determined whether T cell proliferation and cytokine response remain similar or diminish with repeated stimulation. Cancer antigen CAR constructs can be compared side-by-side under equivalent experimental conditions. Various E's can be performed using the chromium release test: cytotoxicity test of T ratio.

Combinations and permutations of the various methods described herein or otherwise known in the art are expressly contemplated for making the genetically engineered cells disclosed herein.

5.8.2.2 manipulation of immune Effector cells

The immune effector cells provided by the invention can be obtained from a subject. Sources of immune effector cells provided by the present invention include, but are not limited to, hematopoietic cells from peripheral blood, cord blood, bone marrow, or other sources. Immune effector cells (e.g., T cells) can be obtained from a number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue at the site of infection, ascites, pleural effusion, spleen tissue, and tumors. In certain embodiments, cell lines available in the art may be used. The immune effector cells provided herein can be isolated by methods well known in the art, including commercially available isolation methods (see, e.g., rowland Jones et al, LYMPHOCYTES: A PRACTICAL APPROACH, oxford University Press, new York (1999)). Various methods for isolating immune effector cells have been previously described and may be used including, but not limited to, the use of peripheral donor lymphocytes (Sadelain et al, nat. Rev. Cancer 3 (2003); morgan et al, science 314.

In certain embodiments, the immune effector cells (e.g., T cells) disclosed herein can use any technique known to those of skill in the art (e.g., ficoll) ^TM Isolated) is obtained from a blood unit collected from the subject. In some embodiments, the cells from the circulating blood of the individual are obtained by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. In some embodiments, cells collected by apheresis may be washed to remove the plasma fraction and place the cells in an appropriate buffer or medium for subsequent processing steps. In some embodiments, the cells are washed with Phosphate Buffered Saline (PBS). In another embodiment, the wash solution lacks calcium, and may lack magnesium, or may lack many if not all divalent cations. In the absence of calcium, the initial activation step results in amplified activation. As will be readily appreciated by those of ordinary skill in the art, the washing step may be accomplished by methods known to those of skill in the art, such as using a semi-automatic "flow-through" centrifuge (e.g., cobe 2991 cell processor, baxter CytoMate, or autologous blood salvage machine 5) according to the manufacturer's instructions. After washing, the cells can be resuspended in various biocompatible buffers, e.g., ca-free ²⁺ Is free of Mg ²⁺ PBS, bokali a (PlasmaLyte a) or other physiological saline solution with or without buffer. Alternatively, undesired components of the apheresis sample may be removed and the cells resuspended directly in culture.

In another embodiment, by lysing erythrocytes and depleting monocytes (e.g., by Percoll) ^TM Gradient centrifugation or countercurrent centrifugation) to separate T cells from peripheral blood lymphocytes. A specific subset of T-cells, e.g. CD3 ⁺ ,CD28 ⁺ ,CD4 ⁺ ,CD8 ⁺ ，CD45RA ⁺ And CD45RO ⁺ T cells, which may be further isolated by positive or negative selection techniques. For example, in one embodiment, the microbeads are coupled (e.g., by coupling with anti-CD 3/anti-CD 28 (i.e., 3X 28))

M-450CD3/CD 28T) for a sufficient period of time for positive selection of the desired T cells. In one embodiment, the period of time is about 30 minutes. In another embodiment, the period of time ranges from 30 minutes to 36 hours or more, and all integer values included therebetween. In another embodiment, the period of time is at least 1, 2, 3, 4, 5, or 6 hours. In yet another preferred embodiment, the period of time is from 10 to 24 hours. In a preferred embodiment, the incubation period is 24 hours. For T cell isolation in leukemia patients, cell yield can be increased using longer incubation times (e.g., 24 hours). In any case where there are fewer T cells than other cell types, longer incubation times can be used to isolate T cells, such as Tumor Infiltrating Lymphocytes (TILs) from tumor tissue or immunocompromised individuals. Furthermore, the efficiency of capturing CD8+ T cells can be improved using longer incubation times. Thus, by simply shortening or extending the time for T cells to bind to CD3/CD28 microbeads and/or by increasing or decreasing the ratio of microbeads to T cells (as further described herein), subpopulations of T cells can be preferentially selected or eliminated at the beginning of the culture or at other time points in the process. In addition, by increasing or decreasing the proportion of anti-CD 3 and/or anti-CD 28 antibodies on the beads or other surfaces, T cell subsets can be preferentially selected or depleted at the start of the culture or at other desired time points. Those skilled in the art will recognize that multiple rounds of selection may also be used in the context of the present invention.

Various techniques can be employed to isolate cells to enrich for desired immune effector cells. For example, negative selection methods can be used to remove cells that are not the desired immune effector cells. In addition, positive selection methods can be used to isolate or enrich for desired immune effector cells or their precursors, or positive selection can be usedA combination of a selection method and a negative selection method. Monoclonal antibodies (MAbs) are particularly useful for identifying markers associated with a particular cell lineage and/or differentiation stage associated with both positive and negative selection. If a particular type of CELL, such as a particular type of T CELL, is to be isolated, various CELL surface markers or combinations of markers can be used to isolate the CELL, including but not limited to CD3, CD4, CD8, CD34 (for hematopoietic stem/progenitor CELLs), etc., as is well known in the art (see, kearse, T CELL PROTOCOLS: DEVELOPMENT AND ACTIVATION, humana Press, totowa NJ (2000); de Libero, T CELL PROTOCOLS, vol. 51of Methods in Molecular Biology, humana Press, totowa NJ (2009)). In some embodiments, enrichment of the T cell population by negative selection can be accomplished with antibody binding to a surface marker specific to the negatively selected cells. One approach is cell sorting and/or selection by negative magnetic immunoadhesion or flow cytometry using a mixture of monoclonal antibodies directed against cell surface markers present on the negatively selected cells. For example, to enrich for CD4 by negative selection ⁺ The cell, monoclonal antibody mixture usually includes CD14, CD20, CD11b, CD16, HLA-DR and CD8 antibody. In certain embodiments, it may be desirable to enrich for or positively select regulatory T cells that normally express CD4+, CD25+, CD62Lhi, GITR +, and FoxP3+. Alternatively, in certain embodiments, T regulatory cells are eliminated by anti-C25 conjugated microbeads or other similar selection methods.

Separation procedures for immune effector cells include, but are not limited to, density gradient centrifugation, coupling of particles that modify cell density, magnetic bead magnetic separation coated with antibodies, affinity chromatography; cytotoxic agents used in conjunction or conjugation with monoclonal antibodies (mabs) include, but are not limited to, complement AND cytotoxins, as well as antibody panning attached to a solid substrate, such as a plate or chip, elution, flow cytometry, or any other convenient technique (see, e.g., recktenwald et al, CELL SEPARATION METHODS AND APPLICATIONS, marcel Dekker, inc., new York (1998)). It will be appreciated that the immune effector cells used in the methods provided herein may be substantially pure cells or may be a polyclonal population. In some embodiments, the polyclonal population can be enriched for desired immune effector cells. This enrichment can be performed before or after genetically engineering the cells to express the BCMA CARs or TCRs provided by the invention, as desired.

The immune effector cells may be autologous or non-autologous to the subject to whom they are administered in accordance with the disclosed methods of treatment. Autologous cells are isolated from a subject to which the engineered cells have been administered. Optionally, the cells may be obtained by leukapheresis, wherein the leukapheresis is selectively removed from the extracted blood, made into recombinants, and then infused into the donor. Alternatively, allogeneic cells from non-autologous donors of non-subjects may be used. In the case of non-autologous donors, the cells are typed and matched with Human Leukocyte Antigens (HLA) to determine the appropriate level of compatibility, as is well known in the art. Cells may optionally be cryopreserved after isolation and/or genetic engineering and/or cell expansion following genetic engineering (see Kaiser et al, supra, 2015)). Methods for cryopreserving CELLS are well known in the art (see, e.g., freshney, CURURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUES,4th ed., wiley-Liss, new York (2000); harrison and Rae, GENERAL TECHNIQUEQUES OF CELL CULTURE, cambridge University Press (1997)).

In some embodiments, the isolated immune effector cell is genetically engineered in vitro for recombinant expression of a polypeptide (e.g., a CAR or a TCR). In some embodiments, the isolated immune effector cell is genetically engineered in vitro for recombinant expression of a BCMA CAR or TCR. In some embodiments, the immune effector cells provided herein are obtained by in vitro priming (sensitization), wherein the priming reaction can occur before or after the immune effector cells are genetically engineered to recombinantly express the disclosed polypeptides. In one embodiment, the primed immune effector cells (e.g., T cells) are isolated from an in vivo source, and it will be self-evident that genetic engineering of primed immune effector cells will occur.

It is also contemplated in the present invention that a blood sample or apheresis preparation is collected from a subject over a period of time before the genetically engineered cells according to the present invention may be needed. Thus, the source of cells to be expanded can be collected at any necessary point in time, and the desired cells (e.g., T cells) isolated and frozen for later use in T cell therapy for any number of diseases or disorders that would benefit from T cell therapy, such as those described herein. In one embodiment, a blood sample or aliquot is taken from a generally healthy subject. In certain embodiments, a blood sample or aliquot is taken from a generally healthy subject at risk of developing the disease but who has not yet developed the disease, and the cells needed are isolated and frozen for later use. In certain embodiments, the T cells may be expanded, frozen, and used at a later time. In certain embodiments, a sample is collected from a patient shortly after diagnosis of a particular disease as described herein, but prior to any treatment. In another embodiment, cells are isolated from a blood sample or a single sample from a subject prior to any number of related treatment modalities, including, but not limited to, drug therapy (e.g., natalizumab, efletuzumab, antiviral agents), chemotherapy, radiation therapy, immunosuppressive agents (e.g., cyclosporine, azathioprine, methotrexate, mycophenolic acid, and FK 506), antibodies or other immunosuppressive agents (e.g., CAMPATH, anti-CD 3 antibodies, cyclophosphamide, fludarabine, cyclosporine, FK506, rapamycin, mycophenolic acid, steroids, FR 901228), and irradiation. These drugs inhibit the calcium dependent phosphatases calcineurin (cyclosporine and FK 506) or inhibit p70S6 kinase (rapamycin) which is important for growth factor induced signaling (Liu et al, cell 66 807-815,1991, henderson et al, immun 73-321, 1991, bierer et al, curr. Opin. Immun.5:763-773, 1993). In further embodiments, the cells are isolated and frozen for subsequent use in conjunction with bone marrow transplantation or stem cell transplantation (e.g., prior to, concurrent with, or after transplantation), T cell ablation therapy with a chemotherapeutic agent (e.g., fludarabine), external electron beam radiation therapy (XRT), cyclophosphamide, or an antibody (e.g., OKT3 or CAMPATH). In another embodiment, the cells are isolated prior to B-cell ablation therapy and can be frozen for later use in later therapy, such as drugs that react with CD20 (e.g., rituxan).

In further embodiments, the T cells are obtained directly from the patient after treatment. In this respect, it has been observed that after certain cancer treatments, in particular treatments with drugs that damage the immune system, the patient is usually recovered from the treatment within a period of time shortly after the treatment, and the quality of the T cells obtained can be optimized or improved due to their capacity to expand in vitro. Likewise, these cells can be in a preferred state for enhanced transplantation and in vivo expansion following in vitro manipulation using the methods described herein. Therefore, it is contemplated that blood cells, including T cells, NK cells, or other immune effector cells of the hematopoietic lineage, are collected at this stage of recovery. Furthermore, in certain embodiments, mobilization (e.g., mobilization with GM-CSF) and pretreatment regimens can be used to create conditions in a subject that favor the re-proliferation, recycling, regeneration, and/or expansion of a particular cell type, particularly during a defined time window following treatment. Exemplary cell types include T cells, B cells, dendritic cells, and other cells of the immune system.

The immune effector cells disclosed herein may be subjected to conditions known in the art to facilitate cell maintenance or expansion. (De Libero, T Cell Protocols, vol.514 of Methods in Molecular Biology, humana Press, totowa NJ (2009); parente-Pereira et al, J.Biol.Methods 1 (2) e7 (doi 10.14440/jbm.2014.30) (2014); movasssagh et al, hum.Gene Ther.11:11891200 (2000); rettig et al, mol.Ther.8:29-41 (2003); agarwal et al, J.Virol.72:3720-3728 (1998); pollok et al, hum.Gene Ther.10:2221-2236 (1999); quinn et al, hum.Gene Ther.9: 1457-Ther (1998); see also commercially available Methods such as Wataham et al, fisher et al). Immune effector cells (e.g., T cells) disclosed herein can optionally be expanded prior to or after in vitro genetic engineering. Expansion of cells is particularly useful for increasing the number of cells in a subject for administration. Such methods for cell expansion are well known in the art (see, e.g., kaiser et al, cancer Gene Therapy 22 (2015); wolfl et al, nat. Protocols 9. In addition, the cells may optionally be cryopreserved after isolation and/or genetic engineering and/or expansion of the genetically engineered cells (see Kaiser et al, supra, 2015)). Methods for cryopreserving CELLS are well known in the art (see, e.g., freshney, CURTURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUES,4th ed., wiley-Liss, new York (2000); harrison and Rae, GENERAL TECHNIQUEQUES OF CELL CULTURE, cambridge University Press (1997)).

In general, the T cells provided herein can be expanded by contacting the T cells with a surface having attached thereto an agent that stimulates a signal associated with the CD3/TCR complex and a ligand that stimulates a co-stimulatory receptor on the surface of the T cell. In particular, the population of T cells can be stimulated as described herein, for example by contact with an anti-CD 3 antibody or antigen-binding fragment thereof, or an anti-CD 2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) that binds to a calcium ionophore. To co-stimulate accessory molecules on the surface of T cells, ligands that bind the accessory molecules are used. For example, a population of T cells can be contacted with an anti-CD 3 antibody and an anti-CD 28 antibody under conditions suitable to stimulate proliferation of the T cells. To stimulate proliferation of CD4+ T cells or CD8+ T cells, anti-CD 3 antibodies and anti-CD 28 antibodies. Examples of anti-CD 28 antibodies include 9.3, B-T3, XR-CD28 (Diaclone, besancon, france), other methods common in the art may also be used (Berg et al, transplant Proc.30 (8): 397677, 1998, haanen et al, J.exp.Med.190 (9): 91328,1999 Garland et al, J.Immunol meth.227 (1-2): 53-63, 1999).

The invention has been described herein in language specific to numerous embodiments. The invention also specifically includes embodiments that wholly or partially exclude certain subject matter, such as substances or materials, method steps and conditions, protocols, procedures, assays, or analyses. Thus, even if the present invention is not generally expressed in a content that is not included in the present invention, aspects that are not explicitly included in the present invention are still disclosed in the present invention.

Specific embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of the disclosed embodiments will become apparent to those skilled in the art upon reading the foregoing description, and it is contemplated that such variations may be suitably employed by persons skilled in the art. Accordingly, this invention is intended to be practiced otherwise than as specifically described, and this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

All publications, patent applications, accession numbers and other references cited in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated herein by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Citation or identification of any reference in the description of some embodiments of the invention shall not be construed as an admission that such reference is available as prior art to the present invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

Various embodiments of the present invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the description in the experiment is intended to illustrate but not limit the scope of the invention described in the claims.

5.9 experiment

Twelve novel anti-BCMA scfvs were generated and characterized as described below. T cells expressing CARs comprising these BCMA scfvs were also generated and characterized. The cytotoxicity of these BCMA CART on BCMA expressing tumors was demonstrated.

5.9.1 materials and methods

Primary human lymphocytes. Primary human CD4+ T cells and CD8+ T cells were isolated from healthy volunteers. T cells were stimulated with anti-CD 3/CD28 Dynabead magnetic beads (Life Technologies, grand Island, NY) and supplementedThe cells were cultured in R10 medium supplemented with 100IU/mL IL-2 (RPMI-1640 medium supplemented with 10% fetal bovine serum, 1% HEPES, 1% GutamAX, 1% penicillin and streptomycin, 1% MEM NEAA and 1% sodium pyruvate).

Cell lines. The following cell lines were cultured in R10 medium and used in related experiments: nalm6 (human leukemia cells), jeko1 (human lymphoma cells), RPMI-8226 (human myeloma cells), raji (human lymphoma cells), THP1 (human leukemia cells), HCC70 (human breast cancer cells), 786-O (human renal cell carcinoma cells), SH-SY5Y (human neuroblastoma cells), A549ESO (human lung cancer cells), SKOV3 (human ovarian cancer cells), PC3 (human prostate cancer cells), H226 (human lung cancer cells), ASPC1 (human pancreatic tumor cells), caski (human cervical cancer cells), and K562 (human leukemia cells).

Lentiviral production and transduction. Lentiviral vectors were generated from HEK293T cells transfected with transfer and packaging plasmids prsv.rev, pmd2.g and pmdlg.prre. Lentiviral vectors were harvested after 24 and 48 hours and concentrated by ultracentrifugation.

T cells (CD 4: CD8= 1) were stimulated by CD3/CD28 Dynabead magnetic beads on day 0. Lentivirus was added to the medium on day 1. Cells were fed daily or every two days with R10 medium containing 100IU/ml IL-2.

BCMA31. Production of BBz and LACO mRNA. In vitro transcription of mRNA was performed using the Ambion Message mMACHINE T7 Ultra kit (Life Technologies, carlsbad, calif.).

Electroporation of BCMA31.BBz and LACO mRNA. mRNA was added to 0.1ml T cells (1 in a volume)

10 ⁸ Individual cells/ml), the T cells were washed twice and resuspended with OPTI-MEM. Electroporation was performed in a 0.2cm cuvette using BTX830 (Harvard Apparatus BTX) at 500V and 0.7 ms.

Tumor killing assay using IncuCyte real-time cell analyzer. Tumor cells and T cells were washed twice with R10 medium and then resuspended in R10 medium. Both tumor cells and CAR + T cells were seeded at a concentration of 10000 cells/well in 96-well plates. The total cumulative intensity was recorded every 4 hours.

ELISA.10 ten thousand CAR-T cells and 10 ten thousand tumor cells were co-cultured at 37 ℃ for 24 hours, and then the supernatant was collected and subjected to ELISA kit (R)&D Systems) for measuring the secretion levels of IL-2 and IFN γ.

CD107a assay. CAR-T cells and tumor cells were mixed at a ratio of 1. CD107 antibody was added to the medium. After 1 hour of co-incubation, golgiStop solution was added. After 3 hours, cells were stained with CD3-BV421 and CD8-APC antibodies and analyzed by flow cytometry.

5.9.2 preparation of anti-BCMA antibodies

anti-BCMA antibodies were prepared using a fully human antibody phage display library according to the following procedure:

(1) Expression and purification of phage display libraries: the log phase TG1 library cultures were infected with freshly thawed M13K07 helper phage with a multiple infection rate of 20 (phage to cell ratio) and induced overnight with IPTG; the phage library was purified by PEG/NaCl precipitation and then the phage titer was determined. The phage were stored at 4 ℃ and later scFv selected.

(2) Selection of BCMA-specific scFv-phages: in the first round of selection, 20. Mu.g/ml BCMA-6His protein dissolved in 1 XPBS was coated on Maxisorp plates and incubated overnight at 4 ℃. (in subsequent rounds of selection, lower protein concentrations were used for more stringent selections, including 2. Mu.g/ml in the second round of bioscreening, 0.5. Mu.g/ml in the third round of bioscreening.) then after washing the plates three times with PBS, blocking buffer (5% milk and 1% BSA in 1 × PBS) was added to each well. After incubation for 2 hours at room temperature, the blocking buffer was discarded, the phage solution was added, the plate was sealed with a preservative film, and incubated for 2 hours with gentle shaking. In the first round of selection, the plates were then washed 10 times with PBST. (in the next few rounds, the stringency of the washes was increased by adding more wash cycles: the second 20 wash cycles, the third 30 wash cycles). The antigen-binding scFv-phages were then eluted using 1mL of acid wash-off buffer (pH 2.2), neutralized, inoculated into 15mL of log-phase TG1 culture (OD 600= 0.5), incubated at 37 ℃ for 30min and shaking for 30min, inoculated on 2xYT-GA agar plates, and incubated overnight at 30 ℃ for subsequent selection.

(3) mpELISA screening: after three rounds of screening, 480 phage-infected colony clones were selected for monoclonal phage ELISA (mpasa) screening. Phage supernatants were generated from single colony clones and tested for binding to BCMA-Fc protein. The supernatant was incubated with pre-blocked Maxisorp plates coated with 2. Mu.g/ml BCMA-6His protein. After three washes, 100 μ l/well of HRP-conjugated anti-M13 antibody was added, which was raised to 1:5000 dilution, and then incubation at room temperature for 60min. After washing the plate 5 times with PBST, 100. Mu.l/well of TMB matrix solution was added and incubated for 10-30 minutes until blue color appeared. The reaction was stopped by adding 50. Mu.l/well of a stop solution (2N H2 SO4). The absorbance was read at 450nm in a microplate reader. Table 4 below provides readings from three representative anti-human BCMA-Fc monoclonal phage ELISA 96-well plates. Clones with a gray highlight were positive clones. In phage ELISA assays, a total of 36 positive clones were selected, scFv fragments were amplified by PCR and sequenced.

Table 4: plate-1

Plate-2

Flat plate-3

(4) Cloning and sequence analysis: positive clones were selected based on the ELISA results and used as PCR cloning templates for scFv sequences (forward primer sequence: tgcagctggcacgacaggttttc, reverse primer sequence: cgtcagactgtagcacgtt). The PCR product was then sequenced by sanger sequencing (forward primer sequence: aacaattgaattcagggga, reverse primer sequence: cctctctaaagaagcgtggatc). The CDR regions of the scFv were analyzed by the abysis website (http:// abysis. Org /), see tables 1 and 2 above.

(5) Screening for functional anti-BCMA scFv in T cells: anti-BCMA scFv was constructed into a bicistronic lentiviral CAR expression vector containing an IRES truncated EGFR (tfegfr) expression cassette. Lentiviruses were produced by transient transfection of 293T cells, followed by purification by ultracentrifugation and concentration. T cells were transduced with CAR lentivirus to generate CAR-T cells, which were then cultured for an additional 10 days. 10 days after lentivirus transduction, CAR-T cells were harvested and stained with 5. Mu.g/ml CD19-Fc protein (Ctrl Fc protein) or BCMA-Fc recombinant protein for 30 min at 4 ℃. After washing, CAR-T cells were stained with anti-human IgG Fc and anti-EGFR mAb. The samples were analyzed using a flow cytometer. As shown, T cells expressing CAR (containing the following anti-BCMA scFv) showed binding to BCMA-Fc (fig. 1B), and were selected for further study: BCMA21, BCMA22, BCMA23, BCMA24, BCMA27, BCMA28, BCMA30, BCMA31, BCMA32, BCMA33, BCMA34, and BCMA35.

5.9.3 preparation and characterization of BCMA-CART

We constructed 12 different anti-BCMA CARs using the anti-BCMA scFv described above. Parallel testing was performed on 3 other CART products, including NBC10 (Novartis AG and University of Pennsylvania, BMCA10. BBz) (SEQ ID NO: 129), FVHH 33 (National Institutes of Health, US) (SEQ ID NO: 128), and B38M (Nanjing legend Biotechnology) (SEQ ID NO: 130). All CARs tested had a 41BBz coactivator domain.

Table 5: BCMA CART, CAR% and expression levels

CART	scFv	CAR％	MFI
					1	NBC10	22％	1.2E+05
2	FHVH33	84％	3.2E+05
				3	BCMA21	31％	1.6E+05
4	BCMA22	12％	7.5E+04
				5	BCMA23	18％	2.2E+05
6	BCMA24	23％	9.4E+04
				7	BCMA27	27％	1.7E+05
8	BCMA28	29％	6.5E+04
				9	BCMA30	25％	4.6E+04
10	BCMA31	37％	2.5E+05
				11	BCMA32	19％	5.6E+04
12	BCMA33	27％	2.6E+05
				13	BCMA34	16％	9.5E+04
14	BCMA35	18％	1.1E+05
				15	B38M	51％	5.8E+05
16	NTD

T cells were transduced by lentiviral vectors to express different BCMA CARs. Table 5 above shows the percentage of CART cells, CAR expressing cells and their respective expression levels used in the presently disclosed study. Figures 2A and 2B show the frequency of CAR + T cells and their expression levels ("MFI" is mean fluorescence intensity), respectively. Among the 12 scfvs generated in the present invention, BCMA31 (# 10, seq ID no 123) and BCMA33 (# 12) were expressed at higher levels than the other scfvs. FIG. 3 shows the comparable frequencies of CAR + CD8 cells (compare frequencies) in the test CART. Fig. 4 shows the phenotype of CART cells. The frequency of naive T cell populations (CD 45RO-; CCR7 +) was higher in BCMA27 (# 7), BCMA31 (# 10), and BCMA33 (# 12) T cells than in other samples, indicating that these T cells were less differentiated.

5.9.4 expression of BCMA in tumor cells

As shown in fig. 5A and 5B, BCMA expression was detected by FACS staining (fig. 5A) and RT-PCR (fig. 5B) for different tumor cell lines. BCMA expression was detected by FACS staining in Jeko-1 (low), raji (medium) and RPMI-8226 cells (high). Although no expression of BCMA in Nalm6 was detected by FACS, RT-PCR analysis showed expression of BCMA in Nalm6, although at a low level.

5.9.5BCMA CART is cytotoxic to tumor cells

Co-culturing the CART cells with Jeko-1 cells and RPMI-8226 tumor cells. The production of INF-gamma and IL-2 was examined. As shown in fig. 6A (INF- γ) and 6B (IL-2), among the 12 CART generated in the present invention, BCMA23 (# 5), BCMA24 (# 6), BCMA27 (# 7), BCMA31 (# 10, seq ID no 138), and BCMA33 (# 12) were able to produce more cytokines than other CART cells (including NBC10 and B38M CAR T cells).

We also tested the cytolytic activity of CART cells against Jeko-1 (FIGS. 7A-7D) and RPMI-8226 cells (FIGS. 8A-8E), respectively. BCMA23 (# 5), BCMA24 (# 6), BCMA31 (# 10), and BCMA33 (# 12) CART cells exhibited varying degrees of cytotoxicity to Jeko-1 cells, with BCMA31 (# 10) being the most cytotoxic and being effective in eliminating Jeko-1. Further, BCMA21 (# 3), BCMA22 (# 4), BCMA23 (# 5), BCMA24 (# 6), BCMA27 (# 7), BCMA31 (# 10), BCMA33 (# 12), BCMA4 (# 13), and BCMA35 (# 14) exhibited different levels of cytotoxicity to RPMI-8226 cells, in which BCMA21 (# 3), BCMA23 (# 5), BCMA24 (# 6), BCMA27 (# 7), BCMA31 (# 10), and BCMA33 (# 12) effectively eliminated RPMI-8226 cells.

6. Electronically submitted sequence listing reference

The present application incorporates by reference a sequence listing created with the present application in the ASCII text file "613a006cn02_st25" of 27,861 bytes size, year 2022, 5/19.

SEQUENCE LISTING

<110> Shanghai excellent Biopharmaceutical Co., ltd

<120> BCMA targeting antibody, chimeric antigen receptor and application thereof

<130> 613A006CN02

<150> PCT/CN2021/112798

<151> 2021-08-16

<150> CN 202180005555.3

<151> 2022-03-25

<160> 184

<170> PatentIn version 3.5

<210> 8

<211> 14

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31 LCDR1

<400> 8

Thr Gly Thr Ser Ser Asp Val Gly Thr Tyr Asn Tyr Val Ser

1 5 10

<210> 18

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31 LCDR2

<400> 18

Asp Val Asn Gln Arg Pro Ser

1 5

<210> 28

<211> 10

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31 LCDR3

<400> 28

Ser Ser Tyr Gly Gly Ser Asn Asn Leu Val

1 5 10

<210> 39

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31 HCDR1

<400> 39

Ser Tyr Trp Met Ser

1 5

<210> 51

<211> 17

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31 HCDR2

<400> 51

Asn Ile Lys Pro Asp Gly Ser Asp Lys Tyr Tyr Val Asp Ser Val Lys

1 5 10 15

Gly

<210> 63

<211> 7

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31 HCDR3

<400> 63

Gly Ala Thr Thr Tyr Gly Ser

1 5

<210> 75

<211> 110

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31 VL AA

<400> 75

Gln Ser Ala Leu Thr Gln Pro Pro Ser Ala Ser Gly Ser Pro Gly Gln

1 5 10 15

Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Thr Tyr

20 25 30

Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu

35 40 45

Met Ile Tyr Asp Val Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Val Ser Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Gly Gly Ser

85 90 95

Asn Asn Leu Val Phe Gly Gly Gly Thr Lys Val Thr Val Leu

100 105 110

<210> 87

<211> 116

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31 VH AA

<400> 87

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Trp Met Ser Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Asn Ile Lys Pro Asp Gly Ser Asp Lys Tyr Tyr Val Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Asp

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Gly Glu Asp Thr Ala Ile Tyr Tyr Cys

85 90 95

Ala Arg Gly Ala Thr Thr Tyr Gly Ser Trp Gly Gln Gly Thr Leu Val

100 105 110

Thr Val Ser Ser

115

<210> 99

<211> 330

<212> DNA

<213> artificial sequence

<220>

<223> BCMA31 VL NT

<400> 99

caatctgccc tgactcagcc tccctccgcg tccgggtctc ctggacagtc agtcaccatc 60

tcctgcactg gaaccagcag tgacgttggt acttataatt atgtctcctg gtaccaacaa 120

cacccaggca aagcccccaa gctcatgatt tatgacgtca atcagcggcc ctcaggggtc 180

cctgatcgct tctctggctc caagtctggc aacacggcct ccctgaccgt ctctgggctc 240

caggctgagg atgaggctga ttattactgc agctcatatg gaggcagcaa caatttggta 300

ttcggcggag ggaccaaggt caccgtccta 330

<210> 111

<211> 348

<212> DNA

<213> artificial sequence

<220>

<223> BCMA31 VH NT

<400> 111

gaagtgcaac tggtggagtc tgggggaggc ttgatccagc ctggggggtc cctgagactc 60

tcctgtgcag cctctggatt cacctttagt agctattgga tgagctgggt ccgccaaagt 120

ccagggaagg ggctggagtg ggtggccaac ataaagccag atggaagtga caaatactat 180

gtggactctg tgaagggccg attcaccatc tccagagaca acgccaagaa ctcactggat 240

ctgcaaatga acagcctgag aggcgaagac acggctattt attactgcgc gagaggtgcc 300

accacctatg gctcctgggg ccagggaacc ctggtcactg tctcctca 348

<210> 123

<211> 241

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31 scFv

<400> 123

Gln Ser Ala Leu Thr Gln Pro Pro Ser Ala Ser Gly Ser Pro Gly Gln

1 5 10 15

Ser Val Thr Ile Ser Cys Thr Gly Thr Ser Ser Asp Val Gly Thr Tyr

20 25 30

Asn Tyr Val Ser Trp Tyr Gln Gln His Pro Gly Lys Ala Pro Lys Leu

35 40 45

Met Ile Tyr Asp Val Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe

50 55 60

Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser Leu Thr Val Ser Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys Ser Ser Tyr Gly Gly Ser

85 90 95

Asn Asn Leu Val Phe Gly Gly Gly Thr Lys Val Thr Val Leu Gly Gly

100 105 110

Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln

115 120 125

Leu Val Glu Ser Gly Gly Gly Leu Ile Gln Pro Gly Gly Ser Leu Arg

130 135 140

Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Trp Met Ser

145 150 155 160

Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Val Ala Asn Ile

165 170 175

Lys Pro Asp Gly Ser Asp Lys Tyr Tyr Val Asp Ser Val Lys Gly Arg

180 185 190

Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Asp Leu Gln Met

195 200 205

Asn Ser Leu Arg Gly Glu Asp Thr Ala Ile Tyr Tyr Cys Ala Arg Gly

210 215 220

Ala Thr Thr Tyr Gly Ser Trp Gly Gln Gly Thr Leu Val Thr Val Ser

225 230 235 240

Ser

<210> 128

<211> 142

<212> PRT

<213> artificial sequence

<220>

<223> FHVH33

<400> 128

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu

20 25 30

Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe

35 40 45

Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys

50 55 60

Gly Leu Glu Trp Val Ser Ser Ile Ser Gly Ser Gly Asp Tyr Ile Tyr

65 70 75 80

Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Ile Ser

85 90 95

Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr

100 105 110

Ala Val Tyr Tyr Cys Ala Lys Glu Gly Thr Gly Ala Asn Ser Ser Leu

115 120 125

Ala Asp Tyr Arg Gly Gln Gly Thr Leu Val Thr Val Ser Ser

130 135 140

<210> 129

<211> 260

<212> PRT

<213> artificial sequence

<220>

<223> NBC10 scFv

<400> 129

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu

20 25 30

Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Phe

35 40 45

Ala Leu Ser Asn His Gly Met Ser Trp Val Arg Arg Ala Pro Gly Lys

50 55 60

Gly Leu Glu Trp Val Ser Gly Ile Val Tyr Ser Gly Ser Thr Tyr Tyr

65 70 75 80

Ala Ala Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Arg

85 90 95

Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Ala

100 105 110

Ile Tyr Tyr Cys Ser Ala His Gly Gly Glu Ser Asp Val Trp Gly Gln

115 120 125

Gly Thr Thr Val Thr Val Ser Ser Ala Ser Gly Gly Gly Gly Ser Gly

130 135 140

Gly Arg Ala Ser Gly Gly Gly Gly Ser Asp Ile Gln Leu Thr Gln Ser

145 150 155 160

Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys

165 170 175

Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln Gln Lys

180 185 190

Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Ala Ala Ser Ser Leu Gln

195 200 205

Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe

210 215 220

Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr

225 230 235 240

Cys Gln Gln Ser Tyr Ser Thr Pro Tyr Thr Phe Gly Gln Gly Thr Lys

245 250 255

Val Glu Ile Lys

260

<210> 130

<211> 244

<212> PRT

<213> artificial sequence

<220>

<223> B38M scFv

<400> 130

Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Glu His Thr Phe Ser Ser His

20 25 30

Val Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ser Val

35 40 45

Ala Val Ile Gly Trp Arg Asp Ile Ser Thr Ser Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Lys Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Ala Arg Arg Ile Asp Ala Ala Asp Phe Asp Ser Trp Gly Gln Gly

100 105 110

Thr Gln Val Thr Val Ser Ser Gly Gly Gly Gly Ser Glu Val Gln Leu

115 120 125

Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly Ser Leu Arg Leu

130 135 140

Ser Cys Ala Ala Ser Gly Arg Thr Phe Thr Met Gly Trp Phe Arg Gln

145 150 155 160

Ala Pro Gly Lys Glu Arg Glu Phe Val Ala Ala Ile Ser Leu Ser Pro

165 170 175

Thr Leu Ala Tyr Tyr Ala Glu Ser Val Lys Gly Arg Phe Thr Ile Ser

180 185 190

Arg Asp Asn Ala Lys Asn Thr Val Val Leu Gln Met Asn Ser Leu Lys

195 200 205

Pro Glu Asp Thr Ala Leu Tyr Tyr Cys Ala Ala Asp Arg Lys Ser Val

210 215 220

Met Ser Ile Arg Pro Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val

225 230 235 240

Ser Ser Thr Ser

<210> 138

<211> 486

<212> PRT

<213> artificial sequence

<220>

<223> BCMA31.BBZ

<400> 138

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro Gln Ser Ala Leu Thr Gln Pro Pro Ser Ala

20 25 30

Ser Gly Ser Pro Gly Gln Ser Val Thr Ile Ser Cys Thr Gly Thr Ser

35 40 45

Ser Asp Val Gly Thr Tyr Asn Tyr Val Ser Trp Tyr Gln Gln His Pro

50 55 60

Gly Lys Ala Pro Lys Leu Met Ile Tyr Asp Val Asn Gln Arg Pro Ser

65 70 75 80

Gly Val Pro Asp Arg Phe Ser Gly Ser Lys Ser Gly Asn Thr Ala Ser

85 90 95

Leu Thr Val Ser Gly Leu Gln Ala Glu Asp Glu Ala Asp Tyr Tyr Cys

100 105 110

Ser Ser Tyr Gly Gly Ser Asn Asn Leu Val Phe Gly Gly Gly Thr Lys

115 120 125

Val Thr Val Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly

130 135 140

Gly Gly Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Ile Gln

145 150 155 160

Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe

165 170 175

Ser Ser Tyr Trp Met Ser Trp Val Arg Gln Ser Pro Gly Lys Gly Leu

180 185 190

Glu Trp Val Ala Asn Ile Lys Pro Asp Gly Ser Asp Lys Tyr Tyr Val

195 200 205

Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn

210 215 220

Ser Leu Asp Leu Gln Met Asn Ser Leu Arg Gly Glu Asp Thr Ala Ile

225 230 235 240

Tyr Tyr Cys Ala Arg Gly Ala Thr Thr Tyr Gly Ser Trp Gly Gln Gly

245 250 255

Thr Leu Val Thr Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro

260 265 270

Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu

275 280 285

Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp

290 295 300

Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly

305 310 315 320

Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg

325 330 335

Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln

340 345 350

Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu

355 360 365

Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala

370 375 380

Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu

385 390 395 400

Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp

405 410 415

Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu

420 425 430

Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile

435 440 445

Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr

450 455 460

Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met

465 470 475 480

Gln Ala Leu Pro Pro Arg

485

<210> 150

<211> 1461

<212> DNA

<213> artificial sequence

<220>

<223> BCMA31.BBZ NT

<400> 150

atgctgctgc tggtgaccag cctgctgctg tgcgagctgc cccaccccgc ctttctgctg 60

atcccccaat ctgccctgac tcagcctccc tccgcgtccg ggtctcctgg acagtcagtc 120

accatctcct gcactggaac cagcagtgac gttggtactt ataattatgt ctcctggtac 180

caacaacacc caggcaaagc ccccaagctc atgatttatg acgtcaatca gcggccctca 240

ggggtccctg atcgcttctc tggctccaag tctggcaaca cggcctccct gaccgtctct 300

gggctccagg ctgaggatga ggctgattat tactgcagct catatggagg cagcaacaat 360

ttggtattcg gcggagggac caaggtcacc gtcctaggtg gtggtggttc tggcggcggc 420

ggctccggag gtggtggatc cgaagtgcaa ctggtggagt ctgggggagg cttgatccag 480

cctggggggt ccctgagact ctcctgtgca gcctctggat tcacctttag tagctattgg 540

atgagctggg tccgccaaag tccagggaag gggctggagt gggtggccaa cataaagcca 600

gatggaagtg acaaatacta tgtggactct gtgaagggcc gattcaccat ctccagagac 660

aacgccaaga actcactgga tctgcaaatg aacagcctga gaggcgaaga cacggctatt 720

tattactgcg cgagaggtgc caccacctat ggctcctggg gccagggaac cctggtcact 780

gtctcctcaa ccactacccc agcaccgcgg ccacccaccc cggctcctac catcgcctcc 840

cagcctctgt ccctgcgtcc ggaggcatgt agacccgcag ctggtggggc cgtgcatacc 900

cggggtcttg acttcgcctg cgatatctac atttgggccc ctctggctgg tacttgcggg 960

gtcctgctgc tttcactcgt gatcactctt tactgtaaac ggggcagaaa gaaactcctg 1020

tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga agatggctgt 1080

agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa gttcagcagg 1140

agcgcagacg cccccgcgta ccagcagggc cagaaccagc tctataacga gctcaatcta 1200

ggacgaagag aggagtacga tgttttggac aagagacgtg gccgggaccc tgagatgggg 1260

ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca gaaagataag 1320

atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg caaggggcac 1380

gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc ccttcacatg 1440

caggccctgc cccctcgcta a 1461

<210> 155

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> linker

<220>

<221> REPEAT

<222> (1)..(5)

<223> (GGGGS)n, n=1,2, 3, 4, or 5

<400> 155

Gly Gly Gly Gly Ser

1 5

<210> 156

<211> 5

<212> PRT

<213> artificial sequence

<220>

<223> linker

<220>

<221> REPEAT

<222> (1)..(5)

<223> (EAAAK)n, n=1,2, 3, 4, or 5

<400> 156

Glu Ala Ala Ala Lys

1 5

<210> 157

<211> 3

<212> PRT

<213> artificial sequence

<220>

<223> linker

<220>

<221> REPEAT

<222> (1)..(2)

<223> (PA)nP, n=1, 2, 3, 4,or 5

<400> 157

Pro Ala Pro

1

<210> 158

<211> 15

<212> PRT

<213> artificial sequence

<220>

<223> linker

<400> 158

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 159

<211> 164

<212> PRT

<213> artificial sequence

<220>

<223> human CD3 zeta

<400> 159

Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu

1 5 10 15

Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys

20 25 30

Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala

35 40 45

Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr

50 55 60

Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg

65 70 75 80

Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met

85 90 95

Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn

100 105 110

Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met

115 120 125

Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly

130 135 140

Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala

145 150 155 160

Leu Pro Pro Arg

<210> 170

<211> 220

<212> PRT

<213> artificial sequence

<220>

<223> human CD28

<400> 170

Met Leu Arg Leu Leu Leu Ala Leu Asn Leu Phe Pro Ser Ile Gln Val

1 5 10 15

Thr Gly Asn Lys Ile Leu Val Lys Gln Ser Pro Met Leu Val Ala Tyr

20 25 30

Asp Asn Ala Val Asn Leu Ser Cys Lys Tyr Ser Tyr Asn Leu Phe Ser

35 40 45

Arg Glu Phe Arg Ala Ser Leu His Lys Gly Leu Asp Ser Ala Val Glu

50 55 60

Val Cys Val Val Tyr Gly Asn Tyr Ser Gln Gln Leu Gln Val Tyr Ser

65 70 75 80

Lys Thr Gly Phe Asn Cys Asp Gly Lys Leu Gly Asn Glu Ser Val Thr

85 90 95

Phe Tyr Leu Gln Asn Leu Tyr Val Asn Gln Thr Asp Ile Tyr Phe Cys

100 105 110

Lys Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser

115 120 125

Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro

130 135 140

Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly

145 150 155 160

Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile

165 170 175

Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met

180 185 190

Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro

195 200 205

Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser

210 215 220

<210> 171

<211> 255

<212> PRT

<213> artificial sequence

<220>

<223> human 4-1BB

<400> 171

Met Gly Asn Ser Cys Tyr Asn Ile Val Ala Thr Leu Leu Leu Val Leu

1 5 10 15

Asn Phe Glu Arg Thr Arg Ser Leu Gln Asp Pro Cys Ser Asn Cys Pro

20 25 30

Ala Gly Thr Phe Cys Asp Asn Asn Arg Asn Gln Ile Cys Ser Pro Cys

35 40 45

Pro Pro Asn Ser Phe Ser Ser Ala Gly Gly Gln Arg Thr Cys Asp Ile

50 55 60

Cys Arg Gln Cys Lys Gly Val Phe Arg Thr Arg Lys Glu Cys Ser Ser

65 70 75 80

Thr Ser Asn Ala Glu Cys Asp Cys Thr Pro Gly Phe His Cys Leu Gly

85 90 95

Ala Gly Cys Ser Met Cys Glu Gln Asp Cys Lys Gln Gly Gln Glu Leu

100 105 110

Thr Lys Lys Gly Cys Lys Asp Cys Cys Phe Gly Thr Phe Asn Asp Gln

115 120 125

Lys Arg Gly Ile Cys Arg Pro Trp Thr Asn Cys Ser Leu Asp Gly Lys

130 135 140

Ser Val Leu Val Asn Gly Thr Lys Glu Arg Asp Val Val Cys Gly Pro

145 150 155 160

Ser Pro Ala Asp Leu Ser Pro Gly Ala Ser Ser Val Thr Pro Pro Ala

165 170 175

Pro Ala Arg Glu Pro Gly His Ser Pro Gln Ile Ile Ser Phe Phe Leu

180 185 190

Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu Leu Phe Phe Leu Thr Leu

195 200 205

Arg Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe

210 215 220

Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly

225 230 235 240

Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu

245 250 255

<210> 184

<211> 235

<212> PRT

<213> artificial sequence

<220>

<223> human CD8

<400> 184

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro Ser Gln Phe Arg Val Ser Pro Leu Asp Arg Thr

20 25 30

Trp Asn Leu Gly Glu Thr Val Glu Leu Lys Cys Gln Val Leu Leu Ser

35 40 45

Asn Pro Thr Ser Gly Cys Ser Trp Leu Phe Gln Pro Arg Gly Ala Ala

50 55 60

Ala Ser Pro Thr Phe Leu Leu Tyr Leu Ser Gln Asn Lys Pro Lys Ala

65 70 75 80

Ala Glu Gly Leu Asp Thr Gln Arg Phe Ser Gly Lys Arg Leu Gly Asp

85 90 95

Thr Phe Val Leu Thr Leu Ser Asp Phe Arg Arg Glu Asn Glu Gly Tyr

100 105 110

Tyr Phe Cys Ser Ala Leu Ser Asn Ser Ile Met Tyr Phe Ser His Phe

115 120 125

Val Pro Val Phe Leu Pro Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg

130 135 140

Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg

145 150 155 160

Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly

165 170 175

Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr

180 185 190

Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Asn His

195 200 205

Arg Asn Arg Arg Arg Val Cys Lys Cys Pro Arg Pro Val Val Lys Ser

210 215 220

Gly Asp Lys Pro Ser Leu Ser Ala Arg Tyr Val

225 230 235

Claims

1. An antibody or antigen-binding fragment thereof that specifically binds BCMA comprising:

(a) A light chain variable region (VL) comprising a light chain CDR1 (VL CDR 1), a light chain CDR2 (VL CDR 2), and a light chain CDR3 (VL CDR 3) having the amino acid sequences set forth in SEQ ID NOs 8, 18, and 28, respectively; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VL CDR; and/or

(b) A heavy chain variable region (VH) comprising a heavy chain CDR1 (VH CDR 1), a heavy chain CDR2 (VH CDR 2), and a heavy chain CDR3 (VH CDR 3) having the amino acid sequences shown in SEQ ID NOs: 39, 51, and 63, respectively; or a variant thereof having up to about 5 amino acid substitutions, additions and/or deletions in the VH CDRs.

2. The antibody or antigen-binding fragment of claim 1, which comprises a VL CDR1, a VL CDR2, a VL CDR3, a VH CDR1, a VH CDR2, and a VH CDR3, wherein (a) the VL CDR1, CDR2, and CDR3 have the amino acid sequences shown in SEQ ID NOs 8, 18, and 28, respectively; and (b) the VH CDR1, CDR2 and CDR3 have amino acid sequences shown in SEQ ID NOS: 39, 51 and 63, respectively.

3. An antibody or antigen-binding fragment thereof that specifically binds BCMA comprising: (a) A VL having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO. 75; and/or (b) a VH having at least 85%, at least 90%, at least 95%, at least 98% or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 87.

4. The antibody or antigen-binding fragment of claim 3, comprising a VL and a VH, wherein the VL and VH have the amino acid sequences shown in SEQ ID NOS 75 and 87, respectively.

5. An antibody or antigen-binding fragment thereof that specifically binds to BCMA comprising

(a) VL comprising VL CDR1, CDR2 and CDR3, said VL CDR1, CDR2 and CDR3

VL derived from an amino acid sequence as set forth in SEQ ID NO. 75; and/or

(b) VH comprising VH CDR1, CDR2 and CDR3, said VH CDR1, CDR2 and CDR3

Derived from VH having the amino acid sequence shown in SEQ ID NO: 87.

6. An antibody or antigen-binding fragment thereof that competes for binding to BCMA with the antibody or antigen-binding fragment of claim 1.

7. The antibody or antigen-binding fragment of claim 1, which is a monoclonal antibody or antigen-binding fragment.

8. The antibody or antigen-binding fragment of claim 1, which is a bispecific antibody or a multispecific antibody.

9. The antibody or antigen-binding fragment of claim 1, which is a bispecific T cell engager (BiTE).

10. The antibody or antigen binding fragment of claim 1, which is selected from the group consisting of an IgG1 antibody, an IgG2 antibody, an IgG3 antibody, and an IgG4 antibody.

11. The antibody or antigen binding fragment of claim 1, which is selected from the group consisting of Fab, fab ', F (ab') ₂ 、Fv、scFv、(scFv) ₂ Single domain antibodies (sdabs) and heavy chain antibodies (hcabs).

12. The antibody of claim 11, which is an scFv.

13. The antibody or antigen-binding fragment of claim 1, which is a chimeric antibody or antigen-binding fragment, a humanized antibody or antigen-binding fragment, or a human antibody or antigen-binding fragment.

14. The antibody or antigen-binding fragment of claim 13, which is a human antibody or antigen-binding fragment.

15. A polynucleotide encoding the antibody or antigen-binding fragment of any one of claims 1 to 14.

16. The polynucleotide of claim 15, which is a messenger RNA (mRNA).

17. A vector comprising the polynucleotide of claim 15.

18. A host cell comprising the polynucleotide of claim 15.

19. A Chimeric Antigen Receptor (CAR) that specifically binds BCMA, comprising from N-terminus to C-terminus:

(a) A BCMA binding domain comprising the antibody or antigen binding fragment of claim 1;

(b) A transmembrane domain; and

(c) A cytoplasmic domain.

20. The CAR of claim 19, wherein the transmembrane domain is derived from CD8, CD28, CD3 ζ, CD4, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LAG-3, 2B4, BTLA, TCR a chain, TCR β chain, or TCR ζ chain, CD3 ε, CD45, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, or CD154.

21. The CAR of claim 19, wherein the transmembrane domain comprises a CD8 transmembrane region or a CD28 transmembrane region.

22. The CAR of claim 19, wherein the cytoplasmic domain comprises a signaling domain derived from CD3 ζ, fcR γ, fcyriia, fcR β, CD3 γ, CD3 δ, CD3 ε, CD5, CD22, CD79a, CD79b, DAP10, DAP12, or any combination thereof.

23. The CAR of claim 22, wherein the cytoplasmic domain further comprises a co-stimulatory domain derived from CD28, 4-1BB (CD 137), OX40, ICOS, DAP10, 2B4, CD27, CD30, CD40, CD2, CD7, LIGHT, GITR, TLR, DR3, CD43, or any combination thereof.

24. The CAR of claim 19, wherein the cytoplasmic domain comprises a CD3 zeta signaling domain and a 4-1BB co-stimulatory domain.

25. The CAR of claim 19, wherein the cytoplasmic domain comprises a CD3 zeta signaling domain and a CD28 costimulatory domain.

26. The CAR of claim 19, further comprising a CD8 hinge, the CD8 hinge being located between the antibody or antigen-binding fragment and the transmembrane domain.

27. A CAR that specifically binds BCMA comprising the amino acid sequence set forth by SEQ ID NO: 138.

28. A polynucleotide encoding the CAR of any one of claims 19 to 27.

29. The polynucleotide of claim 28 which is an mRNA.

30. A vector comprising the polynucleotide of claim 28.

31. A cell comprising the polynucleotide of claim 28.

32. The cell of claim 31, which is an immune effector cell.

33. The cell of claim 32, which is derived from a cell isolated from peripheral blood or bone marrow.

34. The cell of claim 31, which is a T cell or an NK cell.

35. A cell population comprising the cells of claim 31, wherein the cell population is derived from Peripheral Blood Mononuclear Cells (PBMCs), peripheral Blood Lymphocytes (PBLs), tumor Infiltrating Lymphocytes (TILs), cytokine-induced killer Cells (CIKs), lymphokine-activated killer cells (LAKs), or bone marrow infiltrating lymphocytes (mls).

36. A pharmaceutical composition comprising a therapeutically effective amount of the antibody or antigen-binding fragment of any one of claims 1 to 14, and a pharmaceutically acceptable carrier.

37. A pharmaceutical composition comprising a therapeutically effective amount of the cell or population of cells of any one of claims 31-35, and a pharmaceutically acceptable carrier.

38. Use of an antibody or antigen-binding fragment according to any one of claims 1 to 14, or a cell or population of cells according to any one of claims 31 to 35, in the manufacture of a medicament for the treatment of cancer.

39. The use of claim 38, wherein the antibody or antigen-binding fragment, or cell or population of cells is used in combination with an additional therapy.

40. The use of claim 38, wherein the cancer is a BCMA-expressing cancer.

41. The use of claim 38, wherein the cancer is MM.

42. The use of claim 41, wherein the MM is non-secretory multiple myeloma or smoldering multiple myeloma.

43. A method of making a cell capable of expressing a CAR that specifically binds BCMA comprising transferring the polynucleotide of claim 28 to the cell.

44. The method of claim 43, wherein the polynucleotide is transferred by electroporation.

45. The method of claim 43, wherein the cell is selected from the group consisting of a T cell, an NK cell, an NKT cell, a macrophage, a neutrophil, and a granulocyte.