CN104928307A - Tumorous stem mustard myrosinase gene MYR1, tumorous stem mustard myrosinase and tumorous stem mustard myrosinase gene engineering expression method - Google Patents
Tumorous stem mustard myrosinase gene MYR1, tumorous stem mustard myrosinase and tumorous stem mustard myrosinase gene engineering expression method Download PDFInfo
- Publication number
- CN104928307A CN104928307A CN201510407304.4A CN201510407304A CN104928307A CN 104928307 A CN104928307 A CN 104928307A CN 201510407304 A CN201510407304 A CN 201510407304A CN 104928307 A CN104928307 A CN 104928307A
- Authority
- CN
- China
- Prior art keywords
- tumorous stem
- stem mustard
- myrosinase
- myr1
- sulphur
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a tumorous stem mustard myrosinase gene MYR1, tumorous stem mustard myrosinase and a tumorous stem mustard myrosinase gene engineering expression method. The nucleotide sequence of the tumorous stem mustard myrosinase gene MYR1 is shown as SEQ ID NO.1; the amino acid sequence of the tumorous stem mustard myrosinase is shown as SEQ ID NO.2. The tumorous stem mustard myrosinase gene engineering expression method comprises the steps that the total RNA in a tumorous stem mustard leaf is extracted; the myrosinase gene MYR1 is amplified through the RT-PCR method, an expression vector is established, a pichia pastoris expression system is adopted for conducting expression, a Sal I restriction enzyme cutting site linearized vector is transformed into a pichia pastoris genome, geneticin resistance transformants are screened out through G418 resistance, and methyl alcohol is used for conducting inducible expression. Through electrophoretic analysis, a recon can conduct expression, the molecular weight of expression proteins is 90 KDa, the specific activity of the purified proteins is measured, and the specific activity of the tumorous stem mustard myrosinase is approximately equal to 0.003 U/mu L.
Description
Technical field
The invention belongs to sulphur glycosides zymotechnic field, be specifically related to a kind of tumorous stem mustard sulphur glycoside enzyme gene MYR1, tumorous stem mustard sulphur glycosides enzyme and gene engineering expression method thereof.
Background technology
There are a kind of very important defensive ferment and sulphur glycosides enzyme (Myrosinase) in cress, are also referred to as meson enzyme; Sulphur glycosides enzyme can be degraded sulphur glycosides, comprises the materials such as glucose, vitriol, isothiocyanate, thiocyanate-in degraded product; Wherein isothiocyanate has the effect such as anti-inflammatory, preventing cancer; Sulphur glycosides enzyme usually exists with the form of isozyme, and these isozymes cause its physical properties, chemical property different due to glycosylated degree difference.Current discovery, sulphur glycosides enzyme has encoding gene family MA(Myr1, the TGG1 of 3 types at least), MB (Myr2, TGG2), MC (Myr3, TGG3), research shows that MA gene family has 4-5 gene, and the sulphur glycosides enzyme of its coding is solubility dipolymer.MB gene family comprises 10-15 gene, and MC gene family is by 5 genomic constitutions, and the sulphur glycosides enzyme of MB and MC gene family coding is soluble mixture.
At present done a lot of research to the character of sulphur glycosides enzyme, extracting method in the world, first the Separation Research for sulphur glycosides enzyme will be mentioned Bjorkman and equal in sinapsis alba seed, to be extracted sulphur glycosides enzyme in 1972, and has carried out purifying to it; And then the character to the method for purification of sulphur glycosides enzyme and sulphur glycosides enzyme such as Ohtsuru is studied; The people such as Xian Li have also extracted sulphur glycosides enzyme in the middle of horseradish, and are separated; Bones etc. were separated in 1989 and obtain sulphur glycosides enzyme in the middle of Brassica Napus Seedling; But sulphur resources in plant is usually lower, extracting directly can not obtain sulphur glycosides enzyme in a large number.
For studying the character of sulphur glycosides enzyme better, sulphur glycoside enzyme gene to be cloned in yeast by transgenic technology and to express by Chen and Barbara, but the enzyme of expressing is poisonous to yeast, can not great expression.Current domestic scholars mainly from radish, rape, Arabidopis thaliana, leaf mustard, Caulis et Folium Brassicae capitatae, extracts sulphur glycoside enzyme gene and construction of expression vector is expressed; Build recombinant expression plasmid after such as Xiao Haiyan in 2008 etc. extract sulphur glycoside enzyme gene from rape and in intestinal bacteria abduction delivering, obtain the protein band of about 90KDa; Beam Jin Feng in 2010 etc. extract sulphur glycoside enzyme gene and express in pichia spp from Caulis et Folium Brassicae capitatae, obtain the protein band of 65KDa size; The people such as Zhang Wei in 2012 from swede type rape, extract sulphur glycoside enzyme gene and carrier construction is expressed; But do not have at present extract sulphur glycoside enzyme gene from tumorous stem mustard, and carry out the correlative study that vector construction expresses tumorous stem mustard sulphur glycosides enzyme.
Summary of the invention
For prior art above shortcomings, the object of this invention is to provide a kind of tumorous stem mustard sulphur glycoside enzyme gene MYR1.
Another object of the present invention is to provide a kind of tumorous stem mustard sulphur glycosides enzyme.
Another object of the present invention is to provide the gene engineering expression method of above-mentioned tumorous stem mustard sulphur glycosides enzyme.
Realize above-mentioned purpose, the present invention by the following technical solutions: a kind of tumorous stem mustard sulphur glycoside enzyme gene MYR1, its nucleotides sequence is classified as the sequence shown in SEQ ID NO.1.
A kind of tumorous stem mustard sulphur glycosides enzyme, its aminoacid sequence is the sequence shown in SEQ ID NO.2.
A gene engineering expression method for above-mentioned tumorous stem mustard sulphur glycosides enzyme, comprises the steps:
1) get tumorous stem mustard blade, extract total serum IgE;
2) total serum IgE extracted with step 1), for template, by reverse transcription reaction in PCR instrument, synthesizes the first chain cDNA;
3) compare the nucleotide sequence of rape and leaf mustard sulphur glycoside enzyme gene, design a pair forward and reverse primer, described primer is:
Upper primer 1:
5’- GATCCGGTTCTGGCGAATTCGACGACGACGACAAGGATGAAGAAATCAC -3’；
Upper primer 2:
5’- CGACGACGACAAGGATGAAGAAATCACATGTGAAGAAAATAACC-3’；
Lower primer:
5’-GGCGAATTAATTCGCGGCCGCTTATTAAGCATCTGCGAAACGCTTCTTTTG -3’；
4) with step 2) the first chain cDNA of synthesizing is template, adopt the primer designed by step 3), carry out PCR reaction, amplification obtains the full length sequence of sulphur glycoside enzyme gene MYR1, and the nucleotides sequence of described sulphur glycoside enzyme gene MYR1 is classified as shown in SEQ ID NO.1;
5) carrier pPIC9K-S plasmid is extracted, and with plasmid described in EcoR I and NotI double digestion;
6) expression vector after the sulphur glycoside enzyme gene MYR1 of step 4) acquisition and step 5) double digestion is hybridized, obtain recombinant expression vector pPIC9K-S-MYR1;
7) by step 6) recombinant expression vector transformed competence colibacillus cell E. coli DH10B, the cell after transforming is being cultivated 18 hours in 37 DEG C containing on the LB flat board of ammonia benzyl resistance, is checking order through PCR evaluation and screening positive colony bacterium;
8) positive colony checking order correct by step 7) is cultivated, and extracts plasmid, adopts Sal I single endonuclease digestion linearization process, transforms for pichia spp SMD1168 electricity;
9) by the recombinant expression vector pPIC9K-S-MYR1 of Sal I single endonuclease digestion linearization process, electricity is transformed into pichia spp SMD1168, and coating MD is dull and stereotyped cultivates 3-6 days in 30 DEG C, and by G418 resistance, screening obtains geneticin resistant transformant;
10) mono-clonal of picking geneticin resistant transformant is to YPD culture medium culturing, under 28 DEG C of conditions, with the rotating speed jolting of 300 rpm/h to OD600 value between 2-5, centrifugal abandoning supernatant, to precipitation in add BMMY liquid nutrient medium re-suspended cell; Utilize methyl alcohol continuous induction to express, it is 0.5% to continue induction that every 24 hours of period added methyl alcohol to the final volume concentration of methyl alcohol, after inducing 72 h, utilizes the expression of the SDS-PAGE Analysis and Identification recombinant protein of coomassie brilliant blue staining.
Compared to existing technology, the present invention has following beneficial effect:
1, the content of tumorous stem mustard sulphur glycosides enzyme in tumorous stem mustard is considerably less, in tumorous stem mustard, extracting directly sulphur glycosides enzyme has certain difficulty, and natural sulphur glycosides enzyme has glycosylation modified effect, prokaryotic expression product lacks sulphur glycosides enzymic activity, therefore glycosylation modifiedly has a significant impact for sulphur glycosides enzyme enzymic activity; The present invention selects pichia spp to be expression system, in the processing of expression product, external secretion, translation, modification and glycosylation etc., there is very large advantage, and pichia spp has alcohol oxidase AOX1 gene promoter, can grow fast in the substratum taking methyl alcohol as sole carbon source, be very beneficial for the purifying of tumorous stem mustard sulphur glycosides enzyme.
2, the present invention compares the nucleotide sequence of the plant such as rape, leaf mustard sulphur glycoside enzyme gene, choose the region that homology is higher, design a pair forward and reverse primer, with the first chain cDNA of tumorous stem mustard for template, the sulphur glycoside enzyme gene MYR1 of amplification tumorous stem mustard, and build recombinant expression vector pPIC9K-S-MYR1, electricity is transformed into pichia spp SMD1168, be cloned in yeast expression vector by sulphur glycoside enzyme gene MYR1, express and obtain tumorous stem mustard sulphur glycosides enzyme, molecular weight is 90 KDa.
3, the present invention adopts the tumorous stem mustard sulphur glycosides enzyme after expression and purification, with Sinigrin sinigrin for substrate, measures the activity of recombinant protein, result shows at 45 DEG C, albumen expressed by recon can be hydrolyzed sulphur glycosides, and show the biological activity of sulphur glycosides enzyme, Rate activity is about 0.03U/mL.
4, recon of the present invention can great expression tumorous stem mustard sulphur glycosides enzyme, and compared to the method for extracting directly, the present invention has more economic worth, has good marketing prospect.
Accompanying drawing explanation
Fig. 1 is tumorous stem mustard leaf total serum IgE electrophoresis detection figure;
Fig. 2 is the RT-PCR amplification figure of sulphur glycoside enzyme gene;
Fig. 3 is that tumorous stem mustard sulphur glycoside enzyme gene sequence B LASTX schemes;
Fig. 4 is tumorous stem mustard sulphur glycosides enzyme amino acid comparison figure;
Fig. 5 is the SDS-PAGE figure of expression product;
Fig. 6 is the fusion rotein electrophorogram after purifying;
Fig. 7 is the HPLC figure detecting sulphur resources after determination of activity.
Embodiment
Below in conjunction with specific embodiments and the drawings, the present invention is described in further detail.
The tumorous stem mustard (Brassica juncea (L.) Czern. et Coss. var. tumida Tsen et Lee) adopted in following embodiment is Yungan xiaoye, shelf time is 3 years, and by Fuling, Chongqing City, Lv Yuan development in agricultural science and technology company provides; Intestinal bacteria DH10B, SMD1168 engineering bacteria, Expression vector pPIC9K is NEB Products.
Without RNase H
2o, sterilizing paraffin oil, 1 × TAE damping fluid, 1 × tbe buffer liquid, level pad, elution buffer, 6 × loading buffer, GoldviewTM nucleic acid dye, RNase inhibitor, dNTP Mix, AMV ThermoScript II, 10 × PCR Buffer, MgCl
2, archaeal dna polymerase and agarose be purchased from Shanghai biotechnology company limited.
Restriction endonuclease EcoR I and Not I is NEB Products.
Other raw materials used if no special instructions, are common commercially available.
embodiment 1the extraction of tumorous stem mustard total serum IgE:
5 mL Trizol reagent are added in centrifuge tube, get 0.5 g tumorous stem mustard blade and be ground to powder fast in liquid nitrogen, then transfer in test tube, fully mix immediately, after room temperature places 10 min, carry out centrifugal in refrigerated centrifuge, temperature is set to 4 DEG C, rotating speed is 7200 rpm/min, draws supernatant liquid after centrifugal 25 min; CHCl is added in described supernatant liquid
31 mL and 5 mol/L NaCl solution 1 mL, places 3 min after thermal agitation, then in 4 DEG C, centrifugal 25 min of 7200 rpm/min, at this moment sample can be divided into 3 layers, gets supernatant; In supernatant, add 2.5 mL Virahols, place recentrifuge 20 min after 10 min, abandon supernatant, centrifuge tube bottom sides forms gelatinous precipitate; In centrifuge tube, add centrifugal 5 min after 5 mL washing with alcohol precipitations, abandon supernatant, the water dissolution adding 0.25 mL DEPC process after ethanol volatilization completely precipitates, and in-72 DEG C of preservations.
embodiment 2the detected through gel electrophoresis of total serum IgE
In Erlenmeyer flask, add 25 mL 1 × TAE damping fluids and 0.25 g agarose, put microwave-oven-heating into and melt to agarose, during the temperature being cooled to the back of the hand to bear, then add the GoldviewTM nucleic acid dye of 2.5 μ L, pour into after mixing in the middle of glue plate.Take out 4 μ L embodiments 1 extract dissolve total serum IgE mix with the Loading buffer of 1 μ L after carry out application of sample, carry out electrophoresis 30 min under 70mA, 100V after, observe under ultraviolet light, as shown in Figure 1, in Fig. 1, each swimming lane label respectively: R1 for result, R2, R3, three swimming lanes are the RNA of extraction, as seen from Figure 1 three bands, and 28S band and 18S band luminance factor are approximately 2:1, prove that the total serum IgE proposed may be used for experiment below.
embodiment 3the synthesis of the first chain cDNA
Adopt the AMV first chain cDNA synthetic agent box of Shanghai Sheng Gong biotechnology company limited, synthesize the first chain cDNA, centrifuge tube is inserted in ice and add following reaction reagent:
Embodiment 1 extracts the total serum IgE 2 μ L dissolved
Oligo dt Primer（0.5 μg/μL） 1 μL
RNase free ddH
2o makes final volume be 12 μ L
By the solution that the above-mentioned cumulative volume prepared is 12 μ L, in centrifugal 2 min of 4000 rpm/min, then water-bath 5 min in water-bath reaction mixture being placed on 65 DEG C, then inserting 30 s in ice, centrifugal 2 min, get supernatant liquor.
The test tube that supernatant liquor is housed is placed on ice, then adds following component:
5×Reaction buffer 4 μL
RNase Inhibitor(20M/μL) 1 μL
DNTP Mix(10 mmol/L) 2 μL
AMV Reverse Transcriptase(10Μ/μl) 2 μL
Centrifugal 2 min after mixing, PCR instrument carries out reverse transcription reaction, and 42 DEG C of process 60 min are so that the synthesis of cDNA, and then 85 DEG C of process 5 min make enzyme deactivation, after process, are placed in-20 DEG C of refrigerators and preserve.
embodiment 4the amplification of sulphur glycoside enzyme gene
Relatively the nucleotide sequence of the plant such as rape, leaf mustard sulphur glycoside enzyme gene, chooses the region that homology is higher, designs a pair forward and reverse primer, with the first chain cDNA of embodiment 3 synthesis for template carries out PCR reaction.
Upper primer 1:
5’- GATCCGGTTCTGGCGAATTCGACGACGACGACAAGGATGAAGAAATCAC -3’
Upper primer 2:
5’- CGACGACGACAAGGATGAAGAAATCACATGTGAAGAAAATAACC-3’
Lower primer:
5’- GGCGAATTAATTCGCGGCCGCTTATTAAGCATCTGCGAAACGCTTCTTTTG -3’
Prepare 4 centrifuge tubes, be placed in and all add following component successively on ice:
10 × PCR Buffer 5 μ L(is containing 1mM MgCl
2)
10×dNTP 5 μL
Upper primer 1(10 μM) 2 μ L
Upper primer 2 (10 μMs) 2 μ L
Lower primer (10 μMs) 2 μ L
Pfu archaeal dna polymerase 0.5 μ L(5U)
Mixed by mixed solution with rifle, then add the template cDNA 2 μ L of embodiment 3 synthesis, moisturizing makes final volume be 50 μ L, and centrifugal 2 min, are dispensed in PCR pipe, then add the sterilizing paraffin oil of 25 μ L.
React as follows in PCR instrument:
94℃ 5min
94℃ 1min
50℃ 30s 35cycle
72℃ 2min
72℃ 10min
4 DEG C of preservations.
PCR primer agarose gel electrophoresis detects, and carries out recovery purifying; Then increase further as template and obtain the full length sequence of sulphur glycoside enzyme gene.As shown in Figure 2, in Fig. 2, swimming lane is denoted as electrophorogram respectively: P1, P2, P3, P4, M; M is DNA Marker 2000; All the other four roads are all the DNA of representative amplification respectively; As seen from Figure 2, object band has been amplified.Through order-checking, the full length gene sequence of amplification is as shown in SEQ ID NO.1, and the aminoacid sequence of this genes encoding is as shown in SEQ ID NO.2.
By the tumorous stem mustard sulphur glycoside enzyme gene full length cDNA sequence of acquisition and aminoacid sequence BLAST on NCBI website of coding thereof, as shown in Figure 3, result show this sequence and cabbage mustard, colea, cabbage heart, Chinese cabbage, radish the tetraploid rice of sulphur glycoside enzyme gene be 98%, 97%, 96%, 96%, 95% respectively.
On amino acid levels, the aminoacid sequence of tumorous stem mustard sulphur glycosides enzyme and cabbage mustard, colea, cabbage heart, Chinese cabbage, radish have the similarity of 97%, 98%, 94%, 93%, 93% respectively, as shown in Figure 4.
embodiment 5the structure of recon, screening and expression
1, competence intestinal bacteria DH10B is prepared:
Taken out by-80 DEG C of frozen glycerine bacterial classification DH10B, picking one ring is seeded on LB agar plate, 37 DEG C of overnight incubation.After bacterium colony grows, picking mono-clonal is in the test tube that 3 mL LB nutrient solutions are housed, and 37 DEG C, 250 rpm/h joltings are spent the night.The bacterium liquid getting 5 mL adds 500 mL LB nutrient solutions again in test tube, and 3 h are cultivated in jolting again, when the value of OD600 is about 0.3, test tube is taken out ice bath half an hour.Under 4 DEG C of conditions, be dispensed in 50 mL centrifuge tubes centrifugal, removing supernatant, often pipe bacterium 0.1M CaCl
2solution is resuspended, repeats once, namely can be used for transforming.Unnecessary thalline is dispensed in centrifuge tube, adds under sterile glycerol is stored in-72 DEG C of conditions immediately.
2, the preparation of carrier pPIC9K-S:
Adopt the little of Beijing Tian Gen company to carry middle amount test kit extraction pPIC9K-S plasmid, with EcoR I and NotI double digestion, enzyme cuts system and reaction conditions is as follows:
10×NEB Buffer3 5 μL
100×BSA 0.5 μL
EcoR I（20,000 units/mL ） 2 μL
NotI（10,000 units/mL） 2 μL
pPIC9K-S（175 ng/μL） 25 μL
ddH2O 15.5 μL
The above-mentioned reaction mixture mixed enzyme under 37 DEG C of conditions is cut through night, then after identifying, this fragment is carried out recycling and under being stored in the condition of-20 DEG C.
3, the structure of fusion protein expression vector and conversion:
Sulphur glycoside enzyme gene embodiment 4 obtained and this step 2 enzyme are cut expression vector and are hybridized, hybridization system and reaction conditions as follows:
10 × hybrid mixed liquid 5 μ L
The sulphur glycoside enzyme gene MYR1(25ng/ μ L that embodiment 4 obtains) 6 μ L
Step 2 enzyme cuts Expression vector pPIC9K-S(20ng/ μ L) 8 μ L
ddH
2O 1 μL
Above-mentioned reaction soln is mixed, in 25 DEG C of reactions after 30 minutes; The competent cell DH10B that 10 μ L connection products and 200 μ L the present embodiment steps 1 obtain slowly is mixed, places half an hour on ice, do not shake; 42 DEG C of heat-shocked 1min, make plasmid enter cell, put 2 min on ice immediately; Add 800 μ L LB nutrient solutions again, 150rpm/h jolting half an hour.
The cell getting the above-mentioned conversion of 100-150 μ L is added on the LB flat board containing ammonia benzyl resistance, and cell is evenly spreadable, until dry.To put upside down flat board, cultivate 18 hours for 37 DEG C; By the single colony clone 4 DEG C preservation grown, in order to inspection.Checkout procedure is identified through PCR, chooses positive colony bacterium, send DNA to check order and identifies.
4, electricity transforms:
Step 3 checks order correct positive colony, carries middle amount test kit extracting plasmid 20 μ g, by Sal I single endonuclease digestion linearization process with little.
10×NEB Buffer3.1 50 μL
100×BSA 5 μL
Sal I（20,000 units/mL） 10 μL
pPIC9K-S-MYR1（219ng/μL） 90 μL
ddH2O 345 μL
37 DEG C of enzymes cut through night, get 10 μ L digestion products gel analysis, to determine whether that enzyme cuts entirely.
Prepare competent cell SMD1168, plate yeast strain SMD1168 drawn by YPD flat board, cultivates and within 3 days, puts 4 DEG C of refrigerators, prepare competent cell; Prepare 1 1.5 mL centrifuge tube ice bath, add the pichia spp competent cell SMD1168 that 100 μ L are concentrated, pPIC9K-S-MYR1 after 10 μ g DNA(Sal I to be transformed single endonuclease digestion linearization process) (volume is less than or equal to 10 μ L), mixing, leaves standstill 5 min on ice.Mixture is transferred to bottom electric shock cup, need strike to bottom gently, leave standstill 3 min on ice; With 1.5kV, 25uF, 200 Ω do pulse transform, cuvette is sent into electricity and turns in room, until and two electrode contacts; Electricity turns once, and pulse parameter is time 5.5 ms, 1.5kV.Shifted out by cuvette, add the 1 M sorbyl alcohol that 1 mL is ice-cold immediately, soft moves in test tube by the cell after dilution, then pressure-vaccum mixing gently.
Carry out auxotroph screening, 30 DEG C, cell cultivates 1h, and then is coated with MD plate.Every plate MD is coated with the transformant that 150 μ about L sorbyl alcohols are hatched, and gets 30 μ LSMD1168 and is coated with MD plate, cultivates 3-6 days for 30 DEG C, and incubator need discharge water anti-dry.Plate puts 4 DEG C of Refrigerator stores.
5, hereditary enzyme element resistant transformants is screened:
1) prepare 2 flat boards, the geneticin concentrations of is 0.25mg/mL, and another geneticin concentrations is 2.0 mg/mL, draws 3 mL aqua sterilisas in all HIS
+on transformant flat board, with the nose heave outstanding HIS+ transformant of rifle, cell suspension is transferred in sterile centrifugation tube, slightly vortex about 10S.With spectrophotometric determination concentration (1OD600=5 × 10
7cell/mL), the YPD flat board containing Geneticin at every block is coated with 10
5cell, anti-Geneticin clones appearance in about 3 days.
6, express:
Picking mono-clonal to 3 mL YPD culture medium culturing, parallel two pipes.Under 28 DEG C of conditions, 300 rpm/h joltings are between 2-5 to OD600 value.Take out centrifugal 10 min of 2 mL (other bacterium liquid 4 DEG C is preserved for protecting bacterium), collecting cell, removes supernatant liquor, with BMMY re-suspended cell to 1 mL, carries out abduction delivering.Every 24 hours, adding methyl alcohol to the final volume concentration of methyl alcohol was 0.5% to continue to induce (10 μ about L, because having a small amount of wall built-up), gets 1mL centrifugal to centrifuge tube, get supernatant liquor after inducing 72 h.These samples are for analyzing expression level.
6.1 SDS-PAGE qualifications
Get 40 μ L above-mentioned centrifugal after Supernatant samples, add 6 × loading buffer 10 μ L, heating of uncapping, concentrating sample, then carries out 10%Tricine gel electrophoresis, coomassie brilliant blue staining.Result is as shown in Figure 5, as shown in Figure 5, having found soluble proteins and be deposited in 90 KDa places to have occurred a bright band after the cultivation of 72 hours, more identical with the desired value of sulphur glycosides enzyme, and 6 clones are positive colony.
6.2 protect bacterium
The bacterial strain selecting high expression level draws plate cultivation 2-3 days, and picking colony is cultivated in YPD.Collecting cell, the value being suspended to OD600 in the YPD containing 10% glycerine is 50-100, in-80 DEG C of storages.
6.3 express on a large scale
It is dull and stereotyped that pPIC9K-S-Myr1 glycerol stock draws plate YPD, cultivates 3-4 days for 30 DEG C; Cultivate in picking mono-clonal to 3 mL YPD substratum, parallel two pipes; 28 DEG C, (300 rpm/h) is cultivated in jolting is about 2-6 to OD600 value; Be seeded in the shaking flask containing 250 mL BMGY, 28-30 DEG C of thermal agitation, surveying OD600 value to logarithmic phase is about 2-6, and collecting cell, centrifugal segregation supernatant, carries out abduction delivering with BMMY re-suspended cell.In each shaking flask, add the above-mentioned culture of 400 mL, add a cover four layers of sterile gauze, put into shaking table and cultivate.Within second day, add methyl alcohol to methyl alcohol final volume 1%, often induction adds methyl alcohol to methyl alcohol final volume concentration for 24 hours is afterwards that 1%, 72 h collect supernatant.
embodiment 6the purifying of fusion rotein and activity identification
1, purifying:
Ni is balanced with the flow velocity of 15 mL/min with the level pad (20 mM TrisCl, 300 Mm NaCl, 20mM imidazoles, pH8.0) of 2 times of column volumes
2+post, ready to balance is complete, is that the fermented liquid (above-mentioned cultivation object enzymic fermentation liquid) after abduction delivering of 8.0 is with the flow velocity loading of 10 mL/min by mixing up pH in advance.Treat that loading is complete, with level pad drip washing 5-10 column volume until flow out baseline values, carry out wash-out with elution buffer (20 mM TrisCL, 300mM NaCL, 300mM imidazoles, pH8.0), collect sulphur glycosides enzyme fusion proteins eluting peak, electrophoresis detection.As shown in Figure 6, as seen from Figure 6, the fusion rotein after purifying has the band of 90 KDa sizes to result on gel, and the fusion rotein after purifying further can measure activity.
2, determination of activity:
Measure by following reaction system, described sample enzyme is above-mentioned expression and tumorous stem mustard sulphur glycosides enzyme after purifying, and standard enzyme is Sinigrin/ sinigrin; Measurement result is as shown in table 1:
Table 1 reaction reagent table
Table 1 Reaction reagent table
Above-mentioned reaction system is reacted in 45 DEG C of water-bath 10 min, immediately by reaction solution deactivation 10 min in 100 DEG C of boiling water baths after reaction terminates, carries out HPLC analysis after cooling, detects residue sulphur resources.Result as shown in Figure 7, by Tu Ke get, under 45 DEG C of conditions, crude protein expressed by recon can be hydrolyzed sulphur glycosides, show the biological activity of sulphur glycosides enzyme, produce a desired effect, and by sample and discovery that standard model contrasts, the sulphur glycosides peak height of sample is close with the sulphur glycosides peak height adding 0.5U enzyme standard substance, and the sulphur glycosides specific activity of enzyme therefore in sample is about 0.003 U/ μ L.
What finally illustrate is, above embodiment is only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to the technical scheme of invention or equivalent replacement, and not departing from aim and the scope of technical solution of the present invention, it all should be encompassed in the middle of right of the present invention.
<110> Yangtze Normal University;
<120> a tumorous stem mustard sulphur glycoside enzyme gene MYR1, tumorous stem mustard sulphur glycosides enzyme and gene engineering expression method thereof;
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 1591
<212> DNA
<213> artificial sequence
<220>
The nucleotide sequence of <223> SEQ ID NO.1
<400> 1
gatgaagaaa tcacatgtga agaaaataac cctttcacat gttctaacac tgatattttg 60
tcctctaaaa acttcggtaa agattttatc ttcggagtcg cttcatccgc ataccaaatt 120
gaaggtggta gaggtcgtgg agttaatgtc tgggatggtt tctcccatcg gtatccagaa 180
aaggccggtt ccgatctgaa gaacggcgac acaacctgtg aatcttatac tcgttggcaa 240
aaggatgtcg atgttatggg tgaacttaac gccaccggat ataggttctc cttcgcctgg 300
tcccgtatca tccctaaggg taaagtcagc cgtggagtca accaaggtgg acttgattac 360
taccataaac ttatcgatgc actgctggaa aagaacatca ctccattcgt caccttattc 420
cattgggatc tgccacaaac actgcaagat gaatacgaag gtttccttga taggcaaatt 480
attcaagatt ttaaggatta cgctgatctg tgttttaagg aatttggagg taaagttaaa 540
cattggatca ctattaatca attgtacacc gtccctacga ggggatatgc tattgggacc 600
gatgccccag gtaggtgttc cccaatggtc gataccaagc atcgttgtta cggtggaaac 660
tcatccaccg aaccttatat tgttgcacat aaccaacttt tagctcatgc tacagttgtc 720
gatctgtata ggacaaagta caagttccaa aagggcaaaa tcggaccagt tatgatcaca 780
cgttggttct tgccatttga tgaatcagat ccagcctcta tcgaagccgc tgaacgtatg 840
aaccaattct ttcatggttg gtatatggaa cctttgacta agggacgtta cccagatatt 900
atgagacaaa tcgtcggcag ccgtctgcct aacttcaccg aagaagaagc agaattagtt 960
gccggttcct acgatttctt aggactgaac tactatgtca ctcaatacgc acaacctaag 1020
cctaacccat acccttcaga aacacataca gccatgatgg atgccggtgt caagctgacc 1080
tacgataact cccgcggaga atttctggga cctctgttcg tcgaagataa agtcaacgga 1140
aactcatact attaccctaa gggtatctac tatgtcatgg attactttaa gaccaagtac 1200
ggtgacccac tgatctacgt caccgaaaac ggtttctcca ccccatcctc cgaaaataga 1260
gaacaagcta tcgccgatta taagcgtatc gattacttgt gttcacattt gtgtttcctg 1320
cgtaaagtca tcaaggaaaa gggagttaat gtcaggggtt actttgcttg ggctctggga 1380
gataactacg agttttgtaa gggttttaca gttagattcg gactgtctta cgttaattgg 1440
gaggatctgg atgatcgtaa tctcaaggaa tccgggaaat ggtatcaacg tttcattaat 1500
ggtacagtca agaacgccgt caagcaagat ttcttgaggt cctccctgtc ctctcaatct 1560
caaaagaagc gtttcgcaga tgcttaagtt a 1591
<210> 2
<211> 528
<212> PRT
<213> artificial sequence
<220>
The aminoacid sequence of <223> SEQ ID NO.2
<400> 2
DEEITCEENN PFTCSNTDIL SSKNFGKDFI FGVASSAYQI EGGRGRGVNV WDGFSHRYPE 60
KAGSDLKNGD TTCESYTRWQ KDVDVMGELN ATGYRFSFAW SRIIPKGKVS RGVNQGGLDY 120
YHKLIDALLE KNITPFVTLF HWDLPQTLQD EYEGFLHRQI IQDFKDYADL CFKEFGGKVL 180
HWITINQLYT VPTRGYAIGT DAPGRCSPMV DTKHRCYGGN SSTEPYIVAH NYLLAHATVV 240
DLYRTKYKFQ KGKIGPVMIT RWFLPEDESD PASIEAAERM NQFFHGWYME PLTKGRYPDI 300
MRQIVGSRLP NFTEEEAELV AGSYDFLGLN YYMTQYAQPK PNPYPSETHT AMMDAGVKLT 360
YDNSRGEFLG PLFVEDKVNG NSYYYPKGIY YVLDYFKTKY GDPLIYVTEN GFSTPSDENR 420
EQAIADYKRI DYLCSHLCFL RKVIKEKGVN VRGYFAWALG DNYEFCKGFT VRFGLSYVNW 480
EDLDDRNLKE SGKWYQRFIN GLVKNAVKQD FLRSSLSSQS QHKRFADA 528
<210> 3
<211> 49
<212> DNA
<213> artificial sequence
<220>
The nucleotide sequence of the upper primer 1 of <223>
<400> 3
gatccggttc tggcgaattc gacgacgacg acaaggatga agaaatcac 49
<210> 4
<211> 44
<212> DNA
<213> artificial sequence
<220>
The nucleotide sequence of the upper primer 2 of <223>
<400> 4
cgacgacgac aaggatgaag aaatcacatg tgaagaaaat aacc 44
<210> 5
<211> 51
<212> DNA
<213> artificial sequence
<220>
The nucleotide sequence of primer under <223>
<400> 5
ggcgaattaa ttcgcggccg cttattaagc atctgcgaaa cgcttctttt g 51
Claims (3)
1. a tumorous stem mustard sulphur glycoside enzyme gene MYR1, is characterized in that, its nucleotides sequence is classified as the sequence shown in SEQ ID NO.1.
2. a tumorous stem mustard sulphur glycosides enzyme, is characterized in that, its aminoacid sequence is the sequence shown in SEQ ID NO.2.
3. a gene engineering expression method for tumorous stem mustard sulphur glycosides enzyme as claimed in claim 2, is characterized in that, comprise the steps:
1) get tumorous stem mustard blade, extract total serum IgE;
2) total serum IgE extracted with step 1), for template, by reverse transcription reaction in PCR instrument, synthesizes the first chain cDNA;
3) compare the nucleotide sequence of rape and leaf mustard sulphur glycoside enzyme gene, design a pair forward and reverse primer, described primer is:
Upper primer 1:
5’- GATCCGGTTCTGGCGAATTCGACGACGACGACAAGGATGAAGAAATCAC -3’；
Upper primer 2:
5’- CGACGACGACAAGGATGAAGAAATCACATGTGAAGAAAATAACC-3’；
Lower primer:
5’-GGCGAATTAATTCGCGGCCGCTTATTAAGCATCTGCGAAACGCTTCTTTTG -3’；
With step 2) the first chain cDNA of synthesizing is template, adopt the primer designed by step 3), carry out PCR reaction, amplification obtains the full length sequence of sulphur glycoside enzyme gene MYR1, and the nucleotides sequence of described sulphur glycoside enzyme gene MYR1 is classified as shown in SEQ ID NO.1;
Extract carrier pPIC9K-S plasmid, and with plasmid described in EcoR I and NotI double digestion;
Expression vector after the sulphur glycoside enzyme gene MYR1 of step 4) acquisition and step 5) double digestion is hybridized, obtains recombinant expression vector pPIC9K-S-MYR1;
By step 6) recombinant expression vector transformed competence colibacillus cell E. coli DH10B, the cell after transforming is being cultivated 18 hours in 37 DEG C containing on the LB flat board of ammonia benzyl resistance, is checking order through PCR evaluation and screening positive colony bacterium;
The positive colony checking order correct by step 7) is cultivated, and extracts plasmid, adopts Sal I single endonuclease digestion linearization process, transforms for pichia spp SMD1168 electricity;
By the recombinant expression vector pPIC9K-S-MYR1 of Sal I single endonuclease digestion linearization process, electricity is transformed into pichia spp SMD1168, and coating MD is dull and stereotyped cultivates 3-6 days in 30 DEG C, and by G418 resistance, screening obtains geneticin resistant transformant;
The mono-clonal of picking geneticin resistant transformant to YPD culture medium culturing, under 28 DEG C of conditions, with the rotating speed jolting of 300 rpm/h to OD600 value between 2-5, centrifugal abandoning supernatant, to precipitation in add BMMY liquid nutrient medium re-suspended cell; Utilize methyl alcohol continuous induction to express, it is 0.5% to continue induction that every 24 hours of period added methyl alcohol to the final volume concentration of methyl alcohol, after inducing 72 h, utilizes the expression of the SDS-PAGE Analysis and Identification recombinant protein of coomassie brilliant blue staining.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510407304.4A CN104928307B (en) | 2015-07-13 | 2015-07-13 | A kind of tumorous stem mustard sulphur glycoside enzyme gene MYR1, tumorous stem mustard sulphur glycosides enzyme and its gene engineering expression method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510407304.4A CN104928307B (en) | 2015-07-13 | 2015-07-13 | A kind of tumorous stem mustard sulphur glycoside enzyme gene MYR1, tumorous stem mustard sulphur glycosides enzyme and its gene engineering expression method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104928307A true CN104928307A (en) | 2015-09-23 |
| CN104928307B CN104928307B (en) | 2018-01-05 |
Family
ID=54115734
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510407304.4A Expired - Fee Related CN104928307B (en) | 2015-07-13 | 2015-07-13 | A kind of tumorous stem mustard sulphur glycoside enzyme gene MYR1, tumorous stem mustard sulphur glycosides enzyme and its gene engineering expression method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104928307B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107034245A (en) * | 2016-02-04 | 2017-08-11 | 中国科学院微生物研究所 | A kind of method that BITC is synthesized with microbial enzyme method |
| CN115305250A (en) * | 2021-05-08 | 2022-11-08 | 中国科学院分子植物科学卓越创新中心 | Application of MYR1 in improving disease resistance of gramineous plants |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009106985A3 (en) * | 2008-02-27 | 2010-04-01 | University Of Copenhagen | Biosynthetic engineering of glucosinolates |
-
2015
- 2015-07-13 CN CN201510407304.4A patent/CN104928307B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009106985A3 (en) * | 2008-02-27 | 2010-04-01 | University Of Copenhagen | Biosynthetic engineering of glucosinolates |
Non-Patent Citations (3)
| Title |
|---|
| LENMAN M. ET AL.: "characterization of a brassica napus myrosinase pseudogene: myrosinases are members of the bga family of beta-glycosidases", 《PLANT MOL BIOL.》 * |
| UNIPROT: "uniprotkb-q00326(MYRO_BRANA)", 《UNIPROT》 * |
| 梁锦锋等: "西兰花硫代葡萄糖苷酶基因BoMyr2在毕赤酵母中的表达", 《中国食品学报》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107034245A (en) * | 2016-02-04 | 2017-08-11 | 中国科学院微生物研究所 | A kind of method that BITC is synthesized with microbial enzyme method |
| CN107034245B (en) * | 2016-02-04 | 2019-12-31 | 中国科学院微生物研究所 | Method for synthesizing benzyl isothiocyanate by microbial enzyme method |
| CN115305250A (en) * | 2021-05-08 | 2022-11-08 | 中国科学院分子植物科学卓越创新中心 | Application of MYR1 in improving disease resistance of gramineous plants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104928307B (en) | 2018-01-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109161550B (en) | SlbHLH59 gene for regulating and controlling ascorbic acid content of tomato fruits and application method | |
| CN102432679B (en) | Rice extensin OsPEX1 and application thereof | |
| CN101280006A (en) | Protein related to tolerance to Fe deficiency of plant, coding genes and application thereof | |
| CN102757486B (en) | Plant development related protein GA20ox, and encoding gene and application thereof | |
| CN111675755B (en) | Bermuda grass transcription factor CdWRKY50 for regulating and controlling plant salt tolerance and application thereof | |
| CN102586279A (en) | Yunnan red pear PyTTG1 gene, prokaryotic expression vector thereof and application of prokaryotic expression vector | |
| CN102242136B (en) | Gene influencing root system development and yield of rice and application of gene | |
| CN104928307A (en) | Tumorous stem mustard myrosinase gene MYR1, tumorous stem mustard myrosinase and tumorous stem mustard myrosinase gene engineering expression method | |
| CN107400671A (en) | Pear fruit saccharide transporter gene PbTMT4 and its application | |
| CN111996197B (en) | Salt-tolerant gene and protein of pyrus betulaefolia, recombinant vector and application | |
| CN104109192A (en) | Wheat draught-resistant gene and use thereof | |
| CN111303262B (en) | Plant heat resistance and root development related protein and coding gene and application thereof | |
| CN107828801A (en) | Application of the Chlamydomonas reinhardtii RFC1 genes in Chlamydomonas reinhardtii cadmium tolerance is regulated and controled | |
| CN107446031A (en) | A kind of plant glutelin transhipment storage GAP-associated protein GAP OsVHA E1 and its encoding gene and application | |
| CN102417911B (en) | Method for over-expressing brassica napus BnLAS gene for improving plant drought resistance | |
| CN107987134B (en) | A kind of 3-protein d hw1 and its encoding gene dhw1 and application | |
| CN112725352B (en) | Barley HvZIFL2 gene and application thereof | |
| CN104774847A (en) | Julans sigillata Dode proline-enriched protein gene JsPRP1 and applications thereof | |
| CN104911198B (en) | Blueberry salt tolerant, anti-drought gene VcLON2 and its coding albumen and application | |
| CN109053870A (en) | Application of AtERF49 gene during plant responding high temperature stress | |
| CN111763249A (en) | Plant powdery mildew resistance related protein Pm5e, and coding gene and application thereof | |
| CN110295174A (en) | The transgenic arabidopsis strain and its construction method of FIPV gene overexpression | |
| CN109355270A (en) | A kind of rice kinases OSK1 and its application | |
| CN109652419B (en) | Sclerotinia sclerotiorum induced rape promoter pBnGH, identification method and application | |
| CN115232822B (en) | Identification and application of wild soybean inositol transporter gene GsINT1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180105 Termination date: 20200713 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |