CN115305250A - Application of MYR1 in improving disease resistance of gramineous plants - Google Patents

Abstract

The invention provides an application of MYR1 in improving disease resistance of gramineous plants. The inventor discovers through methods such as genetics and molecular biology that a receptor MYR1 of a gramineous plant sensing arbuscular mycorrhizal fungus has the effect of negatively regulating disease resistance of plant roots, the disease resistance of the plant roots can be increased when the expression level of MYR1 is reduced, and the disease resistance of the plant roots can be weakened when the MYR1 is excessively expressed. Therefore, MYR1 is a negative regulatory factor for regulating and controlling plant disease resistance, and the targeted regulation and control of the gene can provide a new way for improvement of plant disease resistance.

Description

Application of MYR1 in improvement of disease resistance of gramineous plants

Technical Field

The invention belongs to the field of biotechnology and botany; more specifically, the invention relates to the use of MYR1 for improving disease resistance in graminaceous plants.

Background

Mycorrhizal symbiosis is a type of symbiosis formed by plants and mycorrhizal fungi, is widely existed in most plants, and according to statistics, 80-90% of terrestrial plants can form symbiosis with the mycorrhizal fungi. The mycorrhizal symbiosis can be divided into two categories of ectomycorrhiza and arbuscular mycorrhiza, wherein the ectomycorrhiza means that hypha of fungi mainly grows on the surface of a plant root system in a fitting mode, and the hypha of arbuscular mycorrhizal fungi grows into the plant root and develops at cortical cells to form a branch-shaped structure. When the plants and the microorganisms form a symbiotic relationship, the plants provide carbon sources necessary for the growth of the microorganisms, and the microorganisms help the plants to absorb water and nutrients in the environment and provide mineral elements such as nitrogen, phosphorus and the like for the plants.

The recognition of the external organisms by the plants is usually to recognize signal molecules from other organisms by using a series of receptor proteins on the surface of cell membranes. These receptor proteins are generally transmembrane proteins, and various extracellular domains can specifically bind molecules from other organisms, and transmit signals to downstream proteins through intracellular domains, so that the expression of related genes is changed, and plants respond to different sensed external organisms. The mycorrhizal symbiosis is formed by that firstly, the plant releases substances such as strigolactone to soil in the growing process, when spores of mycorrhizal fungi sense signals secreted by the plant, the spores germinate and grow towards the plant, and meanwhile, the mycorrhizal fungi release mycorrhizal factors for the plant to recognize, wherein the mycorrhizal factors are mainly lipo-chitooligosaccharide (LCO) and chitin tetra/pentaglycan (CO 4/5). In rice, MYR1 and CERK1 are required to be relied upon to identify mycorrhizal factors released by mycorrhizal fungi.

Symbiotic fungi are also fungi, but do not cause strong immune response in plants during the symbiosis process. Because the immune response of plants is not activated during symbiosis, there is still less research on the immune response during symbiosis. Since the receptor kinase CERK1 is required by plants to recognize both symbiotic fungi and pathogenic bacteria, it is not whether the symbiotic receptor MYR1 influences the immune process of plants by interacting with CERK1, thereby promoting the symbiotic process. Therefore, the immune suppression in the symbiosis process is deeply researched, which not only is beneficial to deeply clarifying the molecular mechanism of mycorrhizal symbiosis, but also lays a theoretical foundation for improving the resistance of rice to root diseases.

Therefore, there is a need in the art for further studies on the mechanism of immunosuppression in mycorrhizal symbiosis to allow rice to be modified by genetic engineering techniques to improve its resistance to root fungal diseases.

Disclosure of Invention

The invention aims to provide application of MYR1 in improving disease resistance of gramineous plants.

In a first aspect of the invention, there is provided the use of a down-regulator of MYR1 for enhancing disease resistance in graminaceous plants; or preparing a preparation for enhancing the disease resistance of the plants.

In a preferred embodiment, the down-regulating agents include (but are not limited to): an agent that knocks out or silences MYR1, an agent that inhibits MYR1 activity; preferably, the down-regulating agent comprises: a CRISPR gene editing reagent, homologous recombination reagent, or site-directed mutagenesis reagent for MYR1 that performs a loss-of-function mutation on MYR1; or, an interfering molecule that specifically interferes with expression of a gene encoding MYR1.

In another aspect of the present invention, there is provided a method for enhancing disease resistance of gramineous plants, comprising: downregulating expression or activity of MYR1 in a plant.

In a preferred example, said down-regulating expression or activity of MYR1 in a plant comprises: knocking out or silencing a gene encoding MYR1, or inhibiting MYR1 activity in a plant; preferably, said gene encoding a knockout or silencing MYR1 in a plant comprises: performing gene editing with a CRISPR system to knock out a coding gene of MYR1; knocking out a coding gene of MYR1 by a homologous recombination method; silencing MYR1 with an interfering molecule that specifically interferes with expression of a gene encoding MYR1; or, performing a loss-of-function mutation on MYR1 in a MYR 1-containing plant.

In another preferred example, the method comprises: performing gene editing by a CRISPR method to knock out a coding gene of MYR1; preferably, targeting gene encoding MYR1 at position 196, deletion of base G at position 196 results in premature termination of protein translation (MYR 1-1); alternatively, targeting gene encoding MYR1 at position 685, deletion of base C at position 685 results in premature termination of protein translation (MYR 1-2).

In another preferred embodiment, the enhancement includes enhancement, promotion, etc., which is a significant enhancement, improvement, or promotion, such as an enhancement, improvement, or promotion of disease resistance of 20%, 40%, 60%, 80%, 90% or more (20%, 40%, 60%, 80%, 90% or less disease reduction).

In another preferred embodiment, said down-regulated expression comprises a deleted expression.

In another preferred embodiment, the downregulation refers to a significant downregulation, such as down-regulation of 20%, 40%, 60%, 80%, 90% or less.

In another preferred example, MYR1 exerts a negative regulatory effect by inhibiting the formation of a disease-resistant receptor complex affecting the output of disease-resistant signals, and MYR1 reverses this negative regulatory effect; wherein the anti-disease receptor complex comprises: complex of disease-resistant receptor protein CEBiP and receptor kinase CERK 1.

In another preferred example, the MYR1 down-regulator increases ROS production when a plant is infested.

In another preferred example, the MYR1 down-regulator increases the activation (phosphorylation) of MAPK upon infestation of the plant.

In another preferred example, the MYR1 down-regulator expression of a disease resistance gene; preferably, the disease resistance gene comprises: PR10, PBZ1 or CHITINASE (including homologues of either of them).

In another preferred example, said graminaceous plant comprises the group consisting of or said MYR1 (including homologues thereof) is from the group consisting of: including (but not limited to): rice, wheat, millet, corn, sorghum, millet, barley, rye, oat, brachypodium distachyon and sugarcane.

In another preferred embodiment, the disease resistance is the ability of a plant to resist pathogens including (but not limited to): fungi; preferably a root fungus (a fungus that infects the roots of a plant); more preferably, the fungi include (but are not limited to): rice blast, rhizoctonia solani, leaf spot of flax, sclerotinia sclerotiorum, downy mildew and other fungal diseases.

In another preferred example, the MYR1 comprises: (a) a polypeptide having an amino acid sequence shown in SEQ ID NO. 2; (b) A polypeptide derived from (a) wherein the amino acid sequence shown in SEQ ID NO. 2 is substituted, deleted or added with one or more (e.g., 1 to 20; preferably 1 to 10; more preferably 1 to 5) amino acid residues, and which has the function of the polypeptide of (a); (c) A polypeptide having an amino acid sequence which is 80% or more (preferably 85% or more; more preferably 90% or more; more preferably 95% or more; e.g., 98% or more or 99% or more) identical to the amino acid sequence defined in (a) and having the function of the polypeptide of (a); or, (d) a fragment of SEQ ID NO 2 having the function of (a) the polypeptide; preferably including the protein kinase domain (amino acid sequence 270-634).

In another aspect of the invention, there is provided a down-regulator of MYR1 for enhancing disease resistance in plants, which is a CRISPR gene editing agent; preferably, it targets MYR1 encoding gene position 196 or 685, and G or C is mutated.

In a preferred embodiment, the sequence of the sgRNA of the down regulator sgRNA construct is the sgRNA of the sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

In another aspect of the invention, there is provided a plant cell, tissue or organ comprising an exogenous source of said down-regulator.

In a preferred embodiment, the plant cell, tissue or organ is not reproductive.

In another aspect of the invention, the application of the plant MYR1 is provided, wherein the application is used as a molecular marker for identifying the disease resistance of the plant or used as a molecular marker for directionally screening the plant.

In another aspect of the present invention, there is provided a method for targeted selection or identification of plants comprising: identifying expression or sequence characteristics of MYR1 in the test plant; if the MYR1 of the test plant is highly expressed, it is a pathogen-sensitive plant; if the MYR1 of the test plant is low or not expressed, the test plant is a plant with high disease resistance; such pathogens include (but are not limited to): fungi; preferably root fungi (fungi that infest plant roots); more preferably, the fungi include (but are not limited to): rice blast, rhizoctonia solani, flaxseed leaf spot, sclerotinia sclerotiorum, downy mildew and other fungal diseases.

In a preferred embodiment, the high expression or activity means that the expression or activity is statistically increased, such as increased by 10%, 20%, 40%, 60%, 80%, 90% or more, compared to the average expression or activity of the same or similar plants.

In another preferred embodiment, the low expression or activity means a statistically significant reduction in expression or activity, such as a reduction of 10%, 20%, 40%, 60%, 80%, 90% or less, compared to the average expression or activity in the same plant or species.

In another preferred embodiment, the disease resistance is statistically higher than the disease resistance of the same or similar plants, such as 10%, 20%, 40%, 60%, 80%, 90% or higher.

In another aspect of the present invention, there is provided a method of screening a substance (potential substance) that enhances disease resistance of plants, the method comprising: (1) adding a candidate substance to a system expressing MYR1; (2) Detecting the system, observing expression or activity of MYR1 therein, and if expression or activity is reduced (significantly reduced, e.g., by 10%, 20%, 40%, 60%, 80%, 90% or less), then the candidate substance is a substance that can be used to enhance disease resistance in plants.

In a preferred embodiment, the candidate substance includes (but is not limited to): further contemplated for MYR1 or a gene encoding it or a protein or gene upstream or downstream thereof, include a process selected from the group consisting of:

(a) The system also expresses a disease-resistant receptor complex; and (2) further comprises: observing the formation of a disease-resistant receptor complex in the system, and if the formation of the complex is promoted, indicating that the candidate substance is a substance capable of enhancing the disease resistance of the plant; wherein the disease-resistant receptor complex comprises: a complex of a disease-resistant receptor protein CEBiP and a receptor kinase CERK 1;

(b) The system also comprises an ROS generating system; and (2) further comprises: observing the generation situation of the ROS in the system, and if the generation of the ROS is promoted, indicating that the candidate substance is a substance for enhancing the disease resistance of the plant;

(c) The system also comprises a MAPK signal path; and (2) further comprises: observing the activation (phosphorylation) of MAPK in the system, and if the activation (phosphorylation) level of MAPK is promoted, indicating that the candidate substance is a substance for enhancing plant disease resistance; or

(d) The system also expresses disease-resistant genes; and (2) further comprises: observing the expression condition of the disease-resistant gene in the system, and if the expression of the disease-resistant gene is promoted, indicating that the candidate substance is a substance capable of enhancing the disease resistance of the plant; preferably, the disease resistance gene comprises: PR10, PBZ1 or CHITINASE.

In another preferred example, the method further comprises: and setting a control group without adding the candidate substance, so as to clearly distinguish the difference of MYR1 expression or activity in the test group from the control group, or the formation of a disease-resistant receptor complex, or ROS generation, MAPK activation, or expression of a disease-resistant gene.

In another preferred embodiment, the candidate substances include (but are not limited to): and (3) a regulatory molecule (such as an up-regulator, a down-regulator, a small molecule compound gene editing construct and the like) designed aiming at MYR1 or a coding gene thereof or an upstream or downstream protein or gene thereof.

Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

FIG. 1, osMYR1 affects blast resistance in roots.

(A) OSMYR1 affects rice blast resistance; the scale indicates 10mm.

(B-C) lesion length (B) and relative biomass (C) of the mutant rice Osmyr1-1 and Osmyr1-2 and wild type Nip rice after rice blast infection for 2 weeks (n is more than or equal to 10). Different letters indicate significant differences (ANOVA, dunnett multiple comparison; P < 0.05). The experiment was repeated three times and the results were consistent.

FIG. 2, osMYR1 influences disease-resistant signal output.

(A) In Osmyr1-1 and Osmyr1-2 mutants, CO8 induced production of higher amounts of ROS than in wild type. 1cm of rice root tips were treated with 1. Mu.M CO8 and the production of ROS was detected by Luminol chemiluminescence. Error bars represent standard errors (n = 10).

(B) Activation of MAPK in Osmyr1-1, osmyr1-2 and wild-type Nip rice roots. Rice roots were treated with 1. Mu.M chitin tetraglycan (CO 4) or chitin octaglycan (CO 8) for 10 minutes.

FIG. 3, zmUbiquitin, that OsMYR1-GFP overexpression weakens the rice blast resistance of rice roots.

(A) The rice blast germ is less infected at the roots of OsMYR1-GFP-9 and OsMYR1-GFP-13 than the wild type. Consistent results were obtained in all three replicates. The scale indicates 10mm.

(B) And carrying out statistics on the root length of OsMYR1-GFP-9, osMYR1-GFP-13 and wild type medium flower 11 after inoculation of rice blast for 2 weeks. Error bars represent standard errors for three technical replicates. The difference significance is detected by One-way ANOVA, different letters indicate that the difference is significant, and P is less than 0.05.

(C-D) lesion length (C) and relative biomass (D) of OsMYR1-GFP-9, osMYR1-GFP-13 and wild type mid-flower 11 rice 2 weeks after rice blast infection were counted. Error bars represent standard errors for three technical replicates. The difference significance is detected by one-way ANOVA, different letters indicate that the difference is significant, and P is less than 0.05.

(E) In OsMYR1-GFP-9 and OsMYR1-GFP-13 overexpression rice, the ROS amount generated by CO8 induction is higher than that of wild type rice. 1cm of rice root tips were treated with 1. Mu.M CO8 and the production of ROS was detected by Luminol chemiluminescence. Error bars represent standard errors (n = 10).

(F) Activation of MAPK in OsMYR1-GFP-9 and OsMYR1-GFP-13 overexpressing rice and wild type mid-flower 11 rice roots. Rice roots were treated with 1. Mu.M CO8 for 10 minutes or pre-treated with 1. Mu.M CO4/5 for 30 minutes followed by 1. Mu.M CO8 for 10 minutes.

(G) And detecting the relative expression amounts of three disease-resistant related marker genes, namely OsPR10, osPBZ1 and OsCHITINASE, in the OsMYR1-GFP-9 and OsMYR1-GFP-13 over-expressed rice and wild type middle flower 11 rice roots 2 weeks after rice blast inoculation. Error bars represent the standard deviation of triplicates of the technique.

FIG. 4, osMYR1 inhibits the formation of disease-resistant signal receptor complex.

(A) OsMYR1-GFP protein expressed in protoplasts inhibits the interaction of OsCEBiP-FLAG with OsCERK1-HA protein.

(B) The formation of MBP-OsCERK1 and His-OsCERK1 protein kinase domain homodimers is inhibited by expressing a purified His-OsMYR1 protein kinase domain in vitro.

(C) OsMYR1-GFP protein expressed in protoplasts inhibits the formation of OsCERK1-FLAG and OsCERK1-HA protein homodimers.

(D) The GST-OsMYR1 protein kinase domain purified in vitro inhibits MBP-OsCERK1 kinase domain from phosphorylating a substrate GST-OsGEF1 in vitro. Purified proteins for in vitro phosphorylation reactions and [ gamma- ³² P]ATP was detected using autoradiography.

Detailed Description

The inventor discovers through methods such as genetics, molecular biology and the like that a receptor MYR1 of gramineous plant sensing arbuscular mycorrhizal fungi has the function of negatively regulating and controlling the disease resistance of plant roots, the disease resistance of the plant roots can be increased when the expression quantity of the MYR1 is reduced, and the disease resistance of the plant roots can be weakened when the MYR1 is excessively expressed, so that the MYR1 is a negative regulation and control factor for regulating and controlling the disease resistance of plants, and a new way can be provided for improving the disease resistance of the plants by targeted regulation and control of the gene.

Gene and plant

As used herein, the "Myc-factor receiver 1 (MYR 1) gene" or "MYR1 polypeptide" refers to a MYR1 gene or polypeptide from rice, a gene or polypeptide that is homologous to a rice-derived gene or polypeptide, contains substantially the same domains, and has substantially the same function.

In the invention, the MYR1 polypeptide also comprises fragments, derivatives and analogues thereof. As used herein, the terms "fragment," "derivative," and "analog" refer to a fragment of a protein that retains substantially the same biological function or activity as the polypeptide in question, and may be (i) a protein in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a protein having a substituent group in one or more amino acid residues, or (iii) a protein in which an additional amino acid sequence is fused to the sequence of the protein, and the like. Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein. Biologically active fragments of the MYR1 polypeptides described may all be applied to the present invention.

In the present invention, the term "MYR1 polypeptide" refers to a protein of the sequence SEQ ID NO:2 having MYR1 polypeptide activity, and also includes homologues (homologous proteins) of the protein of this sequence.

The invention also encompasses polynucleotides (genes) encoding said polypeptides, for example polynucleotides of the nucleotide sequence shown in SEQ ID NO. 1 or degenerate sequences thereof, MYR1 polypeptides which can encode SEQ ID NO. 2, and also homologues (homologous genes) of the proteins of this sequence.

It will be appreciated that although the MYR1 gene of the invention is preferably obtained from the poaceae plant rice, other genes obtained from other plants that are highly homologous (e.g. have more than 80%, such as 85%, 90%, 95%, or even 98% sequence identity) to the rice MYR1 gene or that are degenerate to said gene are also within the contemplation of the invention. Methods and means for aligning sequence identity are also well known in the art, for example BLAST.

Vectors comprising such coding sequences, as well as host cells genetically engineered with such vectors or polypeptide coding sequences, are also encompassed by the invention. Methods well known to those skilled in the art can be used to construct vectors containing suitable expression vectors.

The host cell is typically a plant cell. Transformation of plants generally can be carried out by methods such as Agrobacterium transformation or biolistic transformation, for example, the leaf disc method, rice immature embryo transformation, etc.; the Agrobacterium method is preferred. Transformed plant cells, tissues or organs can be regenerated into plants by conventional methods to obtain plants with altered traits relative to the wild type.

As used herein, a "plant (including crop)" is a plant expressing MYR1 or a homologue thereof. The plant may comprise a monocotyledonous plant or a dicotyledonous plant; preferably, said plant is or said MYR1 is from a cereal crop; preferably, the cereal crop comprises graminaceous plants such as rice, graminaceous wheats such as wheat, graminaceous corn such as corn, and the like. Examples include: rice, sorghum, corn, barley, wheat, oats, rye. It will be appreciated that plants suitable for use in the present embodiments are not limited to those listed above, and that suitable plants may be identified by identifying the presence of a MYR1 homologue therein.

The "pathogen" is a "plant pathogen" and refers to a microorganism or the like which infects a plant, causes a disease of the plant, and in the present invention, it particularly refers to a pathogen which infects the root of a plant. For example, the pathogen includes a fungus; preferably, the fungi include Pyricularia oryzae and the like.

MYR1 down-regulator and application thereof

Based on the new findings of the present inventors, there is provided a method for improving disease resistance of plant roots, the method comprising: downregulating expression or activity of MYR1 in a plant. Wherein the improved trait comprises a trait selected from the group consisting of: increase the expression of disease-resistant genes and reduce the infection rate of pathogenic bacteria on the roots of plants.

The process of plant disease resistance requires multiple signaling pathways to transmit disease resistance signals, such as the generation of reactive oxygen species ROS and the activation of MAPK proteins. It is also desirable to promote the expression of many disease resistance-related genes to promote plant resistance to pathogenic pathogen invasion. In the research process, the inventor finds that after the expression level of MYR1 is reduced, the generation of ROS and the activation of MAPK when the roots of plants are infected by pathogenic bacteria are both obviously higher than those of wild plants, and the expression levels of disease-resistance related genes PR10, PBZ1 and CHITINASE are obviously improved. These findings of the present invention have not been reported in previous studies in the art.

It is understood that, based on the experimental data and the regulatory mechanisms provided herein, various methods may be used to modulate the ROS production, MAPK activation and PR10, PBZ1 and CHITINASE expression, which methods may be encompassed by the present invention. At the same time, the invention also creatively optimizes and obtains preparations and methods with excellent effects, such as detailed in the examples.

As used herein, the down-regulator of MYR1 or a gene encoding it includes inhibitors, antagonists, blockers, and the like, which terms are used interchangeably.

The MYR1 or the encoding gene down-regulator thereof refers to any substance which can reduce the activity of MYR1, reduce the stability of MYR1 or the encoding gene thereof, down-regulate the expression of MYR1, reduce the effective action time of MYR1, or inhibit the transcription and translation of MYR1 gene, and the substance can be used for the invention, and can be used for reducing MYR1, so that the substance can be used for enhancing the disease resistance of plants. For example, the down-regulating agent is: an interfering RNA molecule or antisense nucleotide that specifically interferes with MYR1 gene expression; is an antibody or ligand that specifically binds to a protein encoded by the MYR1 gene; and so on. They may be chemical compounds, small chemical molecules, biomolecules. The biomolecule may be at the nucleic acid level (including DNA, RNA) or at the protein level.

As a preferred mode of the invention, CRISPR/Cas (such as Cas 9) system is used for targeted gene editing, thereby knocking out/knocking down MYR1 gene in the region of targeted disease. Common methods for knocking-out/knocking-down MYR1 genes include: cotransforming a sgRNA or a nucleic acid capable of forming the sgRNA, a Cas9mRNA or a nucleic acid capable of forming the Cas9mRNA into a targeted region or a targeted cell. After the target site is determined, known methods can be employed to cause the sgRNA and Cas9 to be introduced into the cell. The nucleic acid capable of forming the sgRNA is a nucleic acid construct or an expression vector, or the nucleic acid capable of forming the Cas9mRNA is a nucleic acid construct or an expression vector, and these expression vectors are introduced into cells, so that active sgrnas and Cas9 mrnas are formed in the cells. Embodiments of the present invention provide particularly preferred intragenic editing agents that are particularly efficient in targeted mutagenesis of MYR1 to achieve appropriate and effective downregulation (e.g., downregulation 20-30%, 30-40%, downregulation 40-50%, downregulation 50-60%, downregulation 60-70%, downregulation 80-90%, or downregulation 90-100%).

As an alternative, the down-regulator may be an MYR 1-specific interfering RNA molecule (e.g., siRNA, shRNA, miRNA, etc.), and such an interfering RNA molecule may be prepared according to MYR1 sequence information provided in the present invention. Methods for making interfering RNA molecules include, but are not limited to: chemical synthesis, in vitro transcription, etc. The interfering RNA may be delivered into the cell by using an appropriate transfection reagent, or may also be delivered into the cell using a variety of techniques known in the art. RNAi is used to inhibit MYR1.RNAi is an evolutionarily conserved cellular defense mechanism for controlling the expression of foreign genes in most eukaryotes, including humans. RNAi is typically triggered by double-stranded RNA (dsRNA) and causes sequence-specific mRNA degradation of single-stranded target RNA. mediators of mRNA degradation are small interfering RNA duplexes (siRNAs), usually produced by enzymatic cleavage of long dsRNA within the cell. siRNAs are typically about 21 nucleotides in length (e.g., 21-23 nucleotides). After introduction of the small RNA or RNAi into the cell, this sequence is believed to be delivered to an enzyme complex called RISC (RNA-induced silencing complex). RISC recognizes the target and cleaves it with endonucleases. If a larger RNA sequence is delivered to the cell, the RNase III enzyme (Dicer) will convert the longer dsRNA into a ds-siRNA fragment of 21-23 nt.

As an alternative, shRNA technology can be used for interference. shRNA is an RNA sequence that can rotate a tight hairpin and can be used to silence gene expression through RNA interference. shRNA is always expressed using a vector introduced into a cell and a promoter. Such vectors are typically delivered to daughter cells to allow gene silencing to be inherited. The shRNA hairpin structure is cleaved by cellular machinery into siRNA, which is then combined with RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs matched to the siRNA it binds to. The shRNA is transcribed by RNA polymerase III.

As an alternative embodiment, MYR1 expression is modulated using an antisense compound that specifically hybridizes to one or more nucleic acids encoding MYR1. Specific hybridization of an oligomer to its target nucleic acid interferes with the normal function of the nucleic acid. Such modulation of the function of a target nucleic acid by a compound that specifically hybridizes to the target nucleic acid is commonly referred to as "antisense".

As an alternative, MYR1 can be specifically targeted for expression deficiency or deletion expression by homologous recombination. The Cre and loxp methods can also be used to selectively knock-out, reduce expression, or inactivate a gene of interest in the genome of an animal or cell.

As an alternative, the down-regulator is a small molecule compound directed against MYR1. Screening for such small molecule compounds may be performed using methods suitable for screening of small molecule compounds. The screening may rely on various compound libraries existing or to be developed in the art, or on their own to build some new compound libraries.

Plant improvement application

In the invention, the substances for improving the expression or activity of MYR1 in the plant comprise promoters, agonists and activators. The terms "up-regulation", "increase" and "promotion" include "up-regulation", "promotion" of protein activity or "up-regulation", "increase" and "promotion" of protein expression. Any substance that can increase the activity of a MYR1 protein, increase the stability of the MYR1 gene or a protein encoded by the MYR1 gene, up-regulate the expression of the MYR1 gene, and increase the effective action time of the MYR1 protein can be used in the present invention, and can be a useful substance for the MYR1 gene or a protein encoded by the MYR1 gene. They may be chemical compounds, chemical small molecules, biological molecules. The biomolecule may be at the nucleic acid level (including DNA, RNA) or at the protein level.

As another embodiment of the present invention, there is also provided a method of up-regulating expression of a MYR1 gene or a protein encoded thereby in a plant, comprising: the MYR1 gene or an expression construct or vector for the protein encoded by it is transferred into a plant.

The present invention also provides expression vectors, preferably plant expression vectors, comprising said regulatory molecules (in particular CRISPR editing agents such as preferred in embodiments of the present invention); more preferably an expression vector suitable for subsequent transgenic manipulations, such as those using Agrobacterium. The vector may be established using in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like.

The invention also provides genetically engineered host cells containing a gene editing molecule (particularly, e.g., a CRISPR editing agent as preferred in embodiments of the invention), an interfering molecule or silencer sequence or a vector comprising an interfering molecule or silencer sequence. The host cell is typically a plant cell. Transformation of plants generally can be carried out by Agrobacterium transformation or biolistic transformation, for example, leaf disk method, young embryo transformation, etc.

Plant directional screening or targeted screening regulation and control molecule

Based on the new discovery of the inventor, the invention also relates to a tracking marker for the progeny of a genetically transformed plant by using MYR1. The invention also relates to a method for early determining the disease resistance of the plant by detecting the expression condition or activity of MYR1 in the plant by using MYR1 as a molecular marker.

Accordingly, the present invention provides a method for specifically identifying disease resistance in a plant, comprising: and identifying MYR1 of the plant to be tested, and if MYR1 of the plant to be tested is low in expression or not expressed, determining that the plant is a plant with disease resistance.

The skilled artisan can perform nucleic acid sequence analysis or protein analysis using any of a variety of techniques known or in development in the art, which may be included in the present invention. Such methods include, for example, but are not limited to: sequencing, PCR amplification, probe, hybridization, restriction analysis, immunohistochemistry, and the like.

The disease resistance of the plant can be identified in the early planting stage or before planting, and great convenience can be brought to the plant breeding work.

After the function and molecular mechanism of MYR1 are known, the plant can be directionally screened based on the function and molecular mechanism. Potential substances for directionally regulating and controlling plant disease resistance by regulating MYR1 can also be screened based on the new finding.

The invention provides a method for screening potential substances for improving plant disease resistance, which comprises the following steps: (1) Treating an expression system expressing MYR1 with a candidate substance; and (2) detecting expression or activity of MYR1 in said system; if the candidate substance statistically reduces the expression or activity of MYR1, the candidate substance is a potential substance for improving the disease resistance of the plant.

Further, the system can be analyzed for the formation of a disease-resistant receptor complex, the production of ROS, the activation (phosphorylation) of MAPK or the expression of a disease-resistant gene (e.g., PR10, PBZ1 or CHITINASE), and the function of the candidate substance can be further analyzed.

A method of targeting a protein or a gene or a specific region thereof to screen a substance acting on the target can be used in the present invention. The candidate substance may be selected from: peptides, polymeric peptides, peptidomimetics, non-peptidic compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, nucleic acid sequences, and the like. Depending on the kind of the substance to be screened, it is clear to the skilled person how to select a suitable screening method.

Through large-scale screening, a class of potential substances which specifically act on MYR1 or a signal pathway involved in the MYR1 or genes related to upstream and downstream pathways of the MYR1 and have a regulation effect can be obtained.

The main advantages of the invention are:

the inventor deeply researches the action mechanism of MYR1 in the root of a plant for resisting pathogenic bacteria, finds that the receptor for sensing arbuscular mycorrhizal fungi in the plant can influence the disease resistance by competitively binding with a shared receptor kinase, and has very important reference significance for preventing and controlling the root disease of the plant.

The inventor deeply researches the action mechanism of MYR1 in influencing the transmission of disease-resistant signals of plants, and finds that MYR1 can influence the output of the disease-resistant signals by inhibiting the formation of a disease-resistant receptor complex, and has important application value in modifying the expression of plant root receptor kinase and finally improving the disease resistance of roots.

The invention provides a method for improving the disease resistance of plant roots, and provides a powerful tool for breeding and screening disease-resistant plants.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBrook et al, molecular cloning, A laboratory Manual, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

I. Materials and methods

1. Plant material

The inventor selects rice (Oryza sativa) wild Nipponbare to carry out corresponding CRISPR gene knockout. The rice mutants Osmyr1-1 and Osmyr1-2 used in the invention are taken as a Japanese sunny background. All materials were grown at 28 ℃ for 16h light/28 ℃ for 8h dark.

The rice mutant Osmyr1-1: using CRISPR construction, the sgRNA sequence is TGTACCGGACGCAGTCGCG (SEQ ID NO: 3), deleting a G at base 196, resulting in premature termination of the code.

The rice mutant Osmyr1-2: using CRISPR construction, the sgRNA sequence is GTCAGCGGAGGAAAACGCGG (SEQ ID NO: 4), and a C is deleted at 685 base, resulting in premature termination of the code.

2. Strains and cloning vectors

Coli for cloning: DH 5. Alpha., CCDB3.1 (E.coli DB3.1 competent strain);

and (3) agrobacterium: an EHA105;

the rice blast fungus strain: TH12;

plant CRISPR vector: sgRNA (intermediate vector pOs-sgRNA from Dianthus superbus laboratory of Beijing university), pH-Ubi-cas9-7 (Gene knockout).

An overexpression vector: pCAMBIA 1301)

3. Construction of recombinant plasmid

Firstly, complementary fusion is carried out by using a primer OsMYR1-F/OsMYR1-R, a PCR product is recovered and then is connected to a sgRNA vector pOs-sgRNA through BsaI enzyme digestion, escherichia coli is transformed, positive clone is identified, plasmid DNA is extracted, after sequencing verification, LR enzyme (purchased from Invitrogen) is connected to a pH-Ubi-cas9-7 transgenic vector, escherichia coli is transformed, positive clone is identified, and plasmid DNA is extracted for later use.

These recombinant plasmids are referred to as: sgRNA-OsMYR1 (OsMYR 1 inserted in sgRNA), and pH-Ubi-cas9-7-OsMYR1 (OsMYR 1 inserted in pH-Ubi-cas 9-7).

The primer sequences are as follows:

OsMYR1-F：GGCATGTACCGGACGCAGTCGCCG(SEQ ID NO:5)；

OsMYR1-R：AAACCGGCGACTGCGTCCGGTACA(SEQ ID NO:6)。

4. agrobacterium transformation

Preparation of Agrobacterium rhizogenes competent cell

(1) Culture media and solutions

Ultrapure water, LB medium, 10% glycerol (v/v).

(2) Competent preparation

Step 1: taking the preserved strain, streaking on LB plate containing corresponding antibiotic, and culturing at 28 deg.C for 24-48hrs;

step 2: selecting and inoculating the strain in 3mL LB liquid culture medium, shaking for a short time at 28 ℃, inoculating the strain into a non-resistant LB culture medium according to the following ratio of 1;

step 3: ice-cooling for 10min, and centrifuging at 4 deg.C for 10min at 2,500g;

step 4: removing supernatant, suspending the cells with 5mL ice-cold ultrapure water, adding 200mL ice-cold ultrapure water, centrifuging at 4 deg.C and 2,500g for 10min;

step 5: repeating Step 4 once;

step 6: removing supernatant, suspending the cells with 5mL of ice-cold 10% glycerol, adding 200mL of ice-cold 10% glycerol, and centrifuging at 4 deg.C and 2,500g for 10min;

step 7: repeating Step 6 once;

step 8: thoroughly removing supernatant, adding 50mL 10% glycerol, resuspending cells, and packaging with 200 μ L/tube;

step 9: and storing the frozen liquid nitrogen in a refrigerator at the temperature of 80 ℃ below zero for later use.

The expression vector is transferred into agrobacterium EHA105

Step 1: cleaning and drying the electric shock cup for later use, and meanwhile, taking the stored competence and melting on ice;

step 2: sucking 0.5-1 μ L of plasmid into competence, sucking gently, beating and mixing;

step 3: transferring the competent solution containing the plasmid into an electric shock cup, and carrying out electric shock on the competent solution by 1.6-1.8 kilovolt;

step 4: after the electric shock is finished, quickly washing the converted substance out of the EP tube by 600 mu L of non-resistant liquid LB, and resuscitating at 28 ℃ and 220rpm for 1 hr;

step 5: centrifuging at 4,000rpm for 2min, sucking out the excess supernatant, and reserving 50 μ L to resuspend the thallus and coating on LB plate containing corresponding antibiotics;

step 6: culturing at 28 deg.C for 24-48hrs, and picking single clone for identification.

Obtaining rice transgenic combined seedling

a. Rice seed germination

Taking rice seeds 7-10 days after flowering, and disinfecting according to the following steps:

1) Putting the seeds into a 100ml sterile triangular flask, and pouring 75% alcohol for disinfection for 5 minutes;

2) The alcohol was decanted, and an appropriate amount of sodium hypochlorite (NaClO) solution (sodium hypochlorite: water (V/V) = 1.5), soaking more than 90Min (time should not be too long);

3) Pouring out sodium hypochlorite solution, washing the seeds for 5-6 times by using sterile distilled water, putting the seeds on sterile filter paper, cutting out the embryos, and putting the embryos on an induction culture medium;

4) After the operation, the culture dish was sealed with a sealing film, and the culture was performed in a dark environment at 28 ℃ for about 6 days (the time depends on the size of the young embryo).

b. Agrobacterium (engineering bacterium) culture

Streaking the strain preserved at-70 deg.C with LB (or YEB) solid culture medium containing antibiotic to inoculate Agrobacterium strain, and static culturing at 28 deg.C for 2-3d. After 3d, single colony agrobacteria were scraped into LB (or YEB) and shaken overnight, the next day at 1: 50 proportion taking agrobacterium to shake culture for 4-5 h at 28 ℃ in AB culture medium. After centrifugation (5000 rpm/10 min), the OD600 was adjusted to around 0.4 using AAM (+ AS 20 mg/L) medium

c) Co-culture of infectious microbes

1) Inoculating the seeds cultured for 6 days into the agrobacterium tumefaciens suspension with the adjusted OD value for re-infection for 20 minutes, and shaking for several times during the re-infection;

2) Pouring out the bacterial liquid, taking out the callus, and placing on sterile filter paper to suck dry the surface bacterial liquid (1-2 h);

3) The callus was placed on the co-culture medium (a 9cm sterile filter paper was placed on top of the co-culture medium). Dark culture at 28 ℃ for 3 days.

d) Antibiotic selection of callus

1) The co-cultured callus was taken out, placed on sterile filter paper, roots were gently separated from the callus with forceps and a knife, finally placed on sterile filter paper, drained for several minutes, transferred into S1 medium (cut face down), and cultured in the dark at 28 ℃ for 7 days.

2) The calli were then transferred to S2 medium for selection and incubated in the dark at 28 ℃ for 10 days (at this point it was best to grow fresh granular calli on dead, dark old calli).

e) Induced differentiation and rooting of resistant callus

1) Inoculating the resistance callus obtained by screening into a pre-differentiation culture medium, and performing dark culture for 7 days at 28 ℃.

2) Transferring the pre-differentiated resistant callus into a differentiation medium (using a triangular flask instead), culturing in a light incubator for 15-30 days, and subculturing for 14 days.

3) When the plantlet grows to 2-3cm, cutting off the grown root, and transferring to rooting culture medium for rooting.

4) Hardening off the seedlings for 3-7 days and transplanting.

5. Data analysis platform and software

Sequence BLAST analysis: NCBI on-line analysis platform.

Sequence Alignment analysis: serialCloner 2.6.1 software.

Designing a primer: primer Premier 5.0 software.

6. MYR1 sequence

Nucleotide sequence of MYR1 (SEQ ID NO: 1):

ATGGAACACAAGGGTTTGTGCATCCTCGCCGTCGTCATCGCCTTCCAGCTCGCCGGCGGGGAGGCCGTCACCGATGCCACTGCCCGGGCACGTCGCTTCGCCTGTAACGTGTCGGCGCCGTGCGACACGTTCGTCGTGTACCGGACGCAGTCGCCGGGGTTCCTCGACCTCGGCAACATCTCGGACCTGTTCGGCGTGAGCCGGGCGCTGATCGCCAGCGCCAACAAGCTGACCACCGAGGACGGGGTGCTCCTGCCGGGGCAGCCGCTGCTCGTGCCGGTCAAGTGCGGCTGCACGGGCGCGCGCTCCTTCGCCAACGTCACGTACCCCATCCGGCCTCGCGACACCTTCTTCGGGCTCGCCGTCACCGCGTTCGAGAACCTCACCGACTTCGTCCTCGTCGAGGAGCTCAACCCGGCGGCGGAGGCGACCAGGCTGGAGCCGTGGCAGGAGGTCGTCGTGCCGCTCTTCTGCCGGTGCCCGACGCGGGAGGAGCTCAGCGCCGGGTCACGGCTCCTCGTCACCTACGTGTGGCAGCCCGGGGACGACGTGTCCGTGGTGAGCGCGCTGATGAACGCCTCCGCTGCCAACATCGCCGCGTCGAACGGCGTCGCGGGCAACTCCACCTTCGCGACGGGGCAGCCCGTGCTGATCCCGGTGTCGCAGCCGCCGCGTTTTCCTCCGCTGACCTACGGTGCCATCGCCGCCGATCCCGGAGCGGGCAAGCACCGCCACGGCATCATCGTGGCGACGAGCATCGCGGGGTCTTTCGTCGCGTGCGCCGTGCTGTGCACGGCGATCTTGGCGTACCGGAGGTACCGCAAGAAGGCGCCGGTGCCAAAGCACGTCAGCCCGAAGCTTTCTTGGACCAAGAGCCTGAACAGATTCGACAGCAATAGCTCCATTGCTCGCATGATCAATGGAGGGGACAAGCTGCTCACCAGCGTGTCGCAGTTCATCGACAAACCGATCATCTTTAGAGAGGAGGAAATCATGGAAGCGACGATGAACTTGGACGAACAGTGCAAGCTCGGCAGCTCGTATTACCGCGCGAACCTTGAAAGGGAGGTGTTCGCGGTGAAGCCGGCGAAAGGCAACGTTGCCGGGGAGCTGAGGATGATGCAGATGGTGAACCACGCCAACCTGACCAAGCTGGCCGGCATATCCATCGGCGCGGACGGCGACTACGCCTTCCTCGTGTACGAGTTCGCCGAGAAGGGCTCGCTTGACAAGTGGCTGTACCAGAAGCCGCCGTGCTCGCAGCCGTCGTCGAGCTCCGTGGCAACTCTGTCGTGGGACCAGAGGCTGGGCATCGCGCTGGACGTCGCGAACGGCTTGCTCTACCTGCACGAGCACACGCAGCCGAGCATGGTGCACGGCGACGTCCGTGCCCGGAACATCCTCCTCACCGCGGGCTTCAGGGCGAAGCTGTCCAACTTCTCCCTGGCCAAGCCGGCCGCCATGGTCGACGCGGCGGCGACGAGCAGCGACGTGTTCGCGTTCGGGCTGCTCCTCCTCGAGCTCCTCTCCGGGAGGAGGGCGGTGGAGGCGCGCGTCGGGGTGGAGATCGGCATGCTGCGGACGGAGATCCGCACCGTGCTGGACGCCGGCGGGGACAAGAGGGCGGCGAAGCTGAGGAAGTGGATGGACCCGACCCTCGGCGGTGAGTACGGCGTGGACGCGGCGCTCAGCTTGGCCGGCATGGCGAGGGCGTGCACCGAGGAGGACGCGGCGCGGCGGCCCAAGATGGCCGAGATCGCGTTCAGCCTCTCGGTGCTCGGACAGCCGCTGTCCGTCTCCGACGCGTTCGAGAGGCTATGGCAGCCCAGCTCGGAGGACAGCATCGGGATTGGGAACGAGGTGGCAGCTAGATAG

amino acid sequence of MYR1 (SEQ ID NO: 2):

MEHKGLCILAVVIAFQLAGGEAVTDATARARRFACNVSAPCDTFVVYRTQSPGFLDLGNISDLFGVSRALIASANKLTTEDGVLLPGQPLLVPVKCGCTGARSFANVTYPIRPRDTFFGLAVTAFENLTDFVLVEELNPAAEATRLEPWQEVVVPLFCRCPTREELSAGSRLLVTYVWQPGDDVSVVSALMNASAANIAASNGVAGNSTFATGQPVLIPVSQPPRFPPLTYGAIAADPGAGKHRHGIIVATSIAGSFVACAVLCTAILAYRRYRKKAPVPKHVSPKLSWTKSLNRFDSNSSIARMINGGDKLLTSVSQFIDKPIIFREEEIMEATMNLDEQCKLGSSYYRANLEREVFAVKPAKGNVAGELRMMQMVNHANLTKLAGISIGADGDYAFLVYEFAEKGSLDKWLYQKPPCSQPSSSSVATLSWDQRLGIALDVANGLLYLHEHTQPSMVHGDVRARNILLTAGFRAKLSNFSLAKPAAMVDAAATSSDVFAFGLLLLELLSGRRAVEARVGVEIGMLRTEIRTVLDAGGDKRAAKLRKWMDPTLGGEYGVDAALSLAGMARACTEEDAARRPKMAEIAFSLSVLGQPLSVSDAFERLWQPSSEDSIGIGNEVAAR

example II

Example 1 OsMYR1 Down-Regulation affects Rice blast resistance in Rice roots

The present inventors analyzed the resistance of wild type Nip and OsMYR1 mutant rice (Nip background) to Pyricularia oryzae (Magnaporthe oryzae) infection.

The rice blast germs are inoculated on the roots of the rice and cultured for 8 days at the temperature of 22 ℃ on a PDA solid medium. A 50ml plastic centrifuge tube was filled with 35 ml sterile wet vermiculite. The medium with the rice blast germs was placed inside and covered with another 5ml of vermiculite. Two sterilized rice seeds were placed on the second layer of vermiculite, followed by 5ml of vermiculite. The tubes were sealed and incubated (1800 lux, 16h light-8 h dark) at 22 ℃ for 2 to 3 weeks.

And (4) counting the length of disease spots and the relative biomass of rice blast germs on roots 14 days after the roots of Osmyr1 mutant rice and wild type Nipponbare rice are inoculated with rice blast.

The results show that the lesion length of the rice roots is significantly reduced after the OsMYR1 gene mutation compared with the wild rice (FIGS. 1A-B); meanwhile, the relative biomass of rice blast fungus in the root of mutant rice was significantly decreased (fig. 1C).

According to the results, the downmodulation of the OsMYR1 gene can remarkably enhance the resistance of rice to rice blast.

Example 2 Effect of OsMYR1 Down-Regulation on the output of disease-resistant signals

The inventor detects disease-resistant signal output of Osmyr1 mutant rice represented by MAPK phosphorylation and Reactive Oxygen Species (ROS) generation.

1. Changes in Reactive Oxygen Species (ROS)

The inventor uses 1 mu M CO8 to treat rice roots which germinate for a week, and detects the generation of ROS 15 minutes after CO8 treatment by a Luminol chemiluminescence method.

The results show that roots of the Osmyr1 mutant rice were able to produce more ROS after CO8 treatment than the wild type rice, as shown in fig. 2A.

2. Changes in MAPK phosphorylation

In addition, the inventors detected MAPK activation after CO8 treatment using a mitogen-activated protein kinase (MAPK) phosphorylation antibody, and detected when roots of one-week-sized rice seedlings were treated with 1. Mu.M CO 8.

The results showed that the MAPK phosphorylation level of the Osmyr1 mutant rice was significantly stronger than that of the wild type rice (fig. 2B).

The data show that when the OsMYR1 gene is down-regulated, the output of disease-resistant signals is remarkably enhanced.

Example 3 Effect of OsMYR1 overexpression on plant resistance to Rice blast

The inventor constructs an OsMYR1 overexpression vector ZmUbiquitin driven by a maize Ubiquitin promoter (ZmUbiquitin), namely OsMYR1-GFP, and transfers the OsMYR1-GFP into a middle flower 11 (ZH 11) plant to obtain an OsMYR1 overexpression transgenic plant.

Root lesion length was compared between the overexpressed transgenic plants (OsMYR 1-GFP-9, osMYR 1-GFP-13) and wild-type plant ZH 11. Statistical analysis of root lengths 2 weeks after inoculation with rice blast revealed that the root lengths of OsMYR1-GFP-9 and OsMYR1-GFP-13 were significantly shorter than those of the wild type (FIGS. 3A-B). The lesion length was counted 2 weeks after rice blast infection, and compared with the wild type, rice blast germs had significantly longer lesion lengths at the roots of OsMYR1-GFP-9 and OsMYR1-GFP-13, indicating that they were less resistant to the germs than the wild type (FIGS. 3A, C).

After 2 weeks of rice blast infection, the relative biomass of OsMYR1-GFP-9 and OsMYR1-GFP-13 on Pyricularia oryzae roots was counted and compared with that of the wild type. The results show that the germ biomass of over-expressed plants of OsMYR1-GFP-9 and OsMYR1-GFP-13 was greatly increased compared to the wild type (FIG. 3D).

Using the same method as in example 2, the present inventors examined the change in Reactive Oxygen Species (ROS) in OsMYR1 overexpressing plants compared to wild type. The results showed that CO8 induced higher amounts of ROS than wild type in OsMYR1-GFP-9 and OsMYR1-GFP-13 overexpressing rice (FIG. 3E).

Using the same method as in example 2, the inventors tested OsMYR1 overexpressing plants for changes in MAPK phosphorylation compared to wild type. The results show that the level of phosphorylation (activation) of MAPK in OsMYR1-GFP-9 and OsMYR1-GFP-13 overexpressing rice as well as in wild type flower 11 rice roots is significantly reduced (fig. 3F).

The inventor utilizes qRT-PCR to detect the relative expression amounts of three disease-resistant related marker genes, namely OsPR10, osPBZ1 and OsCHITINASE, in OsMYR1-GFP-9 and OsMYR1-GFP-13 over-expressed rice and wild type middle flower 11 rice roots 2 weeks after rice blast inoculation. The results show that the expression of three disease-resistant related marker genes, namely OsPR10, osPBZ1 and OsCHITINASE, is remarkably reduced in OsMYR1 overexpression plants (FIG. 3G).

The results show that the OsMYR1 overexpression obviously weakens the resistance of rice roots to rice blast, and the OsMYR1 is a negative regulation factor for regulating and controlling the disease resistance of rice.

Example 4 molecular mechanism of OsMYR1 participating in disease resistance regulation of rice roots

The inventor analyzes the molecular mechanism of OsMYR1 participating in the regulation and control of the disease resistance of rice roots.

Protein interaction assays showed that OsMYR1-GFP protein expressed in protoplasts inhibited the interaction of OsCEBiP-FLAG with OsCERK1-HA protein (FIG. 4A).

And expressing the purified His-OsMYR1 protein kinase domain (amino acid sequence 270-634) in vitro to inhibit formation of MBP-OsCERK1 and His-OsCERK1 protein kinase domain homodimers (FIG. 4B).

Protein interaction assays showed that OsMYR1-GFP protein expressed in protoplasts inhibited the formation of OsCERK1-FLAG and OsCERK1-HA protein homodimers (FIG. 4C).

And the GST-OsMYR1 protein kinase structural domain (the amino acid sequence of the GST-OsCERK 1 protein kinase structural domain is from 270 th position to 634 th position) purified in vitro inhibits the MBP-OsCERK1 kinase structural domain from phosphorylating a substrate GST-OsGEF1 in vitro.

Thus, osMYR1 inhibits the formation of an anti-disease signal receptor complex.

Discussion of the preferred embodiments

The symbiotic signaling molecule CO4 and the receptor OsMYR1 have the function of inhibiting immune signals, and the CO4 and the OsMYR1 can weaken the output of the immune signals by inhibiting the formation of a disease-resistant related receptor complex OsCEBiP-OsCERK 1.

The down regulation of the OsMYR1 gene is beneficial to improving the resistance of the rice roots to the pathogenic fungi rice blast. When the OsMYR1 protein is deleted, the length of disease spots and the relative biomass of rice blast after the rice is inoculated with rice blast are smaller than those of a wild type. The Osmyr1 mutant rice can cause stronger immune response after being treated by an immune signal molecule CO 8.

During the symbiosis of arbuscular mycorrhizal fungi, chitin CO8 derived from the cell wall of arbuscular mycorrhizal fungi can be recognized as a pathogen-associated molecular pattern (PAMP) with the potential to activate the plant's defense response. However, no strong defence response of the plant was observed to be activated during the establishment of the arbuscular mycorrhizal fungi symbiosis. The research of the inventor shows that the receptor OsMYR1 of the mycorrhizal factor CO4 not only can be used as a sensor of external signals, but also can be used as an inhibitor of plant immune signals. Accordingly, CO4 secreted by arbuscular mycorrhizal fungi can also act as an inhibitor during the PTI stage of plant immunity to suppress the plant's immune response.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes or modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the appended claims of the present application.

Sequence listing

<110> China academy of sciences molecular plant science remarkable innovation center

Application of <120> MYR1 in improving disease resistance of gramineous plants

<130> 211670

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1875

<212> DNA

<213> Oryza sativa L.

<400> 1

atggaacaca agggtttgtg catcctcgcc gtcgtcatcg ccttccagct cgccggcggg 60

gaggccgtca ccgatgccac tgcccgggca cgtcgcttcg cctgtaacgt gtcggcgccg 120

tgcgacacgt tcgtcgtgta ccggacgcag tcgccggggt tcctcgacct cggcaacatc 180

tcggacctgt tcggcgtgag ccgggcgctg atcgccagcg ccaacaagct gaccaccgag 240

gacggggtgc tcctgccggg gcagccgctg ctcgtgccgg tcaagtgcgg ctgcacgggc 300

gcgcgctcct tcgccaacgt cacgtacccc atccggcctc gcgacacctt cttcgggctc 360

gccgtcaccg cgttcgagaa cctcaccgac ttcgtcctcg tcgaggagct caacccggcg 420

gcggaggcga ccaggctgga gccgtggcag gaggtcgtcg tgccgctctt ctgccggtgc 480

ccgacgcggg aggagctcag cgccgggtca cggctcctcg tcacctacgt gtggcagccc 540

ggggacgacg tgtccgtggt gagcgcgctg atgaacgcct ccgctgccaa catcgccgcg 600

tcgaacggcg tcgcgggcaa ctccaccttc gcgacggggc agcccgtgct gatcccggtg 660

tcgcagccgc cgcgttttcc tccgctgacc tacggtgcca tcgccgccga tcccggagcg 720

ggcaagcacc gccacggcat catcgtggcg acgagcatcg cggggtcttt cgtcgcgtgc 780

gccgtgctgt gcacggcgat cttggcgtac cggaggtacc gcaagaaggc gccggtgcca 840

aagcacgtca gcccgaagct ttcttggacc aagagcctga acagattcga cagcaatagc 900

tccattgctc gcatgatcaa tggaggggac aagctgctca ccagcgtgtc gcagttcatc 960

gacaaaccga tcatctttag agaggaggaa atcatggaag cgacgatgaa cttggacgaa 1020

cagtgcaagc tcggcagctc gtattaccgc gcgaaccttg aaagggaggt gttcgcggtg 1080

aagccggcga aaggcaacgt tgccggggag ctgaggatga tgcagatggt gaaccacgcc 1140

aacctgacca agctggccgg catatccatc ggcgcggacg gcgactacgc cttcctcgtg 1200

tacgagttcg ccgagaaggg ctcgcttgac aagtggctgt accagaagcc gccgtgctcg 1260

cagccgtcgt cgagctccgt ggcaactctg tcgtgggacc agaggctggg catcgcgctg 1320

gacgtcgcga acggcttgct ctacctgcac gagcacacgc agccgagcat ggtgcacggc 1380

gacgtccgtg cccggaacat cctcctcacc gcgggcttca gggcgaagct gtccaacttc 1440

tccctggcca agccggccgc catggtcgac gcggcggcga cgagcagcga cgtgttcgcg 1500

ttcgggctgc tcctcctcga gctcctctcc gggaggaggg cggtggaggc gcgcgtcggg 1560

gtggagatcg gcatgctgcg gacggagatc cgcaccgtgc tggacgccgg cggggacaag 1620

agggcggcga agctgaggaa gtggatggac ccgaccctcg gcggtgagta cggcgtggac 1680

gcggcgctca gcttggccgg catggcgagg gcgtgcaccg aggaggacgc ggcgcggcgg 1740

cccaagatgg ccgagatcgc gttcagcctc tcggtgctcg gacagccgct gtccgtctcc 1800

gacgcgttcg agaggctatg gcagcccagc tcggaggaca gcatcgggat tgggaacgag 1860

gtggcagcta gatag 1875

<210> 2

<211> 624

<212> PRT

<213> Oryza sativa L.

<400> 2

Met Glu His Lys Gly Leu Cys Ile Leu Ala Val Val Ile Ala Phe Gln

1 5 10 15

Leu Ala Gly Gly Glu Ala Val Thr Asp Ala Thr Ala Arg Ala Arg Arg

20 25 30

Phe Ala Cys Asn Val Ser Ala Pro Cys Asp Thr Phe Val Val Tyr Arg

35 40 45

Thr Gln Ser Pro Gly Phe Leu Asp Leu Gly Asn Ile Ser Asp Leu Phe

50 55 60

Gly Val Ser Arg Ala Leu Ile Ala Ser Ala Asn Lys Leu Thr Thr Glu

65 70 75 80

Asp Gly Val Leu Leu Pro Gly Gln Pro Leu Leu Val Pro Val Lys Cys

85 90 95

Gly Cys Thr Gly Ala Arg Ser Phe Ala Asn Val Thr Tyr Pro Ile Arg

100 105 110

Pro Arg Asp Thr Phe Phe Gly Leu Ala Val Thr Ala Phe Glu Asn Leu

115 120 125

Thr Asp Phe Val Leu Val Glu Glu Leu Asn Pro Ala Ala Glu Ala Thr

130 135 140

Arg Leu Glu Pro Trp Gln Glu Val Val Val Pro Leu Phe Cys Arg Cys

145 150 155 160

Pro Thr Arg Glu Glu Leu Ser Ala Gly Ser Arg Leu Leu Val Thr Tyr

165 170 175

Val Trp Gln Pro Gly Asp Asp Val Ser Val Val Ser Ala Leu Met Asn

180 185 190

Ala Ser Ala Ala Asn Ile Ala Ala Ser Asn Gly Val Ala Gly Asn Ser

195 200 205

Thr Phe Ala Thr Gly Gln Pro Val Leu Ile Pro Val Ser Gln Pro Pro

210 215 220

Arg Phe Pro Pro Leu Thr Tyr Gly Ala Ile Ala Ala Asp Pro Gly Ala

225 230 235 240

Gly Lys His Arg His Gly Ile Ile Val Ala Thr Ser Ile Ala Gly Ser

245 250 255

Phe Val Ala Cys Ala Val Leu Cys Thr Ala Ile Leu Ala Tyr Arg Arg

260 265 270

Tyr Arg Lys Lys Ala Pro Val Pro Lys His Val Ser Pro Lys Leu Ser

275 280 285

Trp Thr Lys Ser Leu Asn Arg Phe Asp Ser Asn Ser Ser Ile Ala Arg

290 295 300

Met Ile Asn Gly Gly Asp Lys Leu Leu Thr Ser Val Ser Gln Phe Ile

305 310 315 320

Asp Lys Pro Ile Ile Phe Arg Glu Glu Glu Ile Met Glu Ala Thr Met

325 330 335

Asn Leu Asp Glu Gln Cys Lys Leu Gly Ser Ser Tyr Tyr Arg Ala Asn

340 345 350

Leu Glu Arg Glu Val Phe Ala Val Lys Pro Ala Lys Gly Asn Val Ala

355 360 365

Gly Glu Leu Arg Met Met Gln Met Val Asn His Ala Asn Leu Thr Lys

370 375 380

Leu Ala Gly Ile Ser Ile Gly Ala Asp Gly Asp Tyr Ala Phe Leu Val

385 390 395 400

Tyr Glu Phe Ala Glu Lys Gly Ser Leu Asp Lys Trp Leu Tyr Gln Lys

405 410 415

Pro Pro Cys Ser Gln Pro Ser Ser Ser Ser Val Ala Thr Leu Ser Trp

420 425 430

Asp Gln Arg Leu Gly Ile Ala Leu Asp Val Ala Asn Gly Leu Leu Tyr

435 440 445

Leu His Glu His Thr Gln Pro Ser Met Val His Gly Asp Val Arg Ala

450 455 460

Arg Asn Ile Leu Leu Thr Ala Gly Phe Arg Ala Lys Leu Ser Asn Phe

465 470 475 480

Ser Leu Ala Lys Pro Ala Ala Met Val Asp Ala Ala Ala Thr Ser Ser

485 490 495

Asp Val Phe Ala Phe Gly Leu Leu Leu Leu Glu Leu Leu Ser Gly Arg

500 505 510

Arg Ala Val Glu Ala Arg Val Gly Val Glu Ile Gly Met Leu Arg Thr

515 520 525

Glu Ile Arg Thr Val Leu Asp Ala Gly Gly Asp Lys Arg Ala Ala Lys

530 535 540

Leu Arg Lys Trp Met Asp Pro Thr Leu Gly Gly Glu Tyr Gly Val Asp

545 550 555 560

Ala Ala Leu Ser Leu Ala Gly Met Ala Arg Ala Cys Thr Glu Glu Asp

565 570 575

Ala Ala Arg Arg Pro Lys Met Ala Glu Ile Ala Phe Ser Leu Ser Val

580 585 590

Leu Gly Gln Pro Leu Ser Val Ser Asp Ala Phe Glu Arg Leu Trp Gln

595 600 605

Pro Ser Ser Glu Asp Ser Ile Gly Ile Gly Asn Glu Val Ala Ala Arg

610 615 620

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> sgRNA

<400> 3

tgtaccggac gcagtcgccg 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(20)

<223> sgRNA

<400> 4

gtcagcggag gaaaacgcgg 20

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(24)

<223> primer

<400> 5

ggcatgtacc ggacgcagtc gccg 24

<210> 6

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<221> misc_feature

<222> (1)..(24)

<223> primer

<400> 6

aaaccggcga ctgcgtccgg taca 24

Claims (16)

1. Use of a down regulator of MYR1 for enhancing disease resistance in graminaceous plants; or, the preparation can be used for preparing preparations for enhancing plant disease resistance.

2. The use of claim 1, wherein the downregulating comprises: an agent that knocks out or silences MYR1, an agent that inhibits MYR1 activity; preferably, the down-regulating agent comprises: a CRISPR gene editing reagent, homologous recombination reagent, or site-directed mutagenesis reagent for MYR1 that performs a loss-of-function mutation on MYR1; or, an interfering molecule that specifically interferes with expression of a gene encoding MYR1.

3. A method for enhancing disease resistance in graminaceous plants comprising: downregulating expression or activity of MYR1 in a plant.

4. The method of claim 3, wherein downregulating expression or activity of MYR1 in the plant comprises: knocking out or silencing a gene encoding MYR1, or inhibiting MYR1 activity in a plant; preferably, said gene encoding a knockout or silencing MYR1 in a plant comprises:

performing gene editing with a CRISPR system to knock out a coding gene of MYR1;

knocking out a coding gene of MYR1 by a homologous recombination method;

silencing MYR1 with an interfering molecule that specifically interferes with expression of a gene encoding MYR1; or the like, or, alternatively,

MYR1 was subjected to loss-of-function mutation in a MYR 1-containing plant.

5. The method of claim 4, wherein the method comprises: performing gene editing by a CRISPR method to knock out a coding gene of MYR1; preferably, targeting MYR1 encoding gene position 196, deletion of base G at position 196 results in premature termination of protein translation; alternatively, targeting MYR1 encoding gene at position 685, deletion of base C at position 685 results in premature termination of protein translation.

6. The method of any one of claims 1-5, wherein MYR1 exerts a negative regulatory effect by inhibiting the formation of an anti-disease receptor complex affecting the output of an anti-disease signal, and MYR1 reverses the negative regulatory effect; wherein the disease-resistant receptor complex comprises: a complex of a disease-resistant receptor protein CEBiP and a receptor kinase CERK 1; or

The MYR1 down regulator increases ROS production when a plant is infested; or

The MYR1 down-regulator increases MAPK activation when the plant-improving agent is infected; or

Expression of the MYR1 down regulator disease resistance gene; preferably, the disease resistance gene comprises: PR10, PBZ1 or CHITINASE.

7. The plant of any one of claims 1-5, wherein said grass comprises or said MYR1 is from the group comprising: the method comprises the following steps: rice, wheat, millet, corn, sorghum, millet, barley, rye, oat, brachypodium distachyon and sugarcane.

8. The method of any one of claims 1 to 5, wherein the disease resistance is a plant resistance to pathogens comprising: fungi; preferably a root fungus; more preferably, the fungi include: rice blast, rhizoctonia solani, flaxseed leaf spot, sclerotinia sclerotiorum, downy mildew and other fungal diseases.

9. The method of any one of claims 1-5, wherein the MYR1 comprises:

(a) 2, or a polypeptide of the amino acid sequence shown in SEQ ID NO;

(b) 2 through one or more amino acid residue substitution, deletion or addition, and has (a) polypeptide derived from (a) polypeptide function;

(c) A polypeptide having an amino acid sequence which is 80% identical or more to the amino acid sequence defined in (a) and having the function of the polypeptide of (a); or

(d) 2 having (a) the function of the polypeptide; preferably including the protein kinase domain thereof.

10. A down-regulator of MYR1 for enhancing plant disease resistance, which is a CRISPR gene editing agent; preferably, it is targeted at position 196 or 685 of the gene coding for MYR1, with a mutation in G or C.

11. The downregulator of claim 10, which is a sgRNA construct, the sequence of the sgRNA being that of SEQ ID NO. 3 or SEQ ID NO. 4.

12. A plant cell, tissue or organ comprising an exogenous down-regulator according to claim 10 or 11.

13. The application of the plant MYR1 is used as a molecular marker for identifying the disease resistance of plants or used as a molecular marker for directionally screening the plants.

14. A method of targeted selection or identification of plants comprising: identifying expression or sequence characteristics of MYR1 in the test plant; if the MYR1 of the test plant is high, the test plant is a pathogen-sensitive plant; if MYR1 of the test plant is low-expressed or not expressed, the test plant is a plant with high disease resistance; the pathogens include: fungi; preferably a root fungus; more preferably, the fungi include: rice blast, rhizoctonia solani, leaf spot of flax, sclerotinia sclerotiorum, downy mildew and other fungal diseases.

15. A method for screening a substance that enhances disease resistance of a plant, the method comprising:

(1) Adding a candidate substance into a system expressing MYR1;

(2) And detecting the system, observing expression or activity of MYR1 in the system, and if the expression or activity is reduced, indicating that the candidate substance is a substance for enhancing plant disease resistance.

16. The method of claim 15, further comprising a process selected from the group consisting of:

(a) The system also expresses a disease-resistant receptor complex; and (2) further comprises: observing the formation of a disease-resistant receptor complex in the system, and if the formation of the complex is promoted, indicating that the candidate substance is a substance for enhancing the disease resistance of the plant; wherein the anti-disease receptor complex comprises: a complex of a disease-resistant receptor protein CEBiP and a receptor kinase CERK 1;

(b) (1) the system also comprises a ROS generating system; and (2) further comprises: observing the generation situation of the ROS in the system, and if the generation of the ROS is promoted, indicating that the candidate substance is a substance for enhancing the disease resistance of the plant;

(c) The system also comprises a MAPK signal path; and (2) further comprises: observing the activation condition of MAPK in the system, and if the activation level of MAPK is promoted, indicating that the candidate substance is a substance capable of enhancing the disease resistance of plants; or

(d) The disease-resistant gene is also expressed in the system; and (2) further comprises: observing the expression condition of the disease-resistant gene in the system, and if the expression of the disease-resistant gene is promoted, indicating that the candidate substance is a substance capable of enhancing the disease resistance of the plant; preferably, the disease resistance gene comprises: PR10, PBZ1 or CHITINASE.

Images