CN115287342A - Young pigeon sex identification method and PCR primer for identification - Google Patents
Young pigeon sex identification method and PCR primer for identification Download PDFInfo
- Publication number
- CN115287342A CN115287342A CN202210980622.XA CN202210980622A CN115287342A CN 115287342 A CN115287342 A CN 115287342A CN 202210980622 A CN202210980622 A CN 202210980622A CN 115287342 A CN115287342 A CN 115287342A
- Authority
- CN
- China
- Prior art keywords
- pigeon
- sex
- young
- colloidal gold
- young pigeon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6879—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for sex determination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a primer, a reagent and a method for rapidly identifying the sex of a young pigeon, wherein the primer is designed aiming at a special EE0.6 sequence fragment on a W chromosome of the female pigeon and is modified by Biotin and FAM. During detection, firstly, the DNA in the feather pulp is quickly extracted by using high-efficiency nucleic acid lysate, so that the process of obtaining the DNA is simplified; and then, by the specific PCR amplification of the primer, the amplified PCR product is subjected to rapid detection of identification of female individuals through the existence of a strip of a colloidal gold test paper strip, the result is visual and clear, the identification degree is high, the sex of the pigeon is easily identified, the verification result is consistent with the result of the colloidal gold test paper, and the accuracy rate is 100%. The method for determining the sex of the pigeon by utilizing the PCR-colloidal gold test paper technology and the genotyping method has the advantages of strong specificity, high accuracy, simple and convenient operation, quick and accurate identification result, small damage to animals and the like, reduces the time and economic cost for identifying the sex of the pigeon, is convenient for basic popularization and use, and has wide market application prospect.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a young pigeon sex identification method and a PCR primer for identification.
Background
The breeding pigeon industry in China is developed rapidly, but the breeding technology of the meat pigeon lags behind other poultry due to insufficient scientific research and force investment and the special biological characteristics of the pigeon, wherein the problem of sex identification in the breeding pigeon production still needs to be solved. Sex identification is particularly important in breeding pigeons and controlling breeding costs. Individuals with different sexes have different nutritional requirements, and early identification of the sexes is helpful for saving the feeding cost and improving the breeding efficiency. For breeding pigeons, a reasonable sex ratio is needed, and breeding is not facilitated if the sex ratio is not proper. If the sex of the pigeons can be accurately separated and matched in time in the early stage, the production efficiency of a pigeon farm can be improved, the production benefit is increased, unnecessary male pigeons can be eliminated as soon as possible, the production cost is reduced, and particularly, male pigeons and female pigeons are left in the young pigeon stage and are more prominent in the egg pigeon industry, so that the early sex identification has important practical significance and economic value.
However, pigeons belong to sex singlet birds, and are difficult to distinguish from appearance and other behaviors whether they are young pigeons or adult pigeons, and moreover, pigeons are late-grown birds, and the young pigeons cannot be sexed like ordinary poultry by turning their anus. At present, in the aspect of sex identification of young pigeons, sex identification of pigeons is mainly carried out by methods such as appearance behavior characteristics, laparoscopy, fecal steroid detection, karyotype and the like, but the methods are low in accuracy rate and complicated in identification process, and are difficult to popularize on a large scale in production. When the anal-turning method is applied to pigeons, the accuracy rate is only about 70 percent. With the development of molecular biology, some molecular biology methods can be selected for identifying the sex of the pigeons, and the method has the advantages of high accuracy, small damage to animals and the like. However, most of the reported identification methods require complicated genome extraction steps and agarose gel electrophoresis analysis, and are difficult to popularize and apply in production.
Disclosure of Invention
The invention aims to solve the technical problem of providing a young pigeon sex identification method and a PCR primer for identification, which can simply, quickly and accurately identify the sex of young pigeons.
In order to solve the above technical problems, an embodiment of the present invention provides a method for identifying the sex of a young pigeon, comprising the following steps:
s1, pulling out 1-2 newly born feathers with hair follicles from young pigeons;
s2, extracting the genome DNA of the young pigeon to be detected by using a genome DNA extraction reagent, wherein the operation steps are as follows: lysate a and lysate B were mixed according to 24:1, adding a feather sample with feather pulp into a mixed lysate, heating for 15 minutes at 55 ℃, heating for 5 minutes at 95 ℃, adding a stop solution, and taking supernatant to obtain the genome DNA of the feather pulp of the pigeon;
s3, performing PCR amplification by using the extracted DNA as a template and utilizing specific upstream and downstream primers modified by Biotin and FAM; wherein, the PCR reaction system is as follows: 2 XTaq Master Mix 10. Mu.L, forward and reverse primers at a concentration of 10. Mu. Mol/L each 0.8. Mu.L, template DNA 1. Mu.L, ultrapure water 7.4. Mu.L; the PCR reaction program is: pre-denaturation at 95 ℃ for 3min; the extension was carried out for 30 cycles at 95 ℃ 15s,60 ℃ 15s,72 ℃ 60 s; keeping the temperature at 72 ℃ for 5min; and finishing at 4 ℃.
S4, diluting 1-2 mu L of amplified PCR primer by 50-100 times with a sample diluent special for a colloidal gold test strip, adding 50 mu L of amplified PCR primer into a sample adding hole of the colloidal gold test strip, reacting for 2-5min, wherein after a reagent corresponding to a male young pigeon reacts, only one strip appears on a quality control line of the colloidal gold test strip, and no strip exists at a detection line; after the corresponding reagent of the female young pigeon reacts, a strip appears on the quality control line and the detection line of the colloidal gold test strip respectively, so as to identify the sex of the young pigeon.
The invention also provides a PCR primer for identifying the sex of the young pigeon, which comprises the following components:
the sequence of the upstream primer is as follows: TCCTATGCCTACCACCTTCCT;
the sequence of the downstream primer is as follows: TTGAGAAAGAATCTGACCTGAACC.
The invention also provides application of the PCR primer for identifying the sex of the young pigeon in sex identification of the young pigeon.
The invention also provides application of the PCR primer for identifying the sex of the young pigeon in preparing a kit for identifying the sex of the young pigeon.
The present invention also provides a kit for sex determination of a young pigeon, comprising the PCR primer for sex determination of a young pigeon according to claim 2, further comprising: a genome DNA extraction reagent, 2 XTaq Master Mix, ultrapure water and a special sample diluent for colloidal gold test paper.
The technical scheme of the invention has the following beneficial effects:
the invention provides a method for identifying sex of young pigeons and a PCR primer pair for identifying, which utilizes the difference between sex chromosomes ZW (female) and ZZ (male) of male and female pigeons, designs a primer aiming at a specific EE0.6 sequence fragment on the W chromosome of the female pigeons, and utilizes Biotin and FAM to modify upstream and downstream primers, wherein the primer has the advantages of good specificity, high resolution, visual amplification result and the like.
The invention adopts the explored lysis solution to simply and quickly obtain the DNA of the squab feather marrow genome, saves the extraction step of a commercialized DNA extraction kit, and saves time and economic cost.
The PCR product in the invention is directly used for rapidly detecting the strip number of the test strip by colloidal gold to judge male and female, and the result is visual, clear and recognizable. And the result is judged without needing an agarose gel electrophoresis method which takes longer time (20-30 min), so that the method meets the detection requirements of rapidness, accuracy and economy, and is suitable for popularization and application in large-scale pigeon production and breeding.
According to the invention, DNA is extracted from the feathers, so that the pigeon sex detection kit has little harm, and the pigeon sex identification is carried out by using a PCR amplification technology and a colloidal gold rapid detection test strip, so that the detection time is shortened, the detection rate is improved, the technical threshold is reduced, and the pigeon sex detection kit has strong innovation in breeding and reproduction of pigeons.
Drawings
FIG. 1 is a schematic view of 21-day-old young pigeons in example 1 of the present invention;
FIG. 2 is the result of rapid detection of PCR products from 21-day-old young pigeon in example 1 using colloidal gold test paper;
FIG. 3 is a view showing the anatomical verification of the 21-day-old young pigeon in example 1 when the young pigeon is raised to 28-day-old young pigeon;
FIG. 4 is a diagram showing the results of the nucleic acid electrophoresis gel for sex determination of 21-day-old young pigeons of unknown male and female in example 1;
FIG. 5 is a schematic view of a 6-day-old young pigeon in example 2 of the present invention;
FIG. 6 is a diagram showing the results of the rapid detection of PCR products of 6-day-old young pigeons using colloidal gold test paper in example 2;
FIG. 7 is a diagram showing the results of the nucleic acid electrophoresis gel for sex determination of 6-day-old young pigeons of unknown male and female in example 2;
FIG. 8 is a diagram showing the results of rapid detection of a male pigeon and a female pigeon in example 3 of the present invention using colloidal gold test paper.
Detailed Description
In order to make the technical problems, technical solutions and advantages of the present invention more apparent, the following detailed description is given with reference to the accompanying drawings and specific embodiments.
The invention provides a method for identifying the sex of a young pigeon, which comprises the following steps:
s1, pulling out 1-2 newly-born feathers with hair follicles from young pigeons;
s2, extracting the genome DNA of the young pigeon to be detected by using a genome DNA extraction reagent; the operation steps are as follows: lysate a and lysate B were mixed according to a 24:1, adding the feather sample with feather marrow into the mixed lysis solution, heating for 15 minutes at 55 ℃, heating for 5 minutes at 95 ℃, adding the stop solution, and taking the supernatant to obtain the genome DNA of the feather marrow of the pigeon. 1 μ L of the supernatant was used for PCR amplification, and the remainder was stored at-20 ℃ for further use.
S3, performing PCR amplification by using the extracted DNA as a template and utilizing specific upstream and downstream primers modified by Biotin and FAM; wherein, the PCR reaction system is as follows: 2 xTaq Master Mix 10 muL, forward and reverse primers with concentration of 10 mumol/L each 0.8 muL, template DNA with concentration of 40-400 mug/mL extracted in the previous step 1 muL, ultrapure water 7.4 muL; the PCR reaction program is: pre-denaturation at 95 ℃ for 3min; the extension was carried out for 30 cycles at 95 ℃ 15s,60 ℃ 15s,72 ℃ 60 s; keeping the temperature at 72 ℃ for 5min; and finishing at 4 ℃. The specific primer in the step is designed aiming at the unique EE0.6 sequence fragment on the pigeon W chromosome.
S4, taking 1-2 mu L of amplified PCR primers, diluting by 50-100 times of a sample diluent special for a colloidal gold test strip, taking 50 mu L of the amplified PCR primers, adding the 50 mu L of the amplified PCR primers into a sample adding hole of the colloidal gold test strip, reacting for 2-5min, reacting with a reagent corresponding to a male young pigeon, and then only forming a strip on a quality control line of the colloidal gold test strip, wherein no strip is arranged on the detection line; after the corresponding reagent of the female young pigeon reacts, a strip appears on the detection line and the quality control line of the colloidal gold test strip respectively, so as to identify the sex of the young pigeon.
The detailed operation steps are as follows:
(1) 1-2 newly-born feathers with hair follicles on the wings or the tail of each young pigeon are pulled out;
(2) Extracting the genome DNA of the pigeon to be detected by using a genome DNA rapid extraction reagent (20 min);
(3) And performing PCR amplification by using the extracted DNA as a template and using Biotin and FAM modified specific primers and upstream and downstream primers. The PCR reaction system is as follows: 2 XTAQA Master Mix (Nanjing Novowed Bio Inc.) 10. Mu.L, forward and reverse primers at a concentration of 10. Mu. Mol/L each 0.8. Mu.L, template DNA at a concentration of 40-400. Mu.g/mL 1. Mu.L, and ultrapure water 7.4. Mu.L. The PCR reaction program is: pre-denaturation at 95 ℃ for 3min; the extension was carried out for 30 cycles at 95 ℃ 15s,60 ℃ 15s,72 ℃ 60 s; keeping the temperature at 72 ℃ for 5min; and finishing at 4 ℃.
(4) Diluting the amplified PCR primer by 50-100 times, adding 50uL into a sample adding hole of a colloidal gold test strip, reacting for 2-5min, wherein only female pigeons can have macroscopic colloid Jin Tiaodai on a test line, and a quality control line also has a strip. The PCR product of male pigeons has no strip on the detection line and only has one strip on the quality control line. The method can achieve the purpose of rapidly identifying female individuals.
Note that: after the test paper is disassembled, please use as soon as possible; the result should be judged within a specified time, preferably within 5min, and after 10min, false positive may appear.
The technical solution of the present invention is further illustrated below with reference to several examples.
Example 1
Test time: 20220420-20220430, test site: pigeon Co Ltd
1. Randomly selecting 30-feather 21-day-old squabs (healthy pigeons with unknown sex), wearing foot ring marks marked with numbers (as shown in figure 1), and then sampling, wherein a sampler needs to wear disposable gloves to pull out 1-2 new feathers with hair follicles on the wings or the tail of each squab for identifying the sex.
2. Extracting DNA by using a genome DNA rapid extraction reagent, carrying out PCR amplification by using the primers by using the DNA as a template, and then carrying out PCR amplification on a PCR product 1: diluting by 100, adding 50 mu L of diluted product to the sample adding part of a colloidal gold test strip, reading the result after 2min, and only the PCR product of the female young pigeon can be seen as the colloidal Jin Tiaodai on the detection line. As shown in FIG. 2, the results of the test with colloidal gold test paper show 16 female pigeons and 14 male pigeons.
3. When the young pigeons are slaughtered at the age of 28 days, the pigeons are euthanized and dissected, and the gonad 1 of a male individual to a white testis (figure 3) is taken as a judgment standard. There were 14 testicles and 16 testicles. The observation result of the gonad testis (figure 3) is compared with the identification result of the colloidal gold test paper (figure 2) in accordance rate, the detection result of the colloidal gold test paper is completely consistent with the slaughter verification result, and the accuracy rate of the colloidal gold test paper method is 100 percent, and the method is simple and efficient.
4. The PCR product was subjected to 1.5% agarose gel electrophoresis detection, and the electrophoresis result (FIG. 4) showed that a 360bp band was a female squab, and a male squab without a band. The result is consistent with the results of the colloidal gold test paper and slaughter verification.
Example 2
Test time: 20220505-20220602, test site: pigeon Co Ltd
Randomly selecting 20-feather 6-day-old squabs (healthy pigeons with unknown sex), wearing numbered foot ring markers, and then sampling, wherein a sampler needs to wear disposable gloves to pull out 1-2 newborn feathers (as shown in figure 5) with hair follicles on the wings or tail of each squab for identifying the sex. Extracting feather pulp DNA, performing PCR specific amplification, and performing PCR product 1:100 dilution, add on colloidal gold test strip, read the results after 2min, show 9 females, 11 males (fig. 6). When the patient is slaughtered at 28 days of age, the patient is euthanized and dissected, and 11 testicles and 9 testicles are totally obtained. The observation result of the gonad testis is compared with the identification result of the colloidal gold test paper with the coincidence rate, and the accuracy rate is 100 percent. The PCR product was subjected to 1.5% agarose gel electrophoresis (see FIG. 7), and the results were consistent with those of the gold test strip.
Example 3
Test time: 20220606-20220609, test site: a certain Pigeon Co Ltd
Selecting 5 pairs of male and female individuals of breeding pigeons (350-360 days old) with successfully matched and known sexes, pulling 1 feather with hair follicles under wings out of each feather, extracting DNA, performing PCR specific amplification, and performing PCR primer 1: diluting 100 times, adding into colloidal gold test strip, and reading the result after 2min (the result is shown in figure 8). The test paper strip results show that 5 male pigeons and 5 female pigeons completely meet the expectation.
While the foregoing is directed to the preferred embodiment of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims.
Claims (5)
1. A method for identifying the sex of a young pigeon is characterized by comprising the following steps:
s1, pulling out 1-2 newly-born feathers with hair follicles from young pigeons;
s2, extracting the genome DNA of the young pigeon to be detected by using a genome DNA extraction reagent, wherein the operation steps are as follows: lysate a and lysate B were mixed according to 24:1, adding a feather sample with feather marrow into the mixed lysis solution, heating for 15 minutes at 55 ℃, heating for 5 minutes at 95 ℃, adding stop solution, and taking supernatant to obtain the genome DNA of the feather marrow of the pigeon;
s3, performing PCR amplification by using the extracted DNA as a template and utilizing specific upstream and downstream primers modified by Biotin and FAM; wherein, the PCR reaction system is as follows: 2 XTaq Master Mix 10. Mu.L, forward and reverse primers at a concentration of 10. Mu. Mol/L each 0.8. Mu.L, template DNA 1. Mu.L, ultrapure water 7.4. Mu.L; the PCR reaction program is: pre-denaturation at 95 ℃ for 3min; the extension was carried out for 30 cycles at 95 ℃ 15s,60 ℃ 15s,72 ℃ 60 s; keeping the temperature at 72 ℃ for 5min; and finishing at 4 ℃.
S4, diluting 1-2 mu L of amplified PCR primer by 50-100 times with a sample diluent special for a colloidal gold test strip, adding 50 mu L of amplified PCR primer into a sample adding hole of the colloidal gold test strip, reacting for 2-5min, wherein after a reagent corresponding to a male young pigeon reacts, only one strip appears on a quality control line of the colloidal gold test strip, and no strip exists at a detection line; after the corresponding reagent of the female young pigeon reacts, a strip appears on the quality control line and the detection line of the colloidal gold test strip respectively, so as to identify the sex of the young pigeon.
2. A PCR primer for sex determination of young pigeons is characterized by comprising the following components:
the sequence of the upstream primer is as follows: TCCTATGCCTACCACCTTCCT;
the sequence of the downstream primer is as follows: TTGAGAAAGAATCTGACCTGAACC.
3. The use of the PCR primer for sex determination of young pigeon according to claim 2 for sex determination of young pigeon.
4. The use of the PCR primer for sexing young pigeon according to claim 2 in the preparation of a kit for sexing young pigeon.
5. A kit for sex determination of a young pigeon, comprising the PCR primer for sex determination of a young pigeon according to claim 2, and further comprising: a genome DNA extraction reagent, 2 XTaq Master Mix, ultrapure water and a special sample diluent for colloidal gold test paper.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210980622.XA CN115287342A (en) | 2022-08-16 | 2022-08-16 | Young pigeon sex identification method and PCR primer for identification |
| PCT/CN2023/106570 WO2024037252A1 (en) | 2022-08-16 | 2023-07-10 | Pcr primer for sex identification of young pigeons, use thereof, and method for sex identification of young pigeons |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210980622.XA CN115287342A (en) | 2022-08-16 | 2022-08-16 | Young pigeon sex identification method and PCR primer for identification |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115287342A true CN115287342A (en) | 2022-11-04 |
Family
ID=83830704
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210980622.XA Pending CN115287342A (en) | 2022-08-16 | 2022-08-16 | Young pigeon sex identification method and PCR primer for identification |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN115287342A (en) |
| WO (1) | WO2024037252A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024037252A1 (en) * | 2022-08-16 | 2024-02-22 | 江苏省农业科学院 | Pcr primer for sex identification of young pigeons, use thereof, and method for sex identification of young pigeons |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| TWI472623B (en) * | 2010-03-31 | 2015-02-11 | Univ Kaohsiung Medical | Method for columbidae gender identification, nucleotide sequence for columbidae gender and nucleotide primer pair for columbidae gender |
| CN103255217A (en) * | 2013-04-25 | 2013-08-21 | 天津出入境检验检疫局动植物与食品检测中心 | Side direction current test strip detection kit for detecting canis familiaris component in feed and application thereof |
| CN111254189A (en) * | 2020-02-10 | 2020-06-09 | 金陵科技学院 | Detection method of PCR amplification product |
| CN111979308B (en) * | 2020-10-10 | 2023-05-05 | 广东科贸职业学院 | Primer composition, kit and method for identifying early sex of pigeons |
| CN114517236A (en) * | 2022-03-15 | 2022-05-20 | 北京华诺奥美基因医学检验实验室有限公司 | PCR primer, kit and detection method for detecting klebsiella pneumoniae |
| CN115287342A (en) * | 2022-08-16 | 2022-11-04 | 江苏省农业科学院 | Young pigeon sex identification method and PCR primer for identification |
-
2022
- 2022-08-16 CN CN202210980622.XA patent/CN115287342A/en active Pending
-
2023
- 2023-07-10 WO PCT/CN2023/106570 patent/WO2024037252A1/en unknown
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024037252A1 (en) * | 2022-08-16 | 2024-02-22 | 江苏省农业科学院 | Pcr primer for sex identification of young pigeons, use thereof, and method for sex identification of young pigeons |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024037252A1 (en) | 2024-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107217099B (en) | A kind of SNP marker and its application can be used for snakehead genetic sex and the identification of supermale fish | |
| CN107523643B (en) | Method for auxiliary detection of growth traits of cattle KCNJ12 gene CNV marker and special kit thereof | |
| CN113604548B (en) | PCR primer, kit and method for sex identification of geese | |
| CN115287342A (en) | Young pigeon sex identification method and PCR primer for identification | |
| CN114657264B (en) | Clarias fuscus sex-specific molecular marker primer and application thereof | |
| CN111926085A (en) | Molecular marker influencing chicken muscle brightness and application thereof | |
| CN109055520B (en) | Cynoglossus semilaevis exosome differential expression label and kit | |
| CN102912017B (en) | Method for quickly and accurately identifying northern snakehead, Taiwan snakehead and hybrid snakehead | |
| CN113637765A (en) | Molecular marker for identifying genetic sex of micropterus salmoides and application | |
| CN111979308A (en) | Primer composition, kit and method for identifying early sex of pigeons | |
| CN112695101B (en) | Quail early sex identification method, kit and special primer pair | |
| CN115058522B (en) | Molecular marker for identifying broiler breeds containing white roc blood margin and application thereof | |
| CN110607376A (en) | Patinopecten yessoensis living body sex identification method based on DNA molecular marker | |
| CN113151489B (en) | Molecular diagnosis method for evaluating growth traits based on cow ZNF146 gene CNV marker and application thereof | |
| CN108588241A (en) | Differentiate the molecular specificity labeled primers and method of epinephelus fuscoguttatus | |
| CN115232868B (en) | PCR primer, kit and method for emu sex identification | |
| CN203200273U (en) | Quick chicken gender identification kit | |
| CN109439764B (en) | Molecular marker for identifying native-like eggs and native eggs and application | |
| CN114045349B (en) | Primer, probe and kit for synchronously detecting source of sika deer and red deer | |
| CN106636427B (en) | Microsatellite marker primer and method for identifying inbred families of exopalaemon carinicauda | |
| CN114045347B (en) | PCR primer, kit and method for sex identification of special poultry | |
| CN113981106B (en) | Method for early sex identification of Phasianidae animals, kit matched with method and special primer pair | |
| CN113699256B (en) | Functional marker for rapidly identifying gynogenesis offspring of salmon and koi and application of functional marker | |
| CN116426654B (en) | Molecular biological identification method and application of black-bone chickens of different types | |
| CN113755607B (en) | Universal primer for specifically identifying donkey, horse and mule source components in donkey-hide gelatin and raw materials thereof, detection method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |