CN115247188A

CN115247188A - Kit and application thereof in constructing alopecia model pig nuclear transplantation donor cells of high-expression pig II-type 5 alpha-reductase

Info

Publication number: CN115247188A
Application number: CN202210518717.XA
Authority: CN
Inventors: 牛冬; 汪滔; 陶裴裴; 王磊; 曾为俊; 程锐; 赵泽英
Original assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Current assignee: Nanjing Qizhen Genetic Engineering Co Ltd
Priority date: 2022-05-13
Filing date: 2022-05-13
Publication date: 2022-10-28

Abstract

The invention discloses a kit and application thereof in constructing an alopecia model pig nuclear transplantation donor cell of high-expression pig II-type 5 alpha-reductase. The invention provides a method for preparing recombinant porcine cells, which comprises the following steps: integrating a DNA molecule named as a DNA molecule A to the genome DNA of the pig cell at a fixed point to obtain a recombinant pig cell; the DNA molecule A expresses pig II type 5 alpha-reductase. The invention obtains the pig recombinant cell capable of highly expressing II-type 5 alpha-reductase by a gene editing technology, and the recombinant cell can be used as a nuclear transplantation cell donor to clone and produce an alopecia model pig in later period, is beneficial to research and reveal the pathogenesis of androgenetic alopecia, and can be used for research of drug screening, drug effect detection, gene and cell treatment and the like.

Description

Kit and application thereof in constructing alopecia model pig nuclear transplantation donor cells of high-expression pig II-type 5 alpha-reductase

Technical Field

The invention belongs to the technical field of biology, relates to a gene editing technology, and particularly relates to a kit and application thereof in constructing recombinant pig cells of high-expression pig II type 5 alpha-reductase.

Background

According to survey data of Wei Jian and 2019 of the nation, the number of Chinese hair loss is over 2.5 hundred million, and 1 person has hair loss in every 6 persons on average, wherein about 1.63 hundred million male and about 0.88 hundred million female have hair loss rate of 84% before the age of 30, and the hair loss rate is obviously low in age.

There are many types of hair loss, of which androgenic alopecia (AGA) is one of the most common types of hair loss, a progressive follicular miniaturization that begins at or later than puberty. Both men and women can suffer from, but exhibit different patterns and prevalence of alopecia. Current studies indicate that androgens are the determining factor in the pathogenesis of AGA, and other factors including perifollicular inflammation, increased stress on life, stress and anxiety, poor living and eating habits, etc. can aggravate the symptoms of AGA.

Androgens in men are derived primarily from testosterone secreted by the testes; androgens in women are synthesized primarily by the adrenal cortex and may also be secreted by the ovaries in small amounts. Androgens are primarily androstenediol, which can be metabolized to testosterone and dihydrotestosterone. Although androgens are a key factor in the pathogenesis of AGA, almost all AGA patients maintain normal levels of circulating androgens. Research shows that the androgen effect on susceptible hair follicles is increased due to the increase of androgen receptor gene expression and/or type II 5 alpha-reductase gene expression in hair loss regions. In the case of AGA, the cells in the dermal region of the susceptible hair follicle contain specific type ii 5 α -reductase, which converts testosterone circulating in the blood to dihydrotestosterone, and causes a series of reactions by binding to the androgen receptor in the cell, thereby allowing progressive miniaturization and hair loss of the hair follicle until baldness occurs.

The treatment of alopecia is also increasingly gaining attention because patients with alopecia often suffer from psychological problems such as anxiety, depression and even aversion to emotional emotion due to impairment of their own image. At present, the treatment means cannot be generally accepted by the public due to large side effect or high cost, so that the discovery of a novel treatment method has great significance for promoting the public to recognize and receive treatment, and a relevant animal disease model is required to be used as an experimental tool. At present, a common animal model is a mouse model, however, a mouse is greatly different from a human body in aspects of body type, organ size, physiology, pathology and the like, and can not truly simulate normal physiological and pathological states of the human body. The pig is a large animal, is a main meat food supply animal for human for a long time, is similar to human in body size and physiological function, is easy to breed and feed in a large scale, has low requirements on ethics, animal protection and the like, and is an ideal human disease model animal.

Gene editing is a biotechnology that has been greatly developed in recent years, and includes editing technologies from homologous recombination-based gene editing to nuclease-based ZFNs, TALENs, CRISPR/Cas9, and the like, wherein CRISPR/Cas9 technology is currently the most advanced gene editing technology. Currently, gene editing techniques are increasingly applied to the production of animal models.

Disclosure of Invention

The invention relates to a kit and application thereof in constructing an alopecia model pig nuclear transplantation donor cell of high-expression pig II type 5 alpha-reductase. The invention provides a kit and application thereof in constructing recombinant pig cells of high-expression pig II type 5 alpha-reductase, wherein the recombinant pig cells can be used as nuclear transplantation donor cells to prepare cloned pigs, and the cloned pigs can be used as alopecia model pigs.

The invention provides a method for preparing recombinant pig cells, which comprises the following steps: integrating a DNA molecule named as a DNA molecule A into the genome DNA of the pig cell to obtain a recombinant pig cell; the DNA molecule A expresses pig II type 5 alpha-reductase.

Specifically, the porcine type II 5 α -reductase (pSRD 5A2 protein) is represented by SEQ ID NO:15, respectively.

The DNA molecule A is integrated into the COL1A1 gene locus of the genomic DNA of the pig cells.

The porcine type II 5 alpha-reductase is encoded by a porcine type II 5 alpha-reductase gene.

Specifically, the pig type II 5 alpha-reductase gene (pSRD 5A2 gene) is shown as SEQ ID NO:14 from nucleotide 2266 to nucleotide 3030.

Specifically, the DNA molecule A has a pSRD5A2 gene expression cassette.

In the pSRD5A2 gene expression cassette, the expression of pSRD5A2 gene is promoted by the human hEF1 alpha promoter.

Specifically, the human hEF1 alpha promoter is shown as SEQ ID NO:14 from nucleotide 1088 to nucleotide 2265.

The pSRD5A2 gene expression cassette has a Poly (A) downstream of the pSRD5A2 gene.

Specifically, the Poly (A) is EF1 alpha Poly (A).

Specifically, EF1 alpha Poly (A) is shown as SEQ ID NO: nucleotides 3031-3603 in 14.

Specifically, the pSRD5A2 gene expression cassette is shown as SEQ ID NO:14, nucleotides 1088-3603.

Specifically, the DNA molecule A has a resistance screening gene expression cassette.

The resistance selection gene may be a gene encoding a resistance selection protein.

The resistance screening protein is specifically a Neomycin protein.

Specifically, the resistance screening gene expression cassette is shown as SEQ ID NO: nucleotides 3731-5373 in FIG. 14.

The DNA molecule A also comprises a LoxP sequence.

The DNA molecule A specifically comprises 2 LoxP sequences which are respectively shown as SEQ ID NO: nucleotides 3633 to 3666 and nucleotides 5430 to 5463 in 14.

The DNA molecule A also comprises an insulator.

The DNA molecule A specifically comprises 2 insulators which are respectively shown as SEQ ID NO: nucleotides 887-1087 and nucleotides 5484-5685 of 14.

The DNA molecule A sequentially comprises the following sections from upstream to downstream: human hEF1 alpha promoter, pSRD5A2 gene, EF1 alpha Poly (A), loxP sequence, pGK promoter, nucleotide for coding Neomycin protein, bGH Poly (A) and LoxP sequence.

The DNA molecule A sequentially comprises the following sections from upstream to downstream: insulator 1, human hEF1 alpha promoter, pSRD5A2 gene, EF1 alpha Poly (A), loxP sequence, pGK promoter, nucleotide for coding Neomycin protein, bGH Poly (A), loxP sequence and insulator 5.

Specifically, the DNA molecule A is shown as SEQ ID NO: nucleotide numbers 887-5685 of 14.

Specifically, the DNA molecule A is shown as SEQ ID NO: nucleotide numbers 881-5685 in 14.

The "integration of the DNA molecule designated DNA molecule A into the genomic DNA of the pig cells" is carried out in the following manner: introducing a DNA molecule designated as DNA molecule B into a pig cell or introducing a recombinant plasmid having the DNA molecule B into a pig cell; and in the DNA molecule B, the DNA molecule A is provided, an upstream homology arm is arranged at the upstream of the DNA molecule A, and a downstream homology arm is arranged at the downstream of the DNA molecule A, and the upstream homology arm and the downstream homology arm are used for integrating the DNA molecule A into the genome DNA of the pig cells.

The homology arm is directed at the ROSA26 gene, the upstream homology arm is the SH1 left arm, and the downstream homology arm is the SH1 right arm. The left arm of SH1 is shown as SEQ ID NO:3, and the SH1 right arm is shown as SEQ ID NO:3 between 9184 and 10195 nucleotides.

The homology arm is a homology arm aiming at the AAVS1 gene, the upstream homology arm is an SH2 left arm, and the downstream homology arm is an SH2 right arm. The left arm of SH2 is shown as SEQ ID NO:4, the right arm of SH2 is shown as SEQ ID NO:5, respectively.

The homology arm is a homology arm aiming at an H11 locus, the upstream homology arm is an SH3 left arm, and the downstream homology arm is an SH3 right arm. The left arm of SH3 is shown as SEQ ID NO:6, the right arm of SH3 is shown as SEQ ID NO: shown at 7.

The homology arm is directed at the COL1A1 gene, the upstream homology arm is SH4 left arm, and the downstream homology arm is SH4 right arm. The left arm of SH4 is shown as SEQ ID NO:8, the right arm of SH4 is shown as SEQ ID NO: shown at 9.

The homology arm is directed at the COL1A1 gene, the upstream homology arm is an SH4 left arm, and the downstream homology arm is an SH4 right arm. The left arm of SH4 is shown as SEQ ID NO:14, nucleotides 9-880, and the right arm of SH4 is as shown in SEQ ID NO: nucleotides 5686-6412 of 14.

The DNA molecule B sequentially comprises the following sections from upstream to downstream: upstream homology arm, insulator 1, human hEF1 alpha promoter, pSRD5A2 gene, EF1 alpha Poly (A), loxP sequence, pGK promoter, nucleotide for coding Neomycin protein, bGH Poly (A), loxP sequence, insulator 5 and downstream homology arm.

Specifically, the DNA molecule B is shown as SEQ ID NO: nucleotide numbers 9-6412 in 14.

Specifically, the recombinant plasmid with the DNA molecule B is shown as SEQ ID NO: as shown at 14.

The DNA molecule A is integrated into ROSA26 gene or AAVS1 gene or H11 site or COL1A1 gene of the genomic DNA of the pig cells. Preferably the COL1A1 gene.

The DNA molecule A is integrated into the ROSA26 safe harbor insertion site or the AAVS1 safe harbor insertion site or the H11 safe harbor insertion site or the COL1A1 safe harbor insertion site of the genomic DNA of the pig cells. Preferably a COL1A1 safe harbor insertion site.

The integration of the DNA molecule A into the ROSA26 gene of the genomic DNA of the pig cells means that the DNA molecule A is inserted between the left arm of SH1 and the right arm of SH1 in the genomic DNA; the left arm of SH1 is shown as SEQ ID NO:3, and the SH1 right arm is shown as SEQ ID NO:3 between 9184 and 10195 nucleotides.

The integration of the DNA molecule A into the AAVS1 gene of the genomic DNA of the pig cells means that the DNA molecule A is inserted between the SH2 left arm and the SH2 right arm in the genomic DNA; the left arm of SH2 is shown as SEQ ID NO:4, the right arm of SH2 is shown as SEQ ID NO:5, respectively.

Integration of the DNA molecule a into the H11 site of the genomic DNA of the pig cells means insertion of the DNA molecule a between the SH3 left arm and the SH3 right arm in the genomic DNA; the left arm of SH3 is shown as SEQ ID NO:6, the right arm of SH3 is shown as SEQ ID NO: shown at 7.

The integration of the DNA molecule A into the COL1A1 gene of the genomic DNA of the pig cells means that the DNA molecule A is inserted into the genomic DNA between the SH4 left arm and the SH4 right arm; the left arm of SH4 is shown as SEQ ID NO:8, the right arm of SH4 is shown as SEQ ID NO: shown at 9.

The integration of the DNA molecule A into the COL1A1 gene of the genomic DNA of the pig cells means that the DNA molecule A is inserted into the genomic DNA between the SH4 left arm and the SH4 right arm; the left arm of SH4 is shown as SEQ ID NO:14, nucleotides 9-880, and the right arm of SH4 is shown in SEQ ID NO: nucleotides 5686-6412 of 14.

In the method, a recombinant plasmid with the DNA molecule B and two auxiliary plasmids are introduced into a pig cell together; the two helper plasmids are sgRNA plasmid and Cas9 plasmid;

transcribing the sgRNA plasmid to obtain a specific sgRNA; the specific sgRNA is sgRNA _ROSA26-g3 、sgRNA _AAVS1-g4 、sgRNA _H11-g1 Or sgRNA _COL1A1-g3 ；sgRNA _ROSA26-g3 The target sequence binding region of (a) is as shown in SEQ ID NO:10 at nucleotides 1 to 20; sgRNA _AAVS1-g4 The target sequence binding region of (a) is as shown in SEQ ID NO:11, nucleotides 1-20; sgRNA _H11-g1 The target sequence binding region of (3) is as shown in SEQ ID NO:12, nucleotides 1 to 20; sgRNA _COL1A1-g3 The target sequence binding region of (a) is as shown in SEQ ID NO:13, nucleotides 1 to 20;

the Cas9 plasmid expresses Cas9 protein.

The target sequence binding region refers to a region in the sgRNA that binds to a target sequence (the target sequence is located in a target region of a target gene).

The Cas9 plasmid can be specifically a plasmid pKG-GE3.

Specifically, the sgRNA plasmid is obtained by inserting a coding sequence of a target sequence binding region of a specific sgRNA into a pKG-U6gRNA vector by means of a restriction enzyme BbsI.

The molar ratio of the recombinant plasmid with the DNA molecule B, the sgRNA plasmid and the Cas9 plasmid can be specifically 1:3:1.

the proportion of the pig cell, the recombinant plasmid with the DNA molecule B, the sgRNA plasmid and the Cas9 plasmid can be specifically as follows: about 20 million porcine cells: 1.3. Mu.g of recombinant plasmid with the DNA molecule B: 0.8 μ g sgRNA plasmid: 0.9 μ g Cas9 plasmid.

Specifically, the ROSA26 safe harbor insertion site and the peripheral region thereof in the genome of the pig are shown as SEQ ID NO: shown at 16.

Specifically, the AAVS1 safe harbor insertion site and the peripheral region thereof in the pig genome are shown as SEQ ID NO: shown at 17.

Specifically, the H11 safe harbor insertion site and the peripheral region thereof in the pig genome are shown as SEQ ID NO:18, respectively.

Specifically, the COL1A1 safe harbor insertion site and the peripheral region thereof in the pig genome are shown as SEQ ID NO:19, respectively.

The recombinant porcine cells are homozygous recombinant (i.e., the DNA molecules A are integrated at the same positions of two homologous chromosomes, respectively).

The recombinant porcine cells are heterozygous recombinant (i.e., the DNA molecule A is integrated into a homologous chromosome).

The invention also provides a kit comprising any one of the DNA molecules B.

The invention also provides a kit which comprises the recombinant plasmid containing any one of the DNA molecules B.

The kit further includes the sgRNA plasmid and the Cas9 plasmid.

the kit may also include porcine cells.

The invention also protects the application of any one of the DNA molecules B in the preparation of the kit.

The invention also protects the application of the recombinant plasmid with any one of the DNA molecules B in the preparation of a kit.

The invention also protects the application of the recombinant plasmid, sgRNA plasmid and Cas9 plasmid with any one of the DNA molecules B in the preparation of a kit.

The use of any one of the above kits is (a) or (b): (a) Preparing a recombinant pig cell over-expressing a pig type II 5 alpha-reductase gene; (b) preparing the alopecia model pig.

The invention also protects the application of any one of the DNA molecules B, the recombinant plasmid with any one of the DNA molecules B or any one of the kits, and the application is as follows (a) or (b): (a) Preparing a recombinant pig cell over-expressing a pig type II 5 alpha-reductase gene; (b) preparing the alopecia model pig.

The pig cell is a cell derived from a male pig.

The pig cell is a somatic cell derived from a male pig.

The porcine cells are porcine primary fibroblasts.

The porcine cells are primary fibroblasts derived from male pigs.

The pig can be any variety of pig, and preferably, the pig can be a fragrant pig from Jiang.

The pig may be a newborn pig.

The plasmid pKG-GE3 has a specific fusion gene; the specific fusion gene encodes a specific fusion protein;

the specific fusion protein sequentially comprises the following elements from N end to C end: two nuclear localization signals, a Cas9 protein, two nuclear localization signals, a P2A peptide, a fluorescent reporter protein, a T2A peptide and a resistance screening marker protein;

in the plasmid pKG-GE3, the expression of the specific fusion gene is started by the EF1a promoter;

the plasmid pKG-GE3 has a WPRE sequence element, a 3' LTR sequence element and a bGH poly (A) signal sequence element downstream of the specific fusion gene.

The plasmid pKG-GE3 comprises the following elements in this order: CMV enhancer, EF1a promoter, the specific fusion gene, WPRE sequence element, 3' LTR sequence element, bGH poly (A) signal sequence element.

In the specific fusion protein, two nuclear localization signals at the upstream of the Cas9 protein are SV40 nuclear localization signals, and two nuclear localization signals at the downstream of the Cas9 protein are nucleoplamin nuclear localization signals.

In the specific fusion protein, the fluorescent reporter protein can be EGFP protein.

In the specific fusion protein, the resistance screening marker protein can be Puromycin resistance protein.

The amino acid sequence of the P2A peptide is "ATNFSLLKQAGDVEENPGP" (the cleavage site is between the first and second amino acid residues from the C-terminus).

The amino acid sequence of the T2A peptide is "EGRGSLLTCGDVEENPGP" (the cleavage site is between the first and second amino acid residues from the C-terminus).

The specific fusion gene is specifically shown in SEQ ID NO:1, nucleotides 911-6706.

The CMV enhancer is as set forth in SEQ ID NO:1 from nucleotide 395 to nucleotide 680.

The EF1a promoter is shown as SEQ ID NO:1, nucleotides 682-890.

The WPRE sequence element is shown as SEQ ID NO:1, nucleotides 6722-7310.

3' LTR sequence element is shown as SEQ ID NO:1, nucleotide numbers 7382-7615.

The bGH poly (a) signal sequence element is as set forth in SEQ ID NO:1, nucleotides 7647-7871.

The plasmid pKG-GE3 is specifically shown in SEQ ID NO:1 is shown.

In plasmid pKG-U6gRNA, the plasmid has the sequence of SEQ ID NO:2 from 2280 th to 2637 th nucleotides.

The plasmid pKG-U6gRNA is specifically shown in SEQ ID NO:2, respectively.

Specifically, sgRNA _ROSA26-g3 As shown in SEQ ID NO: shown at 10.

Specifically, sgRNA _AAVS1-g4 As shown in SEQ ID NO: shown at 11.

Specifically, sgRNA _H11-g1 As shown in SEQ ID NO: shown at 12.

Specifically, sgRNA _COL1A1-g3 As shown in SEQ ID NO: shown at 13.

The invention also protects the recombinant porcine cell prepared by any one of the methods.

Specifically, the recombinant porcine cell can be a recombinant porcine cell as follows: the genomic DNA of recombinant porcine cells differs from porcine primary fibroblasts only in that: the gene sequence shown in SEQ ID NO:14, nucleotide 881-5685.

Any one of the above recombinant porcine cells: homozygous recombination (i.e., identical insertions of two homologous chromosomes) occurs.

The recombinant porcine cells are homozygously recombined (namely, DNA molecules shown by nucleotides 881-5685 in SEQ ID NO:14 are inserted between the left arm of SH4 and the right arm of SH4 of two homologous chromosomes).

The recombinant porcine cells are heterozygous (namely, a DNA molecule shown by nucleotides 881-5685 in SEQ ID NO:14 is inserted between the left arm of SH4 and the right arm of SH4 of a homologous chromosome).

The invention also protects the application of the recombinant porcine cells in preparing the alopecia model pig.

The recombinant pig cells are used as nuclear transfer donor cells to clone somatic cells, so that cloned pigs, namely the alopecia model pigs, can be obtained. The model pig can be used in the biomedical fields of next-step drug screening and drug effect evaluation, gene and cell treatment, alopecia mechanism research and the like. The model pig can provide a powerful tool for researching human AGA pathogenesis or exploring related treatment methods.

Compared with the prior art, the invention has at least the following beneficial effects:

(1) The subject of the invention (pig) has better applicability than other animals (rat, primate).

Rodents such as rats and mice have great differences from humans in body types, organ sizes, physiology, pathology and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that over 95% of drugs validated to be effective in large mice are not effective in human clinical trials. In large animals, primates are animals that have a close relationship with humans, but are small in size, late in sexual maturity (mating starts at age 6-7), and are single-birth animals, and the population propagation speed is extremely slow, and the raising cost is high. In addition, the cloning efficiency of the primate is low, the difficulty is high and the cost is high.

However, pigs, which are animals related to humans other than primates, do not have the above-mentioned disadvantages, and have body types, body weights, organ sizes, and the like similar to those of humans, and are very similar to those of humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. Meanwhile, the pigs have early sexual maturity (4-6 months), high reproductive capacity and multiple piglets, and can form a large group within 2-3 years. In addition, the cloning technology of the pig is very mature, and the cloning and feeding cost is much lower than that of a primate.

(2) The invention aims at the pig genome to carry out exploration on the expression condition of 4 safe harbor site genes after knocking in, and screens out the optimal safe harbor site of the pig genome for inserting the exogenous gene, thereby effectively improving the expression condition of the target gene after knocking in the gene.

(3) The homozygous knock-in cloned pig of the pSRD5A2 gene expression cassette can be directly obtained by cloning somatic cell nuclear transfer animals by using the homozygous knock-in single-cell cloned strain of the pSRD5A2 gene expression cassette obtained by the invention, and the homozygous insert gene can be stably inherited. Furthermore, the method can be used in the biomedical fields of AGA, such as drug screening and drug effect evaluation, gene and cell therapy, and pathogenesis research.

In mouse model making, fertilized egg is usually injected with gene editing material and then embryo transplantation is carried out, and because the probability of directly obtaining homozygous inserted offspring is very low (less than 1%), offspring hybridization breeding is needed, which is not suitable for making large animal (such as pig) model with longer gestation period. Therefore, the method adopts the primary cell in-vitro editing and screening positive editing single cell cloning method with great technical difficulty and high challenge, and directly obtains the corresponding model pig by the somatic cell nuclear transfer animal cloning technology at the later stage, thereby greatly shortening the manufacturing period of the model pig and saving manpower, material resources and financial resources.

(4) The invention firstly over-expresses the pig II type 5 alpha-reductase gene, and obtains single cell clone knocked in by a homozygous expression frame through verification.

The invention obtains the recombinant pig cell of the over-expression pig II type 5 alpha-reductase gene by a gene editing technology, and the recombinant pig cell can be used as a nuclear transplantation cell donor to clone and produce the alopecia model pig at the later stage, is beneficial to research and reveal the pathogenesis of AGA, can be used for research on drug screening, drug effect detection, gene and cell treatment and the like, can provide effective experimental data for further clinical application, and further provides a powerful experimental means for preventing and treating human AGA. The invention has great application value for the research of human AGA pathogenesis, the research and the development of medicaments and preclinical tests.

Drawings

FIG. 1 is a schematic structural view of plasmid PB-1G2R 3-puro-ROSA 26.

FIG. 2 is a graph of the green fluorescence expression of GFP regulated by different harbor safety loci.

FIG. 3 shows the fluorescent quantitative PCR results of the transcriptional level of GFP gene regulated by different safe harbor loci.

FIG. 4 shows the results of FACS detection of the expression of GFP protein regulated by different harbor safety loci.

FIG. 5 is a schematic diagram of the structure of plasmid EF1 α -pSRD5A2.

FIG. 6 shows the sequencing results of the COL1A1 gene sequence and the insulator 1 adaptor sequence.

FIG. 7 shows the sequencing result of the adaptor sequence of insulator 1 and EF1 alpha promoter in the pSRD5A2 gene expression cassette.

FIG. 8 shows the sequencing result of the adapter sequence of the EF 1. Alpha. Promoter and pSRD5A2 gene in the expression cassette of pSRD5A2 gene.

FIG. 9 shows the sequencing of the adapter sequence of the pSRD5A2 gene with EF 1. Alpha. Poly (A) in the expression cassette of the pSRD5A2 gene.

FIG. 10 shows the sequencing result of the adaptor sequence of EF 1. Alpha. Poly (A) and LoxP (a part of the Neomycin gene expression cassette) in the pSRD5A2 gene expression cassette.

FIG. 11 shows the result of detecting the transcription level of pSRD5A2 gene of single cell clone.

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The recombinant plasmids constructed in the examples were all sequence verified. Complete culture broth (% by volume): 15% fetal bovine serum (Gibco) +83% DMEM medium (Gibco) +1% Penicilin-Streptomyces (Gibco) +1% HEPES (Solarbio). Cell culture conditions: 37 ℃,5% of CO ₂ 、5％O ₂ The constant temperature incubator.

The porcine primary fibroblasts used in example 1 were prepared from porcine ear tissue of Jiangxiang pigs at birth. The porcine primary fibroblasts used in example 2 were prepared from ear tissue of Jiangxiang pigs (males) at birth. The method for preparing the primary pig fibroblast comprises the following steps: (1) taking 0.5g of pig ear tissue, removing hair and bone tissue, soaking in 75% alcohol for 30-40s, washing with PBS buffer containing 5% (volume ratio) Penicillin-Streptomycin (Gibco) for 5 times, and washing with PBS buffer for one time; (2) shearing the tissue with scissors, digesting with 5mL of 0.1% collagenase solution (Sigma) at 37 ℃ for 1h, centrifuging 500g for 5min, and removing the supernatant; (3) resuspending the precipitate with 1mL of complete culture solution, spreading into a 10cm diameter cell culture dish containing 10mL of complete culture solution and sealed with 0.2% gelatin (VWR), and culturing until the bottom of the dish is 60% full of cells; (4) after completion of step (3), the cells were digested with trypsin and collected, and then resuspended in complete medium. Used for carrying out subsequent electrotransfer experiments.

eEF1a-mNLS-hSpCas9-EGFP-PURO is called plasmid pKG-GE3 (circular plasmid) for short, and is shown as SEQ ID NO:1 is shown. The amino acid sequence of SEQ ID NO:1, nucleotides 395 to 680 form a CMV enhancer, nucleotides 682 to 890 form an EF1a promoter, nucleotides 986 to 1006 encode a Nuclear Localization Signal (NLS), nucleotides 1016 to 1036 encode a Nuclear Localization Signal (NLS), nucleotides 1037 to 5161 encode a Cas9 protein, nucleotides 5162 to 5209 encode a Nuclear Localization Signal (NLS), nucleotides 5219 to 5266 encode a Nuclear Localization Signal (NLS), nucleotides 5276 to 5332 encode a P2A peptide (the amino acid sequence of the P2A peptide is "ATNFSLLKQAGDVEENPGP", the cleavage position is between the first and second amino acid residues from the C-terminus), nucleotides 5333 to 6046 encode an EGFP protein, nucleotides 6056 to 6109 encode a T2A peptide (the amino acid sequence of the T2A peptide is "EGRGSLLTCGDVEENPGP", the cleavage position is between the first and second amino acid residues from the C-terminus), nucleotides 6110 to 6703 encode a protein (the amino acid sequence of the WPRE 677310 to 6747), and nucleotides 677647 constitute a WPbro element (GH 7647), and codon 761 31. SEQ ID NO:1, 911-6706 forms a fusion gene, expressing the fusion protein. Due to the presence of P2A peptide and T2A peptide, the fusion protein spontaneously forms the following three proteins: proteins with Cas9 protein, proteins with EGFP protein and proteins with Puro protein. Is described in patent application 202011170395.1 (application publication No. CN 112522261A; application publication No. 2021.03.19).

pKG-U6gRNA vector, also known as plasmid pKG-U6gRNA (circular plasmid), is set forth in SEQ ID NO:2, respectively. SEQ ID NO:2, the 2280 th to 2539 th nucleotides form an hU6 promoter, and the 2558 th to 2637 th nucleotides are used for transcription to form a gRNA framework. When the recombinant plasmid is used, a DNA molecule (a target sequence binding region for forming gRNA through transcription) with about 20bp is inserted into a plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in a cell to obtain the gRNA. Is described in patent application 202011170395.1 (application publication No. CN 112522261A; application publication No. 2021.03.19).

Example 1 selection of optimal safe harbor site for site-directed insertion of foreign Gene into pig genome

1. Construction of different safe harbor site Donor vectors containing GFP Gene

Plasmids PB-1G 2R3-puro-ROSA 26, PB-1G 2R3-puro-AAVS 1, PB-1G 2R3-puro-H11, and PB-1G 2R3-puro-COL 1A1 were constructed. All four plasmids were circular plasmids.

The plasmid PB-1G2R 3-puro-ROSA26 is shown as SEQ ID NO:3, the structure is schematically shown in figure 1.SEQ ID NO:3, nucleotides 9 to 339 form the porcine genome region 5 'of the ROSA26 safe harbor insertion site (SH 1 left arm), and nucleotides 9184 to 10195 form the porcine genome region 3' of the ROSA26 safe harbor insertion site (SH 1 right arm). The amino acid sequence of SEQ ID NO:3, nucleotides 346-546, 3132-3531, 6506-6706 and 8975-9175 respectively constitute 4 different insulator regions. SEQ ID NO:3, the 637-1209 th nucleotide constitutes EF-1 alpha poly (A) signal, the 1216-1935 th nucleotide encodes EGFP protein, the 1954-3131 th nucleotide constitutes EF-1 alpha promoter, the 3543-4042 th nucleotide constitutes PGK promoter, the 4059-4769 th nucleotide encodes mCheerry protein, the 4791-5015 th nucleotide constitutes bGH poly (A) signal, the 5054-6504 th nucleotide is loxP-puro-loxP expression frame region, the 6969-7233 th nucleotide constitutes beta-globin poly (A) signal, and the 7259-8974 th nucleotide constitutes pCAG promoter.

The plasmid PB-1G2R 3-puro-AAVS1 differs from the plasmid PB-1G2R 3-puro-ROSA26 only in that: the SH1 left arm was replaced with the pig genome region 5 'of the AAVS1 safety harbor insertion site (SH 2 left arm, SH2 left arm is shown in SEQ ID NO: 4) and the SH1 right arm was replaced with the pig genome region 3' of the AAVS1 safety harbor insertion site (SH 2 right arm, SH2 right arm is shown in SEQ ID NO: 5).

The plasmid PB-1G2R 3-puro-H11 differs from the plasmid PB-1G2R 3-puro-ROSA26 only in that: the SH1 left arm was replaced with the 5 'pig genome region of the H11 safety harbor insertion site (SH 3 left arm, SH3 left arm is shown in SEQ ID NO: 6) and the SH1 right arm was replaced with the 3' pig genome region of the H11 safety harbor insertion site (SH 3 right arm, SH3 right arm is shown in SEQ ID NO: 7).

The plasmid PB-1G2R 3-puro-COL1A1 differs from the plasmid PB-1G2R 3-puro-ROSA26 only in that: the SH1 left arm was replaced with the pig genome region 5 'of the COL1A1 safety harbor insertion site (SH 4 left arm, SH4 left arm is shown in SEQ ID NO: 8) and the SH1 right arm was replaced with the pig genome region 3' of the COL1A1 safety harbor insertion site (SH 4 right arm, SH4 right arm is shown in SEQ ID NO: 9).

2. Efficient cutting target screening of safe harbor sites of porcine ROSA26, AAVS1, H11 and COL1A1 genomes

Through early screening, the efficient cutting target of the ROSA26 safe harbor site is sgRNA _ROSA26-g3 (the cutting efficiency is 38%), and the efficient cutting target of the AAVS1 safe harbor site is sgRNA _AAVS1-g4 (cleavage efficiency of 30%) and the efficient cleavage target of the H11 safe harbor site is sgRNA _H11-g1 (cleavage efficiency is 60%), and the efficient cleavage target of the COL1A1 safe harbor site is sgRNA _COL1A1-g3 (cleavage efficiency 56%).

The target sequences are as follows:

sgRNA _ROSA26-g3 and (3) target point: 5'-GAAGGAGCAAACTGACATGG-3';

sgRNA _AAVS1-g4 and (3) target point: 5'-TGCAGTGGGTCTTTGGGGAC-3';

sgRNA _H11-g1 and (3) target point: 5'-TTCCAGGAACATAAGAAAGT-3';

sgRNA _COL1A1-g3 and (3) target point: 5'-GCAGTCTCAGCAACCACTGA-3'.

3. Preparation of safe harbor site gRNA recombinant vector

The plasmid pKG-U6gRNA was digested with the restriction enzyme BbsI, and the vector backbone (approximately 3kb linear large fragment) was recovered.

ROSA26-g3-S and ROSA26-g3-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. A double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (ROSA 26-g 3). Plasmid pKG-U6gRNA (ROSA 26-g 3) expresses the nucleic acid sequence of SEQ ID NO:10 sgRNA _ROSA26-g3 。

AAVS1-g4-S and AAVS1-g4-A were synthesized separately, mixed and annealed to obtain double-stranded DNA molecules having cohesive ends. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (AAVS 1-g 4). Plasmid pKG-U6gRNA (AAVS 1-g 4) expresses the nucleic acid sequence of SEQ ID NO:11 sgRNA _AAVS1-g4 。

H11-g1-S and H11-g1-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having a cohesive end was ligated to a vector backbone to obtain a plasmid pKG-U6gRNA (H11-g 1). Plasmid pKG-U6gRNA (H11-g 1) expresses the nucleic acid sequence of SEQ ID NO:12 sgRNA _H11-g1 。

COL1A1-g3-S and COL1A1-g3-A were synthesized separately, and then mixed and annealed to obtain a double-stranded DNA molecule having a cohesive end. The double-stranded DNA molecule having the cohesive ends was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (COL 1A1-g 3). Plasmid pKG-U6gRNA (COL 1A1-g 3) expresses the nucleic acid sequence of SEQ ID NO:13 sgRNA _COL1A1-g3 。

ROSA26-g3-S, ROSA-g 3-A, AAVS-g 4-S, AAVS-g 4-A, H-g 1-S, H11-g1-A, COL A1-g3-S and COL1A1-g3-A are single-stranded DNA molecules.

ROSA26-g3-S：caccGAAGGAGCAAACTGACATGG；

ROSA26-g3-A：aaacCCATGTCAGTTTGCTCCTTC。

AAVS1-g4-S：caccgTGCAGTGGGTCTTTGGGGAC；

AAVS1-g4-A：aaacGTCCCCAAAGACCCACTGCAc。

H11-g1-S：caccgTTCCAGGAACATAAGAAAGT；

H11-g1-A：aaacACTTTCTTATGTTCCTGGAAc。

COL1A1-g3-S：caccGCAGTCTCAGCAACCACTGA；

COL1A1-g3-A：aaacTCAGTGGTTGCTGAGACTGC。

sgRNA _ROSA26-g3 (SEQ ID NO：10)：

GAAGGAGCAAACUGACAUGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

sgRNA _AAVS1-g4 (SEQ ID NO：11)：

UGCAGUGGGUCUUUGGGGACguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

sgRNA _H11-g1 (SEQ ID NO：12)：

UUCCAGGAACAUAAGAAAGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

sgRNA _COL1A1-g3 (SEQ ID NO：13)：

GCAGUCUCAGCAACCACUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu。

4. Fluorescent Donor vectors (namely different safety harbor site vectors containing exogenous gene GFP), sgRNA vectors and Cas9 vectors (namely plasmid pKG-GE 3) containing homologous arms on two sides of different safety harbor insertion sites for mixed electrotransformation of porcine primary fibroblasts and detection of fluorescence intensity of cell GFP

1. Cotransfection

First group (ROSA 26 group): the plasmid PB-1G2R 3-puro-ROSA26, the plasmid pKG-U6gRNA (ROSA 26-g 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 1.26. Mu.g of plasmid PB-1G2R 3-puro-ROSA26: 0.82. Mu.g of plasmid pKG-U6gRNA (ROSA 26-g 3): 0.92. Mu.g of plasmid pKG-GE3; namely, the molar ratio of the 3 plasmids is as follows in sequence: 1:3:1.

second group (AAVS 1 group): the plasmid PB-1G2R 3-puro-AAVS1, the plasmid pKG-U6gRNA (AAVS 1-g 4) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 1.26. Mu.g of plasmid PB-1G2R 3-puro-AAVS1: 0.82. Mu.g plasmid pKG-U6gRNA (AAVS 1-g 4): 0.92. Mu.g of plasmid pKG-GE3; namely, the molar ratio of the 3 plasmids is as follows in sequence: 1:3:1.

third group (H11 group): the plasmid PB-1G2R 3-puro-H11, the plasmid pKG-U6gRNA (H11-g 1) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 1.26. Mu.g of plasmid PB-1G2R 3-puro-H11: 0.82. Mu.g of plasmid pKG-U6gRNA (H11-g 1): 0.92. Mu.g of plasmid pKG-GE3; namely, the molar ratio of the 3 plasmids is as follows in sequence: 1:3:1.

fourth group (COL 1A1 group): the plasmid PB-1G2R 3-puro-COL1A1, the plasmid pKG-U6gRNA (COL 1A1-g 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 1.26. Mu.g of plasmid PB-1G2R 3-puro-COL1A1: 0.82. Mu.g of plasmid pKG-U6gRNA (COL 1A1-g 3): 0.92. Mu.g of plasmid pKG-GE3; namely, the molar ratio of the 3 plasmids is as follows in sequence: 1:3:1.

and a fifth group: carrying out electrotransformation operation on primary pig fibroblasts without adding any plasmid according to isoelectric parameters.

Co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransformation apparatus (parameters set at 1450V, 10ms, 3 pulses).

2. After step 1 is completed, the culture is carried out for 12 to 24 hours by using the complete culture solution, and then the culture is carried out by replacing a new complete culture solution. The total time of incubation was 48 hours.

3. After the completion of step 2, the cells were cultured in a complete culture medium containing 1.5. Mu.g/mL puromycin for 3 weeks (a new complete culture medium containing 1.5. Mu.g/mL puromycin was added every 2 days), and the GFP green fluorescence was continuously observed and photographed, and the level of the expression efficiency of the foreign gene at the safe harbor site was judged by the intensity of the GFP fluorescence expression.

One week after puromycin screening, the fluorescence intensity of the ROSA26 and COL1A1 safety harbor site test group is obviously stronger than that of the AAVS1 and H11 test group. After two weeks of puromycin screening, the fluorescence intensity is from strong to weak: COL1A1> ROSA26> H11> AAVS1, wherein the fluorescence intensity of the H11 group is not very uniform, the fluorescence intensity of the ROSA26 group is relatively uniform and relatively high, the fluorescence expression of the AAVS1 group cells is the weakest, and the fluorescence of the COL1A1 group cells is the most and most intense. After the puromycin is continuously screened for three weeks, the fluorescence intensity is from strong to weak: COL1A1> ROSA26> H11> AAVS1, the photograph is shown in FIG. 2.

5. GFP Gene transcript level detection

To compare the differences in mRNA transcription levels after the GFP gene was integrated into four different safe harbor sites, it was possible to determine whether the GFP gene could be involved in the regulation of expression and influence on the expression level. Designing a pair of primers at the exon of GFP gene, and taking the fourth stepAfter three weeks of puromycin screening, total RNA was extracted and reverse transcribed into cDNA, the transcript level of primary cells after integration of GFP gene at four different safe harbor sites was examined, while the quantitative results obtained with the cells of the fifth group (plasmid-free control electrotransfer) were used as controls. GAPDH gene as reference gene according to 2 ^-ΔCt The method carries out calculation.

Primers for detection of GFP gene: AGATCCGCCACAACATCGAG; r is GTCCATGCCGAGAGTGATCC.

Primers for detecting GAPDH gene: GGTCGGAGTGAACGGATTTG; r is CCATTTGATGTTGGCGGGAT.

Data analysis was performed using SPSS statistical software, expressed as (mean. + -. Standard deviation), and statistical analysis was performed using two-way analysis of variance. 2 ^-ΔCt The results showed that the GFP expression levels in AAVS1 and H11 groups were low, that in ROSA26 and COL1A1 groups were high, and that the difference in GFP transcription levels between COL1A1 and ROSA26 groups was very significant (P) compared with AAVS1 and H11 groups after three weeks of puromycin screening (P)<0.01)。2 ^-ΔCt The values are shown in table 1, and the results of the significance analysis of the differences are shown in fig. 3.

TABLE 12 ^-ΔCt Value information

From the results of real-time fluorescence quantitative PCR of GFP gene and fluorescence signal intensity three weeks after culturing the cells, it was concluded that, among the four genomic safe harbor sites ROSA26, AAVS1, H11, and COL1A1, the COL1A1 site had the best expression effect when a foreign gene was inserted.

6. FACS detection of protein expression level of GFP Gene

To compare the expression of GFP after the GFP gene was integrated into four different safe harbor sites. After three weeks of puromycin screening in step four, the cells were electroporated by trypsinization, centrifuged at 400g for 4min and the supernatant discarded. The cells were resuspended in 1mL of complete medium and the cell suspensions were transferred separately into flow tubes. GFP signals were detected in the FITC channel of a BD FACCSmolody flow cytometer, and 5X 10 GFP signals were collected ⁴ The individual cells were analyzed and the results are shown in FIG. 4.

The results showed that the GFP fluorescence signal intensity COL1A1> ROSA26> H11> AAVS1.

Therefore, combining the above results, the COL1A1 site is the safe harbor site of the porcine primary cell which most efficiently expresses the foreign gene among the four safe harbor sites ROSA26, AAVS1, H11 and COL1A1.

Example 2 preparation of Single cell clone with pSRD5A2 Gene expression cassette site-directed insertion into the COL1A1 safe harbor site of genome

Porcine SRD5A2 gene (pSRD 5A2 gene) information: encodes type II 5 alpha-reductase (5-alpha reductase type 2); (ii) Sus scrofa; is located on pig chromosome 3; geneID is 397048. The amino acid sequence of the pig II type 5 alpha-reductase is shown as SEQ ID NO: shown at 15.

1. Construction of EF1 alpha-pSRD 5A2 Donor vector

The EF1 alpha-pSRD 5A2 Donor vector is the plasmid EF1 alpha-pSRD 5A2.

Plasmid EF1 α -pSRD5A2 is as shown in SEQ ID NO:14, which is a circular plasmid, and the structure schematic diagram is shown in FIG. 5.SEQ ID NO:14, the 9 th to 880 th nucleotides are a pig genome region (SH 4 left arm) at the 5' end of a COL1A1 safe harbor insertion site, the 887 th to 1087 th nucleotides are insulators (named as insulator 1 and insulator 1), the 1088 th to 2265 th nucleotides are human hEF1 alpha promoters, the 2266 th to 3030 th nucleotides are pSRD5A2 genes, the 3031 th to 3603 th nucleotides are EF1 alpha Poly (A), the 3633 th to 3666 th nucleotides are LoxP sequences, the 3731 th to 4230 th nucleotides are pGK promoters, and the 4308 th to 5111 th nucleotides encode Neomycin protein (short for Neo) ^R Protein), the 5149-5373 th nucleotide is bGH Poly (A), the 5430-5463 th nucleotide is a LoxP sequence, the 5484-5685 th nucleotide is an insulator (named as insulator 5 and insulator 5), and the 5686-6412 th nucleotide is a pig genome region (SH 4 right arm) at the 3' end of the COL1A1 safety harbor insertion site. The Neomycin protein is a Neomycin resistance protein. Neomycin (Geneticin), also known as G418 or Geneticin.

2. Cotransfection

The plasmid EF1 alpha-pSRD 5A2, the plasmid pKG-U6gRNA (COL 1A1-g 3) and the plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. Proportioning: about 20 million porcine primary fibroblasts: 1.3 μ g plasmid EF1 α -pSRD5A2: 0.8. Mu.g of plasmid pKG-U6gRNA (COL 1A1-g 3): 0.9. Mu.g of plasmid pKG-GE3; namely, the molar ratio of the 3 plasmids is as follows in sequence: 1:3:1.

co-transfection was performed by electroporation using a mammalian nuclear transfection kit (Neon kit, thermofeisher) and a Neon TM transfection system electrotransfer instrument (parameters set at 1450V, 10ms, 3 pulses).

The plasmids pKG-GE3 and pKG-U6gRNA (COL 1A1-g 3) function to create DNA double strand breaks in the porcine genomic DNA in order to increase the homologous recombination rate. The plasmid EF1 alpha-pSRD 5A2 is subjected to homologous recombination with the pig genome DNA, and a foreign target gene fragment (namely a DNA molecule shown as nucleotides 881-5685 in SEQ ID NO: 14) is inserted between the left arm of SH4 and the right arm of SH4 in the pig genome DNA.

3. Neomycin pressure screen

1. Screening positive cells inserted with exogenous target gene fragment

(1) And after the second step is completed, culturing the transformed cells by adopting the complete culture solution for 16-18 hours, and then replacing a new complete culture solution for culturing. The total time of incubation was 48 hours.

(2) After completion of step (1), the selection culture was carried out by replacing the whole culture medium containing 1.5mg/mL of G418 with a fresh whole culture medium containing 1.5mg/mL of G418 every day for 3 weeks.

When the cells were cultured for 1 week, the cells died a lot.

When the screening culture is carried out for 2 weeks, the cells die sporadically, part of positive clones begin to divide and proliferate, and the number of the cells is increased continuously.

The purpose of the selection at week 3 of culture was to allow complete degradation of intracellular plasmid to exclude false positive cell clones.

(3) After completion of step (2), the cells were harvested and cultured again for 2 passages (1 passage every 2 days) using complete medium without G418, and the cells were returned to good condition for the next single cell sorting.

2. Single cell sorting and enlarged culture

(1) After completion of step 1, the cells were collected, digested with trypsin, neutralized with complete medium, centrifuged at 500G for 5min, the supernatant was discarded, the pellet was resuspended and diluted appropriately with 1mL of complete medium, the cells were picked up with a pipette and transferred to a 96-well plate (100. Mu.l of complete medium was added in advance per well) (one 96-well plate per cell group, one cell per well), cultured for 2 days, replaced with complete medium containing 1.5mg/mL G418, and then replaced with new complete medium containing 1.5mg/mL G418 every 2 to 3 days, during which the growth of the cells per well was observed with a microscope, and wells without cells and non-single cell clones were excluded.

(2) After the cells in the wells of the 96-well plate in step (1) grew to the bottom of the wells (about 2 weeks or so), cells were digested with trypsin and collected, 2/3 of the cells were seeded into a 6-well plate containing complete culture broth, and the remaining 1/3 of the cells were collected in a 1.5mL centrifuge tube.

(3) When the cells in the wells of the 6-well plate in step (2) reached 50% fullness, the cells were digested with 0.25% (Gibco) trypsin and collected, and the cells were cryopreserved using a cell cryopreservation solution (90% complete medium +10% dmso, vol.).

4. Genome level identification of COL1A1 safe harbor site fixed-point inserted exogenous target gene fragment

To examine whether or not the COL1A1 safe harbor site of the cell genome was successfully inserted with a targeted foreign gene fragment. And (3) taking the centrifuge tube in the step (2) in the step (III), extracting cell genome DNA, performing PCR amplification by using specific primer pairs (the specific primer pairs are respectively a primer pair consisting of sh4-Lr-JDF1414 and sh4-Lr-JDR5965, a primer pair consisting of sh4-Rr-JDF282 and sh4-Rr-JDR4723, and a primer pair consisting of sh4-wt-JDF1085 and sh4-wt-JDR 1560), and performing electrophoresis. Porcine primary fibroblasts were used as wild type control (WT).

A primer pair consisting of sh4-Lr-JDF1414 and sh4-Lr-JDR5965 is used for identifying whether the recombination of EF1 alpha-pSRD 5A2 at the 5' end of the porcine COL1A1 safe harbor insertion site is successful or not (the target sequence is 4552bp, and the obtained amplification product of about 4552bp represents the success of the recombination); a primer pair consisting of sh4-Rr-JDF282 and sh4-Rr-JDR4723 is used for identifying whether the recombination of EF1 alpha-pSRD 5A2 at the 3' end of the porcine COL1A1 safe harbor insertion site is successful or not (the target sequence is 4442bp, and the obtained amplification product of about 4442bp indicates the success of the recombination); the primer pair consisting of sh4-wt-JDF1085 and sh4-wt-JDR1560 is used for identifying whether the exogenous target gene fragment inserted into the porcine COL1A1 safe harbor site at a fixed point is homozygous or heterozygous (the genomic DNA of the wild type control can amplify a 476bp fragment, and the recombinant cell cannot amplify the inserted exogenous target gene fragment because the inserted exogenous target gene fragment is too large, so that if the amplification product is not displayed, the cell is homozygous for inserting the exogenous target gene fragment, and if the 476bp amplification product is displayed, the cell is heterozygous or wild type for inserting the exogenous target gene fragment).

sh4-Lr-JDF1414：CCTGCTGTAAGTGCCGTAGT；

sh4-Lr-JDR5965：CTAGGGGCACAGCACGTC。

sh4-Rr-JDF282：AAGTTATTAGGTCTGAAGAGGAGTTT；

sh4-Rr-JDR4723：CCCATCATTCCGTCCCAGAG。

sh4-wt-JDF1085：TGCTGAGTTCTGGCTTCCTG；

sh4-wt-JDR1560：TCTACCAAGAGAGTGACCAGCAG。

According to the identification result, the single cell clones numbered 1-16, 18-21, 23-36 and 38-55 are all single cell clone clones which are successfully inserted with exogenous target gene fragments at the site of the porcine COL1A1 safe harbor, wherein the single cell clones numbered 11 and 38 are homozygous site-specific insertion, and the other single cell clones are heterozygous site-specific insertion. See table 2.

TABLE 2 genotypes of single cell clones

The recombinant cell numbered 1 in Table 2 (heterozygous site-directed insertion type) was designated as recombinant cell # 1. Through whole genome sequencing, compared with porcine primary fibroblasts from the same source, the genomic DNA of the # 1 recombinant cell only differs in that: a foreign target gene fragment (i.e., a DNA molecule represented by nucleotides 881-5685 in SEQ ID NO: 14) is inserted between the left arm of SH4 and the right arm of SH4 in the genomic DNA and is heterozygous (i.e., one homologous chromosome is inserted and the other chromosome is not inserted).

The recombinant cell numbered 11 in table 2 (homozygous site-directed insertional) was designated as recombinant cell # 11. The recombinant cell numbered 38 in table 2 (homozygous site-directed insertional) was designated as recombinant cell # 38. Through whole genome sequencing, the genomic DNA of the recombinant 11# cell (or the recombinant 38# cell) is different from that of the primary pig fibroblast cell of the same source only in that: an exogenous target gene fragment (i.e., a DNA molecule represented by nucleotides 881-5685 in SEQ ID NO: 14) is inserted between the left arm of SH4 and the right arm of SH4 in the genomic DNA and is homozygous (i.e., the same insertion occurs in both homologous chromosomes). The results of sequencing the key adaptor sequences are shown in FIGS. 6-10.

5. pSRD5A2 gene transcription level detection of single cell clones

The test cells: the 17# numbered cell (wild type single cell clone, as WT control), the 1# recombinant cell, the 11# recombinant cell, or the 38# recombinant cell in table 2.

Taking a test cell, extracting total RNA, and carrying out reverse transcription to obtain cDNA. The relative expression level of the pSRD5A2 gene was determined by fluorescent quantitative PCR using cDNA as a template (2 for beta-actin as an internal reference gene) ^-ΔCt Calculated by the method). Porcine primary fibroblasts were used as control (WT).

The primers for the fluorescent quantitative PCR were as follows:

pSRD5A2-F：GCCTGGTTCCTGCAGGAGCTG；

pSRD5A2-R：AATGTCCTGTGGAAGTAATGT；

β-actin-F：CACGCCATCCTGCGTCTGGA；

β-actin-R：AGCACCGTGTTGGCGTAGAG。

data analysis was performed using SPSS statistical software, expressed as (mean ± standard deviation), using independent sample T-test statistical analysis. The results are shown in FIG. 11.2 ^-ΔCt The value results show that the expression level of pSRD5A2 gene of the tested recombinant cells is obviously higher than that of the control, and the homozygous fixed-pointThe inserted single cell clones expressed higher levels than the heterozygous site-directed inserts. The results show that the pSRD5A2 gene is expressed to a higher degree in the tested recombinant cells.

In conclusion, the invention successfully obtains the recombinant cell which overexpresses the pSRD5A2 gene, and the recombinant cell can be used as a nuclear transfer cell donor clone to produce the alopecia model pig.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> Nanjing King Gene engineering Co., ltd

<120> kit and application thereof in constructing alopecia model pig nuclear transplantation donor cells of high-expression pig II-type 5 alpha-reductase

<130> GNCYX221735

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 10476

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc tagcgcgtgc 360

gccaattctg cagacaaatg gctctagagg tacccgttac ataacttacg gtaaatggcc 420

cgcctggctg accgcccaac gacccccgcc cattgacgtc aatagtaacg ccaataggga 480

ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg gcagtacatc 540

aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa tggcccgcct 600

ggcattgtgc ccagtacatg accttatggg actttcctac ttggcagtac atctacgtat 660

tagtcatcgc tattaccatg ggggcagagc gcacatcgcc cacagtcccc gagaagttgg 720

ggggaggggt cggcaattga tccggtgcct agagaaggtg gcgcggggta aactgggaaa 780

gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg gggagaaccg tatataagtg 840

cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc cgccagaaca caggttggac 900

cggtgccacc atggactata aggaccacga cggagactac aaggatcatg atattgatta 960

caaagacgat gacgataaga tggcccccaa aaagaaacga aaggtgggtg ggtccccaaa 1020

gaagaagcgg aaggtcggta tccacggagt cccagcagcc gacaagaagt acagcatcgg 1080

cctggacatc ggcaccaact ctgtgggctg ggccgtgatc accgacgagt acaaggtgcc 1140

cagcaagaaa ttcaaggtgc tgggcaacac cgaccggcac agcatcaaga agaacctgat 1200

cggagccctg ctgttcgaca gcggcgaaac agccgaggcc acccggctga agagaaccgc 1260

cagaagaaga tacaccagac ggaagaaccg gatctgctat ctgcaagaga tcttcagcaa 1320

cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 1380

agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 1440

ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 1500

ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 1560

cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 1620

ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 1680

caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 1740

gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 1800

gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 1860

ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 1920

cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 1980

gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 2040

ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 2100

agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 2160

ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 2220

actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 2280

cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 2340

tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 2400

cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 2460

gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 2520

ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 2580

gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 2640

atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 2700

cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 2760

cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 2820

cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 2880

caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 2940

cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 3000

gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 3060

cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 3120

cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 3180

ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 3240

cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 3300

gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 3360

gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 3420

caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 3480

cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 3540

ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 3600

ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 3660

caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 3720

cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 3780

gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 3840

aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 3900

gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 3960

ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 4020

cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 4080

cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 4140

aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 4200

cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 4260

aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 4320

catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 4380

gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 4440

taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 4500

agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 4560

catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 4620

agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 4680

cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 4740

gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 4800

ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 4860

gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 4920

caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 4980

tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 5040

caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 5100

ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 5160

caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg gcggctccaa 5220

gcggcctgcc gcgacgaaga aagcgggaca ggccaagaaa aagaaaggat ccggcgcaac 5280

aaacttctct ctgctgaaac aagccggaga tgtcgaagag aatcctggac cggtgagcaa 5340

gggcgaggag ctgttcaccg gggtggtgcc catcctggtc gagctggacg gcgacgtaaa 5400

cggccacaag ttcagcgtgt ccggcgaggg cgagggcgat gccacctacg gcaagctgac 5460

cctgaagttc atctgcacca ccggcaagct gcccgtgccc tggcccaccc tcgtgaccac 5520

cctgacctac ggcgtgcagt gcttcagccg ctaccccgac cacatgaagc agcacgactt 5580

cttcaagtcc gccatgcccg aaggctacgt ccaggagcgc accatcttct tcaaggacga 5640

cggcaactac aagacccgcg ccgaggtgaa gttcgagggc gacaccctgg tgaaccgcat 5700

cgagctgaag ggcatcgact tcaaggagga cggcaacatc ctggggcaca agctggagta 5760

caactacaac agccacaacg tctatatcat ggccgacaag cagaagaacg gcatcaaggt 5820

gaacttcaag atccgccaca acatcgagga cggcagcgtg cagctcgccg accactacca 5880

gcagaacacc cccatcggcg acggccccgt gctgctgccc gacaaccact acctgagcac 5940

ccagtccgcc ctgagcaaag accccaacga gaagcgcgat cacatggtcc tgctggagtt 6000

cgtgaccgcc gccgggatca ctctcggcat ggacgagctg tacaagggct ccggcgaggg 6060

caggggaagt cttctaacat gcggggacgt ggaggaaaat cccggcccaa ccgagtacaa 6120

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 6180

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 6240

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 6300

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 6360

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 6420

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 6480

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 6540

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaga cctccgcgcc 6600

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 6660

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctgaacgc gttaagtcga 6720

caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta actatgttgc 6780

tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta ttgcttcccg 6840

tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt atgaggagtt 6900

gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg caacccccac 6960

tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt tccccctccc 7020

tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag gggctcggct 7080

gttgggcact gacaattccg tggtgttgtc ggggaaatca tcgtcctttc cttggctgct 7140

cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc cttcggccct 7200

caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc ttccgcgtct 7260

tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc gtcgacttta 7320

agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga 7380

ctggaagggc taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct 7440

ctctggttag accagatctg agcctgggag ctctctggct aactagggaa cccactgctt 7500

aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac 7560

tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagggcc 7620

cgtttaaacc cgctgatcag cctcgactgt gccttctagt tgccagccat ctgttgtttg 7680

cccctccccc gtgccttcct tgaccctgga aggtgccact cccactgtcc tttcctaata 7740

aaatgaggaa attgcatcgc attgtctgag taggtgtcat tctattctgg ggggtggggt 7800

ggggcaggac agcaaggggg aggattggga agacaatagc aggcatgctg gggatgcggt 7860

gggctctatg gcctgcaggg gcgcctgatg cggtattttc tccttacgca tctgtgcggt 7920

atttcacacc gcatacgtca aagcaaccat agtacgcgcc ctgtagcggc gcattaagcg 7980

cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ttagcgcccg 8040

ctcctttcgc tttcttccct tcctttctcg ccacgttcgc cggctttccc cgtcaagctc 8100

taaatcgggg gctcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 8160

aacttgattt gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 8220

ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 8280

tcaactctat ctcgggctat tcttttgatt tataagggat tttgccgatt tcggtctatt 8340

ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttttaacaaa atattaacgt 8400

ttacaatttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc 8460

cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg 8520

cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat 8580

caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca 8640

tgataataat ggtttcttag acgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc 8700

ctatttgttt atttttctaa atacattcaa atatgtatcc gctcatgaga caataaccct 8760

gataaatgct tcaataatat tgaaaaagga agagtatgag tattcaacat ttccgtgtcg 8820

cccttattcc cttttttgcg gcattttgcc ttcctgtttt tgctcaccca gaaacgctgg 8880

tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt gggttacatc gaactggatc 8940

tcaacagcgg taagatcctt gagagttttc gccccgaaga acgttttcca atgatgagca 9000

cttttaaagt tctgctatgt ggcgcggtat tatcccgtat tgacgccggg caagagcaac 9060

tcggtcgccg catacactat tctcagaatg acttggttga gtactcacca gtcacagaaa 9120

agcatcttac ggatggcatg acagtaagag aattatgcag tgctgccata accatgagtg 9180

ataacactgc ggccaactta cttctgacaa cgatcggagg accgaaggag ctaaccgctt 9240

ttttgcacaa catgggggat catgtaactc gccttgatcg ttgggaaccg gagctgaatg 9300

aagccatacc aaacgacgag cgtgacacca cgatgcctgt agcaatggca acaacgttgc 9360

gcaaactatt aactggcgaa ctacttactc tagcttcccg gcaacaatta atagactgga 9420

tggaggcgga taaagttgca ggaccacttc tgcgctcggc ccttccggct ggctggttta 9480

ttgctgataa atctggagcc ggtgagcgtg gaagccgcgg tatcattgca gcactggggc 9540

cagatggtaa gccctcccgt atcgtagtta tctacacgac ggggagtcag gcaactatgg 9600

atgaacgaaa tagacagatc gctgagatag gtgcctcact gattaagcat tggtaactgt 9660

cagaccaagt ttactcatat atactttaga ttgatttaaa acttcatttt taatttaaaa 9720

ggatctaggt gaagatcctt tttgataatc tcatgaccaa aatcccttaa cgtgagtttt 9780

cgttccactg agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt 9840

ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt 9900

tgccggatca agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga 9960

taccaaatac tgttcttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag 10020

caccgcctac atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata 10080

agtcgtgtct taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg 10140

gctgaacggg gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga 10200

gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca 10260

ggtatccggt aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa 10320

acgcctggta tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt 10380

tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac 10440

ggttcctggc cttttgctgg ccttttgctc acatgt 10476

<210> 2

<211> 3120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60

cttagacgtc aggtggcact tttcggggaa atgtgcgcgg aacccctatt tgtttatttt 120

tctaaataca ttcaaatatg tatccgctca tgagacaata accctgataa atgcttcaat 180

aatattgaaa aaggaagagt atgagtattc aacatttccg tgtcgccctt attccctttt 240

ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg 300

ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga 360

tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcactttt aaagttctgc 420

tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac 480

actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg 540

gcatgacagt aagagaatta tgcagtgctg ccataaccat gagtgataac actgcggcca 600

acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg 660

gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg 720

acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg 780

gcgaactact tactctagct tcccggcaac aattaataga ctggatggag gcggataaag 840

ttgcaggacc acttctgcgc tcggcccttc cggctggctg gtttattgct gataaatctg 900

gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct 960

cccgtatcgt agttatctac acgacgggga gtcaggcaac tatggatgaa cgaaatagac 1020

agatcgctga gataggtgcc tcactgatta agcattggta actgtcagac caagtttact 1080

catatatact ttagattgat ttaaaacttc atttttaatt taaaaggatc taggtgaaga 1140

tcctttttga taatctcatg accaaaatcc cttaacgtga gttttcgttc cactgagcgt 1200

cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 1260

gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 1320

taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 1380

ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 1440

tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 1500

ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 1560

cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 1620

agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 1680

gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 1740

atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 1800

gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1860

gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1920

ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1980

cagtgagcga ggaagcggaa gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc 2040

cgattcatta atgcagctgg cacgacaggt ttcccgactg gaaagcgggc agtgagcgca 2100

acgcaattaa tgtgagttag ctcactcatt aggcacccca ggctttacac tttatgcttc 2160

cggctcgtat gttgtgtgga attgtgagcg gataacaatt tcacacagga aacagctatg 2220

accatgatta cgccaagctt gcatgcaggc ctctgcagtc gacgggcccg ggatccgatg 2280

ataaacatgt gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc 2340

tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac 2400

gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat 2460

ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt 2520

gtggaaagga cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag 2580

ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 2640

tagcgcgtgc gccaattctg cagacaaatg gctctagagg tacccataga tctagatgca 2700

ttcgcgaggt accgagctcg aattcactgg ccgtcgtttt acaacgtcgt gactgggaaa 2760

accctggcgt tacccaactt aatcgccttg cagcacatcc ccctttcgcc agctggcgta 2820

atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat 2880

ggcgcctgat gcggtatttt ctccttacgc atctgtgcgg tatttcacac cgcatatggt 2940

gcactctcag tacaatctgc tctgatgccg catagttaag ccagccccga cacccgccaa 3000

cacccgctga cgcgccctga cgggcttgtc tgctcccggc atccgcttac agacaagctg 3060

tgaccgtctc cgggagctgc atgtgtcaga ggttttcacc gtcatcaccg aaacgcgcga 3120

<210> 3

<211> 14138

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggcgcgccct ctacctgctc tcggacccgt gggggtgggg ggtggaggaa ggagtggggg 60

gtcggtcctg ctggcttgtg ggtgggaggc gcatgttctc caaaaacccg cgcgagctgc 120

aatcctgagg gagctgcagt ggaggaggcg gagagaaggc cgcacccttc tccgcagggg 180

gaggggagtg ccgcaatacc tttatgggag ttctctgctg cctccttttc ctaaggaccg 240

ccctgggcct agaaaaatcc ctccctcccc cgcgatctcg tcatcgcctc catgtcagtt 300

tgctccttct cgattatggg cgggattctt ttgccctggc gcgccccaga cccgggcctg 360

gggggcaagt cggggggcgg ggggaggtcg ggcagggtcc cctgggagga tggggacgtg 420

ctgtgcccct agcggccacc agagggcacc aggacaccac tgcggtcggc tcagcggctc 480

ctgccctggt cagggggcgc caggtcctgc ccctcctggg gagggcgggg ggcgagaagg 540

gcgattttaa ttaacccacg tttcaacatg cacatcccag taatttggaa acattttgtt 600

tccaaagatt cacttaacat tggtttagca acatgaagct ttctatgcaa cccaaggact 660

cagtttttgg cctgttttag tgacaggcaa tcagcaacat gctgcatttc tctccagtgt 720

tgtaatcaaa gaaaccctcc catagcttta aatgatattc cttccccttc caattatgtg 780

gggggaaaac aaccctattc tccacccaga agtgttaact caagaattac attttcaaga 840

agtttccaga ttcgtaaaac cagaattaga tgtctttcac ctaaatgtct cggtgttgac 900

caaaggaaca cacaggtttc tcatttaact tttttaatgg gtctcaaaat tctgtgacaa 960

atttttggtc aagttgtttc cattaaaaag tactgatttt aaaaactaat aacttaaaac 1020

tgccacacgc aaaaaagaaa accaaagtgg tccacaaaac attctccttt ccttctgaag 1080

gttttacgat gcattgttat cattaaccag tcttttacta ctaaacttaa atggccaatt 1140

gaaacaaaca gttctgagac cgttcttcca ccactgatta agagtggggt ggcaggtatt 1200

agggataatg ctagcttact tgtacagctc gtccatgccg agagtgatcc cggcggcggt 1260

cacgaactcc agcaggacca tgtgatcgcg cttctcgttg gggtctttgc tcagggcgga 1320

ctgggtgctc aggtagtggt tgtcgggcag cagcacgggg ccgtcgccga tgggggtgtt 1380

ctgctggtag tggtcggcga gctgcacgct gccgtcctcg atgttgtggc ggatcttgaa 1440

gttcaccttg atgccgttct tctgcttgtc ggccatgata tagacgttgt ggctgttgta 1500

gttgtactcc agcttgtgcc ccaggatgtt gccgtcctcc ttgaagtcga tgcccttcag 1560

ctcgatgcgg ttcaccaggg tgtcgccctc gaacttcacc tcggcgcggg tcttgtagtt 1620

gccgtcgtcc ttgaagaaga tggtgcgctc ctggacgtag ccttcgggca tggcggactt 1680

gaagaagtcg tgctgcttca tgtggtcggg gtagcggctg aagcactgca cgccgtaggt 1740

cagggtggtc acgagggtgg gccagggcac gggcagcttg ccggtggtgc agatgaactt 1800

cagggtcagc ttgccgtagg tggcatcgcc ctcgccctcg ccggacacgc tgaacttgtg 1860

gccgtttacg tcgccgtcca gctcgaccag gatgggcacc accccggtga acagctcctc 1920

gcccttgctc accatggtgg cgtcgaccgt acgtcacgac acctgaaatg gaagaaaaaa 1980

actttgaacc actgtctgag gcttgagaat gaaccaagat ccaaactcaa aaagggcaaa 2040

ttccaaggag aattacatca agtgccaagc tggcctaact tcagtctcca cccactcagt 2100

gtggggaaac tccatcgcat aaaacccctc cccccaacct aaagacgacg tactccaaaa 2160

gctcgagaac taatcgaggt gcctggacgg cgcccggtac tccgtggagt cacatgaagc 2220

gacggctgag gacggaaagg cccttttcct ttgtgtgggt gactcacccg cccgctctcc 2280

cgagcgccgc gtcctccatt ttgagctccc tgcagcaggg ccgggaagcg gccatctttc 2340

cgctcacgca actggtgccg accgggccag ccttgccgcc cagggcgggg cgatacacgg 2400

cggcgcgagg ccaggcacca gagcaggccg gccagcttga gactaccccc gtccgattct 2460

cggtggccgc gctcgcaggc cccgcctcgc cgaacatgtg cgctgggacg cacgggcccc 2520

gtcgccgccc gcggccccaa aaaccgaaat accagtgtgc agatcttggc ccgcatttac 2580

aagactatct tgccagaaaa aaagcgtcgc agcaggtcat caaaaatttt aaatggctag 2640

agacttatcg aaagcagcga gacaggcgcg aaggtgccac cagattcgca cgcggcggcc 2700

ccagcgccca ggccaggcct caactcaagc acgaggcgaa ggggctcctt aagcgcaagg 2760

cctcgaactc tcccacccac ttccaacccg aagctcggga tcaagaatca cgtactgcag 2820

ccagtggaag taattcaagg cacgcaaggg ccataacccg taaagaggcc aggcccgcgg 2880

gaaccacaca cggcacttac ctgtgttctg gcggcaaacc cgttgcgaaa aagaacgttc 2940

acggcgacta ctgcacttat atacggttct cccccaccct cgggaaaaag gcggagccag 3000

tacacgacat cactttccca gtttaccccg cgccaccttc tctaggcacc ggttcaattg 3060

ccgacccctc cccccaactt ctcggggact gtgggcgatg tgcgctctgc ccactgacgg 3120

gcaccggagc cctagattcg attccctttg gggcaaaact caccgcctaa tcccctataa 3180

ctctaccggg gagcccggtg gagagcagac gggctgacgc tgccacctgc cggccatccc 3240

aggataggac cgccgtattc aagtcgccct caggaaggac cctcggggca ccagaggcct 3300

tcgaagcccc aatgagtgag gcaactgagg gtcgcgggtg ccattacaag gcccagccaa 3360

ggcctagagc caaggcttga accgtggggg acccccaagc cccacctgcc caggaacagc 3420

agacactggg acactttgtt tcaggtcctg cccaggcccc tcccactgtg aggctgggat 3480

ttgtcgccca gggtgcagat gagaagagtg gggaaagcag tcctgagcca ggaaattcta 3540

ccgggtaggg gaggcgcttt tcccaaggca gtctggagca tgcgctttag cagccccgct 3600

gggcacttgg cgctacacaa gtggcctctg gcctcgcaca cattccacat ccaccggtag 3660

gcgccaaccg gctccgttct ttggtggccc cttcgcgcca ccttctactc ctcccctagt 3720

caggaagttc ccccccgccc cgcagctcgc gtcgtgcagg acgtgacaaa tggaagtagc 3780

acgtctcact agtctcgtgc agatggacag caccgctgag caatggaagc gggtaggcct 3840

ttggggcagc ggccaatagc agctttgctc cttcgctttc tgggctcaga ggctgggaag 3900

gggtgggtcc gggggcgggc tcaggggcgg gctcaggggc ggggcgggcg cccgaaggtc 3960

ctccggaggc ccggcattct gcacgcttca aaagcgcacg tctgccgcgc tgttctcctc 4020

ttcctcatct ccgggccttt cgacctccta gggccaccat ggtgagcaag ggcgaggacg 4080

acaacatggc catcatcaag gagttcatgc gcttcaaggt gcacatggag ggctccgtga 4140

acggccacga gttcgagatc gagggcgagg gcgagggccg cccctacgag ggcacccaga 4200

ccgccaagct gaaggtgacc aagggcggcc ccctgccctt cgcctgggac atcctgtccc 4260

ctcagttcat gtacggctcc aaggcctacg tgaagcaccc cgccgacatc cccgactact 4320

tgaagctgtc cttccccgag ggcttcaagt gggagcgcgt gatgaacttc gaggacggcg 4380

gcgtggtgac cgtgacccag gactcctccc tgcaggacgg cgagttcatc tacaaggtga 4440

agctgcgcgg caccaacttc ccctccgacg gccccgtaat gcagaagaag accatgggct 4500

gggaggcctc ctccgagcgg atgtaccccg aggacggcgc cctgaagggc gagatcaagc 4560

agaggctgaa gctgaaggac ggcggccact acgacgccga ggtcaagacc acctacaagg 4620

ccaagaagcc cgtgcagctg cccggcgcct acaacgtcaa catcaagctg gacatcacct 4680

cccacaacga ggactacacc atcgtggaac agtacgagcg cgccgagggc cgccactcca 4740

ccggcggcat ggacgagctg tacaagtgag gatccgctga tcagcctcga ctgtgccttc 4800

tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc tggaaggtgc 4860

cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc tgagtaggtg 4920

tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt gggaagacaa 4980

tagcaggcat gctggggatg cggtgggctc tatggcttct gaggcggaaa gaacccttct 5040

gaggcggaaa gaaccagctg ccttaatata acttcgtata atgtatgcta tacgaagtta 5100

ttaggtctga agaggagttt acgtccagcc aattctgtgg aatgtgtgtc agttagggtg 5160

tggaaagtcc ccaggctccc cagcaggcag aagtatgcaa agcatgcatc tcaattagtc 5220

agcaaccagg tgtggaaagt ccccaggctc cccagcaggc agaagtatgc aaagcatgca 5280

tctcaattag tcagcaacca tagtcccgcc cctaactccg cccatcccgc ccctaactcc 5340

gcccagttcc gcccattctc cgccccatgg ctgactaatt ttttttattt atgcagaggc 5400

cgaggccgcc tctgcctctg agctattcca gaagtagtga ggaggctttt ttggaggcct 5460

aggcttttgc aaaaagctcc cgggagcttg tatatccatt ttcggcggcc gcgccaccat 5520

gaccgagtac aagcccacgg tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg 5580

caccctcgcc gccgcgttcg ccgactaccc cgccacgcgc cacaccgtcg atccggaccg 5640

ccacatcgag cgggtcaccg agctgcaaga actcttcctc acgcgcgtcg ggctcgacat 5700

cggcaaggtg tgggtcgcgg acgacggcgc cgcggtggcg gtctggacca cgccggagag 5760

cgtcgaagcg ggggcggtgt tcgccgagat cggcccgcgc atggccgagt tgagcggttc 5820

ccggctggcc gcgcagcaac agatggaagg cctcctggcg ccgcaccggc ccaaggagcc 5880

cgcgtggttc ctggccaccg tcggagtctc gcccgaccac cagggcaagg gtctgggcag 5940

cgccgtcgtg ctccccggag tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga 6000

gacctccgcg ccccgcaacc tccccttcta cgagcggctc ggcttcaccg tcaccgccga 6060

cgtcgaggtg cccgaaggac cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaga 6120

attcgcggga ctctggggtt cgaaatgacc gaccaagcga cgcccaacct gccatcacga 6180

gatttcgatt ccaccgccgc cttctatgaa aggttgggct tcggaatcgt tttccgggac 6240

gccggctgga tgatcctcca gcgcggggat ctcatgctgg agttcttcgc ccaccccaac 6300

ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat 6360

aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat 6420

catgtctgta taccgctcga ctagagcttg cggaaccctt aatataactt cgtataatgt 6480

atgctatacg aagttattag gtccgctggc catctacgag ccaaagactt tcaaatcttt 6540

ggctgccttg gccagtagga ggcgacacga aggatttgct gctgccttgg gggatgggaa 6600

ggaacctgaa ggcatttttt ccagagtggt gcagtaccac tgaggactgt tgctgtattg 6660

attaggaaaa gagacagagt aatttgcagt ttgtttgatt tatactgggc tgcaggtcga 6720

gggatcttca taagagaaga gggacagcta tgactgggag tagtcaggag aggaggaaaa 6780

atctggctag taaaacatgt aaggaaaatt ttagggatgt taaagaaaaa aataacacaa 6840

aacaaaatat aaaaaaaatc taacctcaag tcaaggcttt tctatggaat aaggaatgga 6900

cagcaggggg ctgtttcata tactgatgac ctctttatag ccacctttgt tcatggcagc 6960

cagcatatgg catatgttgc caaactctaa accaaatact cattctgatg ttttaaatga 7020

tttgccctcc catatgtcct tccgagtgag agacacaaaa aattccaaca cactattgca 7080

atgaaaataa atttccttta ttagccagaa gtcagatgct caaggggctt catgatgtcc 7140

ccataatttt tggcagaggg aaaaagatct cagtggtatt tgtgagccag ggcattggcc 7200

acaccagcca ccaccttctg ataggcagcc tgcggtacct tacatggtgg cgaattcgtt 7260

tgccaaaatg atgagacagc acaataacca gcacgttgcc caggagctgt aggaaaaaga 7320

agaaggcatg aacatggtta gcagaggctc tagagccgcc ggtcacacgc cagaagccga 7380

accccgccct gccccgtccc ccccgaaggc agccgtcccc ctgcggcagc cccgaggctg 7440

gagatggaga aggggacggc ggcgcggcga cgcacgaagg ccctccccgc ccatttcctt 7500

cctgccggcg ccgcaccgct tcgcccgcgc ccgctagagg gggtgcggcg gcgcctccca 7560

gatttcggct ccgccagatt tgggacaaag gaagtccctg cgccctctcg cacgattacc 7620

ataaaaggca atggctgcgg ctcgccgcgc ctcgacagcc gccggcgctc cggggccgcc 7680

gcgcccctcc cccgagccct ccccggcccg aggcggcccc gccccgcccg gcacccccac 7740

ctgccgccac cccccgcccg gcacggcgag ccccgcgcca cgccccgcac ggagccccgc 7800

acccgaagcc gggccgtgct cagcaactcg gggagggggg tgcagggggg ggttacagcc 7860

cgaccgccgc gcccacaccc cctgctcacc cccccacgca cacaccccgc acgcagcctt 7920

tgttcccctc gcagcccccc cgcaccgcgg ggcaccgccc ccggccgcgc tcccctcgcg 7980

cacacgcgga gcgcacaaag ccccgcgccg cgcccgcagc gctcacagcc gccgggcagc 8040

gcgggccgca cgcggcgctc cccacgcaca cacacacgca cgcacccccc gagccgctcc 8100

cccccgcaca aagggccctc ccggagccct ttaaggcttt cacgcagcca cagaaaagaa 8160

acgagccgtc attaaaccaa gcgctaatta cagcccggag gagaagggcc gtcccgcccg 8220

ctcacctgtg ggagtaacgc ggtcagtcag agccggggcg ggcggcgcga ggcggcgcgg 8280

agcggggcac ggggcgaagg caacgcagcg actcccgccc gccgcgcgct tcgcttttta 8340

tagggccgcc gccgccgccg cctcgccata aaaggaaact ttcggagcgc gccgctctga 8400

ttggctgccg ccgcacctct ccgcctcgcc ccgccccgcc cctcgccccg ccccgccccg 8460

cctggcgcgc gccccccccc cccccgcccc catcgctgca caaaataatt aaaaaataaa 8520

taaatacaaa attgggggtg gggagggggg ggagatgggg agagtgaagc agaacgtggg 8580

gctcacctcg acccatggta atagcgatga ctaatacgta gatgtactgc caagtaggaa 8640

agtcccataa ggtcatgtac tgggcataat gccaggcggg ccatttaccg tcattgacgt 8700

caataggggg cgtacttggc atatgataca cttgatgtac tgccaagtgg gcagtttacc 8760

gtaaatagtc cacccattga cgtcaatgga aagtccctat tggcgttact atgggaacat 8820

acgtcattat tgacgtcaat gggcgggggt cgttgggcgg tcagccaggc gggccattta 8880

ccgtaagtta tgtaacgcgg aactccatat atgggctatg aactaatgac cccgtaattg 8940

attactatta ataactagtc aataatcaat gtcgtaaatg tcgtaaatgt ctcagctagt 9000

caggtagtaa aaggtgtcaa ctaggcagtg gcagagcagg attcaaattc agggctgttg 9060

tgatgcctcc gcagactctg agcgccacct ggtggtaatt tgtctgtgcc tcttctgacg 9120

tggaagaaca gcaactaaca cactaacacg gcatttacta tgggccagcc attgtacgcg 9180

ttgcttaacc tgattcttgg gcgttgtcct gcaggggatt gagcaggtgt acgaggacga 9240

gcccaatttc tctatattcc cacagtcttg agtttgtgtc acaaaataat tatagtgggg 9300

tggagatggg aaatgagtcc aggcaacacc taagcctgat tttatgcatt gagactgcgt 9360

gttattacta aagatctttg tgtcgcaatt tcctgatgaa gggagatagg ttaaaaagca 9420

cggatctact gagttttaca gtcatcccat ttgtagactt ttgctacacc accaaagtat 9480

agcatctgag attaaatatt aatctccaaa ccttaggccc cctcacttgc atccttacgg 9540

tcagataact ctcactcata ctttaagccc attttgtttg ttgtacttgc tcatccagtc 9600

ccagacatag cattggcttt ctcctcacct gttttaggta gccagcaagt catgaaatca 9660

gataagttcc accaccaatt aacactaccc atcttgagca taggcccaac agtgcattta 9720

ttcctcattt actgatgttc gtgaatattt accttgattt tcattttttt ctttttctta 9780

agctgggatt ttactcctga ccctattcac agtcagatga tcttgactac cactgcgatt 9840

ggacctgagg ttcagcaata ctccccttta tgtcttttga atacttttca ataaatctgt 9900

ttgtattttc attagttagt aactgagctc agttgccgta atgctaatag cttccaaact 9960

agtgtctctg tctccagtat ctgataaatc ttaggtgttg ctgggacagt tgtcctaaaa 10020

ttaagataaa gcatgaaaat aactgacaca actccattac tggctcctaa ctacttaaac 10080

aatgcattct atcatcacaa atgtgaaaaa ggagttccct cagtggacta accttatctt 10140

ttctcaacac ctttttcttt gcacaatttt ccacacatgc ctacaaaaag tacttatgcg 10200

gccgccataa aagttttgtt actttataga agaaattttg agtttttgtt ttttttaata 10260

aataaataaa cataaataaa ttgtttgttg aatttattat tagtatgtaa gtgtaaatat 10320

aataaaactt aatatctatt caaattaata aataaacctc gatatacaga ccgataaaac 10380

acatgcgtca attttacaca tgattatctt taacgtacgt cacaatatga ttatctttct 10440

agggttaatc tagctgcgtg ttctgcagcg tgtcgagcat cttcatctgc tccatcacgc 10500

tgtaaaacac atttgcaccg cgagtctgcc cgtcctccac gggttcaaaa acgtgaatga 10560

acgaggcgcg ctcactggcc gtcgttttac aacgtcgtga ctgggaaaac cctggcgtta 10620

cccaacttaa tcgccttgca gcacatcccc ctttcgccag ctggcgtaat agcgaagagg 10680

cccgcaccga tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg gacgcgccct 10740

gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg 10800

ccagcgccct agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg 10860

gctttccccg tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac 10920

ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct 10980

gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt 11040

tccaaactgg aacaacactc aaccctatct cggtctattc ttttgattta taagggattt 11100

tgccgatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt 11160

ttaacaaaat attaacgctt acaatttagg tggcactttt cggggaaatg tgcgcggaac 11220

ccctatttgt ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc 11280

ctgataaatg cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt 11340

cgcccttatt cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct 11400

ggtgaaagta aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga 11460

tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag 11520

cacttttaaa gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca 11580

actcggtcgc cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga 11640

aaagcatctt acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag 11700

tgataacact gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc 11760

ttttttgcac aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa 11820

tgaagccata ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt 11880

gcgcaaacta ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg 11940

gatggaggcg gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt 12000

tattgctgat aaatctggag ccggtgagcg tggttcacgc ggtatcattg cagcactggg 12060

gccagatggt aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat 12120

ggatgaacga aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact 12180

gtcagaccaa gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa 12240

aaggatctag gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt 12300

ttcgttccac tgagcgtcag accccgtaga aaagatcaaa ggatcttctt gagatccttt 12360

ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca ccgctaccag cggtggtttg 12420

tttgccggat caagagctac caactctttt tccgaaggta actggcttca gcagagcgca 12480

gataccaaat actgtccttc tagtgtagcc gtagttaggc caccacttca agaactctgt 12540

agcaccgcct acatacctcg ctctgctaat cctgttacca gtggctgctg ccagtggcga 12600

taagtcgtgt cttaccgggt tggactcaag acgatagtta ccggataagg cgcagcggtc 12660

gggctgaacg gggggttcgt gcacacagcc cagcttggag cgaacgacct acaccgaact 12720

gagataccta cagcgtgagc tatgagaaag cgccacgctt cccgaaggga gaaaggcgga 12780

caggtatccg gtaagcggca gggtcggaac aggagagcgc acgagggagc ttccaggggg 12840

aaacgcctgg tatctttata gtcctgtcgg gtttcgccac ctctgacttg agcgtcgatt 12900

tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac gccagcaacg cggccttttt 12960

acggttcctg gccttttgct ggccttttgc tcacatgttc tttcctgcgt tatcccctga 13020

ttctgtggat aaccgtatta ccgcctttga gtgagctgat accgctcgcc gcagccgaac 13080

gaccgagcgc agcgagtcag tgagcgagga agcggaagag cgcccaatac gcaaaccgcc 13140

tctccccgcg cgttggccga ttcattaatg cagctggcac gacaggtttc ccgactggaa 13200

agcgggcagt gagcgcaacg caattaatgt gagttagctc actcattagg caccccaggc 13260

tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt gtgagcggat aacaatttca 13320

cacaggaaac agctatgacc atgattacgc caagcgcgcc cgccgggtaa ctcacggggt 13380

atccatgtcc atttctgcgg catccagcca ggatacccgt cctcgctgac gtaatatccc 13440

agcgccgcac cgctgtcatt aatctgcaca ccggcacggc agttccggct gtcgccggta 13500

ttgttcgggt tgctgatgcg cttcgggctg accatccgga actgtgtccg gaaaagccgc 13560

gacgaactgg tatcccaggt ggcctgaacg aacagttcac cgttaaaggc gtgcatggcc 13620

acaccttccc gaatcatcat ggtaaacgtg cgttttcgct caacgtcaat gcagcagcag 13680

tcatcctcgg caaactcttt ccatgccgct tcaacctcgc gggaaaaggc acgggcttct 13740

tcctccccga tgcccagata gcgccagctt gggcgatgac tgagccggaa aaaagacccg 13800

acgatatgat cctgatgcag ctagattaac cctagaaaga tagtctgcgt aaaattgacg 13860

catgcattct tgaaatattg ctctctcttt ctaaatagcg cgaatccgtc gctgtgcatt 13920

taggacatct cagtcgccgc ttggagctcc cgtgaggcgt gcttgtcaat gcggtaagtg 13980

tcactgattt tgaactataa cgaccgcgtg agtcaaaatg acgcatgatt atcttttacg 14040

tgacttttaa gatttaactc atacgataat tatattgtta tttcatgttc tacttacgtg 14100

ataacttatt atatatatat tttcttgtta tagatatc 14138

<210> 4

<211> 1069

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtgctgagtc cttttcccat cccacccacc tggagctccc ctcttccagt cctgagccac 60

ttgaactggc ctggtttttg ccatcctgcg ctgccctctc tccggactcg agccactgct 120

gagggcctca ggccagtcca tcctcgtctt gtctctttcg ccctgctctt tccccacctt 180

gagcgctctt aaccagcctg gcccgtgcca cctctactct gccatcgaat gctgccccac 240

tttctcgagt ccgccacttc tcccagcttc accggtaccc actgtttccc ctagtccagg 300

caggtaccac tttccctgag cgtcctcctc ctctctcctg ggcctgtgct gcttcttttc 360

ccgctctctg gcctgggccg tttcttcggc cagcccccga gccttccatg ccctttcctt 420

caggtttctg ctcttcatcc ttggtctctg ccatctgttg ccatgtaagg gtgctctttc 480

ctgagccatc gccctcaagg cgctctgctc ctcaagtgga tgcttccctc gcctggctca 540

cctcctgctc tctctcctgc ccccttcacc tgcgtgccct cctcattctc cctctgtgcc 600

acctctggcc ttgcactgta ggctctctct tggggatgtt tctccttctc cacacacttc 660

tctttcactc tgtcctcttg ctttgtgtgg gcctgcagcg ttaccctttt ttctgggcac 720

actcagagca ccctcctctt tctggttctg ggccacctgt ctgtcctcgg gtcatcttgc 780

tctctctgcc tggatgccct cctgtggctt tgggcagctt ctccctcctt cagagtgcac 840

cgccagttct cctaggcccg gtcacttccc cttcccaggg gacctagagc cctgctaggt 900

cctctctctc cacaacctgg gcccccaaac ctttccaaaa caccttgctt tctgcctcca 960

ttggtcttgt gttccagagc cagagtcact atatgtccca gaaccaggat tccctctggt 1020

tctgagggct tttatcgcat cccctgcctg gctgcagtgg gtctttggg 1069

<210> 5

<211> 260

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gacaggccac agaagagcct ctactcctcc ctctgtcccc gaggctgtct ccctcccagt 60

cttcccagct caggccagtc cccaggcctc tcttccctgc cagagcccgt caggttcggt 120

tactttgggg cccagagagg accctgtgaa ggaagcgtgg gtaggggcac gggaatgggg 180

aggatgcctg aagaggcccc cttagccaga agaggagcag aagaggagca ggtacccaga 240

agaggagcag ttcagggaaa 260

<210> 6

<211> 540

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaatacccac gtttattggg acaaaagttg ttagggaaaa tggggcctca gagttatgat 60

tcaagtcata attctttcca tttataattt cactcgagac tctgttaact gattccttgt 120

gtgttgtatc ttactcctca gctcacaatt acttttagtt attcacctta actgtatgaa 180

taacagtgga gaaaaggatt ctaccagaat actctaatta tggttttgag tcccctttcc 240

agactgaaga tttttcagtc tttttgatct gaggtgattt ttcagtcttt tcgatctgag 300

gtgacagtct caagctcctc aattcaccca gtctcttgat acttgtccat ttagggccac 360

caaagctact ttgacttcat actagagagt caattaatga ggccattctc tgatggacag 420

gtgaagcagg caaggtgact atattttgac taaacggtag aaaacagcct gagtgttaac 480

agtgtagcct ataaaaccca gagctgccca ccctgatcta aacttccagg aacataagaa 540

<210> 7

<211> 1009

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agtaggtcac atttcagtaa aacctggctt tgtggattga gcatggtctg tctcttcctg 60

gtacttcatt agtcccctaa gtgggatttg ctgagcaaga ctcctcaatt acagaaatac 120

tccagtttag aattctcgca aaggcttttt gtttccacaa gtagaatcta gaaagcaatc 180

tcaagtaaca acagcagaga cctgaatccc aatccatctt tcctgtgtgt cctcttttac 240

ctccttccct ttcatgttga accaacagtc ctttttcagt ctagaagcta gtacgaaaga 300

aatgtacaga tgtaggtacc aagcaaagcc attagccaat aactggtgag atggagctaa 360

gaggaaataa aagtgttcct aagaatagca cagcagaagc tagatccaca gatcttaaaa 420

caattttggt tgagtaagag tagaggcaaa agaggaagct aataatgcag tttttaggag 480

ctaagagcca gataaagggt aagggcagga ggaagtgcta tctcagctaa cgagatacat 540

gaaacaacgg tggaagtcca gcaggcacaa gatgagttga gaagcaatca gggccagaag 600

gatgtgcaag gcctcaaaat aaaaaagcac agggccacag ggaaccttat ggaaattaaa 660

aggaagagga tgcagtcagg agaggaaaaa atagtgctcc ctcccccatg cccaaggaag 720

cagctgagca gccagtactt gggaagttag tagtaataag ttggtaagag ggagttctgt 780

tcgtggctca atggttaaca aatcagacta gaaaccgtga ggttgcgggt ttgatccctg 840

gccttgctca gtgggttaag gatccggcat tgccgtgacc tgtggtgtag gtcacagacg 900

tggctcagtt cccgcattcc tgtggctctg gtgtaggctg gtggctacag ctctgattag 960

acccctaggc tgggaacctc catatgccct ggaagtggcc gtagaaaag 1009

<210> 8

<211> 872

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggatggggac tcatgtgaat tttctaaagg tgctatttaa acggggggca cgagtgccgg 60

ctttggacag ggccgctcgc tctccaccct ttcttcttcc ccctcggccg cctctcaccc 120

cctgaggcct ctctcccccc acgacctcct ctctctcctc tgaaaccctc tcctcctcag 180

ctgcatccca ccctcgtggc ctctctctct ctctgtctgt cctgtgtcct ctctcactgg 240

gtttcagagc acagatgccc aaagcacaaa agcagttttc ccctggggtg ggaggaagca 300

agagactttg tacctatttt gtatgtgtat aataatttga gatgttttta attattttga 360

ttgctggaat aaagcatgtg gaaatgaccc aaaccaatct tgcactggcc tcctgatttc 420

cttccttgga gacggaggga gggggagacc tgggggaggg cgcttggggg ggggtgggct 480

ctcttctttc tgcgctcccc ccccccacct ccaacacctt gacgacccct cctgcttccg 540

cttgcctttc tcaggcttta acactttctc ctcgccctct cagcatgcgc atgcgcgtgc 600

ctctacctcc cccgcacatc ctggcctgcc caccctgaat ggcctggccc agcgatgcca 660

ccaactctct cgctccgtcc acggctgggg aggggggcac tctgcagggt tggggggcac 720

tgggaggctg ggttgggtga gggaggggtg cctgggcccc caccccccag caagttctct 780

ccctaggcga actggagggt cgtctggcct cttgagcctt gttgctggct ctgagctcta 840

ccaagagagt gaccagcagg accgcaccat ca 872

<210> 9

<211> 727

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtggttgctg agactgcgtg ggggcccaag gagacctgga gaaaggaatg cttcctgctc 60

cttcttctgg ggccccagga gagccttccc agggccttgg agaggtgctg tccagggact 120

aaccctgtgc tctaggaagg ctgcaggccc tgaccagctg ggcaggtcct gggtccctcc 180

tggccttcta agttccccaa acatgagacc tctgggtgtg gggtggcctg gggaggtcat 240

tttgcccagg ccctacctcc tgcccattcc taaccctttt taaaaatctg tgcgtcctct 300

tcttccttct tctccctccc ttcccttttc gctcaccctc tgctgctggc ctgagagccg 360

gaggccccca gggggaaggc gactggtctc ctccccagtc tcagggaagg gagacagaga 420

atccaggaag ccagaactca gcagacgaag cacccaggga cctagagatg ggttgaaaag 480

ttgacagctg tcccacctgc ctcccaaggt ctcagggcct aaacctccaa ggcaggaaag 540

gcccctgtcc ctccctgggg tccatagaaa gagggacaag tctgcacgga ccatttgctg 600

taatattaac accttggctg tcattaggta gtcttggctg ttaattatgt cctgtgataa 660

tgtattatta gcacgccgac cacatagggt agggaactgc agctagtaaa caaaagtttg 720

ttcctat 727

<210> 10

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gaaggagcaa acugacaugg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 11

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ugcagugggu cuuuggggac guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 12

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

uuccaggaac auaagaaagu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 13

<211> 100

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gcagucucag caaccacuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60

cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100

<210> 14

<211> 10355

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ggcgcgccgg atggggactc atgtgaattt tctaaaggtg ctatttaaac ggggggcacg 60

agtgccggct ttggacaggg ccgctcgctc tccacccttt cttcttcccc ctcggccgcc 120

tctcaccccc tgaggcctct ctccccccac gacctcctct ctctcctctg aaaccctctc 180

ctcctcagct gcatcccacc ctcgtggcct ctctctctct ctgtctgtcc tgtgtcctct 240

ctcactgggt ttcagagcac agatgcccaa agcacaaaag cagttttccc ctggggtggg 300

aggaagcaag agactttgta cctattttgt atgtgtataa taatttgaga tgtttttaat 360

tattttgatt gctggaataa agcatgtgga aatgacccaa accaatcttg cactggcctc 420

ctgatttcct tccttggaga cggagggagg gggagacctg ggggagggcg cttggggggg 480

ggtgggctct cttctttctg cgctcccccc ccccacctcc aacaccttga cgacccctcc 540

tgcttccgct tgcctttctc aggctttaac actttctcct cgccctctca gcatgcgcat 600

gcgcgtgcct ctacctcccc cgcacatcct ggcctgccca ccctgaatgg cctggcccag 660

cgatgccacc aactctctcg ctccgtccac ggctggggag gggggcactc tgcagggttg 720

gggggcactg ggaggctggg ttgggtgagg gaggggtgcc tgggccccca ccccccagca 780

agttctctcc ctaggcgaac tggagggtcg tctggcctct tgagccttgt tgctggctct 840

gagctctacc aagagagtga ccagcaggac cgcaccatca cgcgccccag acccgggcct 900

ggggggcaag tcggggggcg gggggaggtc gggcagggtc ccctgggagg atggggacgt 960

gctgtgcccc tagcggccac cagagggcac caggacacca ctgcggtcgg ctcagcggct 1020

cctgccctgg tcagggggcg ccaggtcctg cccctcctgg ggagggcggg gggcgagaag 1080

ggcgattggc tccggtgccc gtcagtgggc agagcgcaca tcgcccacag tccccgagaa 1140

gttgggggga ggggtcggca attgaaccgg tgcctagaga aggtggcgcg gggtaaactg 1200

ggaaagtgat gtcgtgtact ggctccgcct ttttcccgag ggtgggggag aaccgtatat 1260

aagtgcagta gtcgccgtga acgttctttt tcgcaacggg tttgccgcca gaacacaggt 1320

aagtgccgtg tgtggttccc gcgggcctgg cctctttacg ggttatggcc cttgcgtgcc 1380

ttgaattact tccactggct gcagtacgtg attcttgatc ccgagcttcg ggttggaagt 1440

gggtgggaga gttcgaggcc ttgcgcttaa ggagcccctt cgcctcgtgc ttgagttgag 1500

gcctggcctg ggcgctgggg ccgccgcgtg cgaatctggt ggcaccttcg cgcctgtctc 1560

gctgctttcg ataagtctct agccatttaa aatttttgat gacctgctgc gacgcttttt 1620

ttctggcaag atagtcttgt aaatgcgggc caagatctgc acactggtat ttcggttttt 1680

ggggccgcgg gcggcgacgg ggcccgtgcg tcccagcgca catgttcggc gaggcggggc 1740

ctgcgagcgc ggccaccgag aatcggacgg gggtagtctc aagctggccg gcctgctctg 1800

gtgcctggcc tcgcgccgcc gtgtatcgcc ccgccctggg cggcaaggct ggcccggtcg 1860

gcaccagttg cgtgagcgga aagatggccg cttcccggcc ctgctgcagg gagctcaaaa 1920

tggaggacgc ggcgctcggg agagcgggcg ggtgagtcac ccacacaaag gaaaagggcc 1980

tttccgtcct cagccgtcgc ttcatgtgac tccacggagt accgggcgcc gtccaggcac 2040

ctcgattagt tctcgagctt ttggagtacg tcgtctttag gttgggggga ggggttttat 2100

gcgatggagt ttccccacac tgagtgggtg gagactgaag ttaggccagc ttggcacttg 2160

atgtaattct ccttggaatt tgcccttttt gagtttggat cttggttcat tctcaagcct 2220

cagacagtgg ttcaaagttt ttttcttcca tttcaggtgt cgtgaatgcc tgttcgctgc 2280

cagcagagcc cggtgctggc gggcagcgcc actttggctg ccctgggggc actggccctg 2340

tacttcgcgg agccctctgg ctacgggaag tacacggaga gcctgacgcc cgcggctatc 2400

cgcctgccag cccgtgccgc ctggttcctg caggagctgc cctccttcgt ggtgcccgcg 2460

gggatcctcg ccgggcagcc ccgttctctc ttcggcccgc ctgcgactgt gcttctgggc 2520

ctcttctgcg cacattactt ccacaggaca tttgtttact cactgctcac tagagggagg 2580

ccttttccag ttgtattcct tttcagaggc tttgtcttct gcatgggaaa tggactcctt 2640

caaggctact atctggttta ctgtgccgaa taccctgctg agtggtacac agacatacgg 2700

tttagcctag gtgtgttctt atttattttg ggcatgggaa tcaacattca cagcgactat 2760

atattgcgcc agctcaggaa gcctggagaa gtcatctata agattccaca aggtggcttg 2820

ttcacgtacg tttctggagc caatttcctt ggtgagatca ttgaatggat cggctatgcc 2880

ttggccactt ggtcccttcc agcacttgca tttgcatttt tctcgctttg tttccttggg 2940

ctgcgagctt ttcaccatca taggttctac gtcaagatgt ttgaggacta ccccaagtct 3000

cgaaaagccc ttattccatt tatcttttaa attatcccta atacctgcca ccccactctt 3060

aatcagtggt ggaagaacgg tctcagaact gtttgtttca attggccatt taagtttagt 3120

agtaaaagac tggttaatga taacaatgca tcgtaaaacc ttcagaagga aaggagaatg 3180

ttttgtggac cactttggtt ttcttttttg cgtgtggcag ttttaagtta ttagttttta 3240

aaatcagtac tttttaatgg aaacaacttg accaaaaatt tgtcacagaa ttttgagacc 3300

cattaaaaaa gttaaatgag aaacctgtgt gttcctttgg tcaacaccga gacatttagg 3360

tgaaagacat ctaattccgg ttttacgaat ctggaaactt cttgaaaatg taattcttga 3420

gttaacactt ctgggtggag aatagggttg ttttcccccc acataattgg aaggggaagg 3480

aatatcattt aaagctatgg gagggtttct ttgattacaa cactggagag aaatgcagca 3540

tgttgctgat tgcctgtcac taaaacaggc caaaaactga gtccttgggt tgcatagaaa 3600

gctgtttccg atcatattca ataaccctta atataacttc gtataatgta tgctatacga 3660

agttattagg tctgaagagg agtttacgtc cagccaagct agcttggctg caggtcgtcg 3720

aaattctacc gggtagggga ggcgcttttc ccaaggcagt ctggagcatg cgctttagca 3780

gccccgctgg gcacttggcg ctacacaagt ggcctctggc ctcgcacaca ttccacatcc 3840

accggtaggc gccaaccggc tccgttcttt ggtggcccct tcgcgccacc ttctactcct 3900

cccctagtca ggaagttccc ccccgccccg cagctcgcgt cgtgcaggac gtgacaaatg 3960

gaagtagcac gtctcactag tctcgtgcag atggacagca ccgctgagca atggaagcgg 4020

gtaggccttt ggggcagcgg ccaatagcag ctttgctcct tcgctttctg ggctcagagg 4080

ctgggaaggg gtgggtccgg gggcgggctc aggggcgggc tcaggggcgg ggcgggcgcc 4140

cgaaggtcct ccggaggccc ggcattctgc acgcttcaaa agcgcacgtc tgccgcgctg 4200

ttctcctctt cctcatctcc gggcctttcg acctgcagcc tgttgacaat taatcatcgg 4260

catagtatat cggcatagta taatacgaca aggtgaggaa ctaaaccatg ggatcggcca 4320

ttgaacaaga tggattgcac gcaggttctc cggccgcttg ggtggagagg ctattcggct 4380

atgactgggc acaacagaca atcggctgct ctgatgccgc cgtgttccgg ctgtcagcgc 4440

aggggcgccc ggttcttttt gtcaagaccg acctgtccgg tgccctgaat gaactgcagg 4500

acgaggcagc gcggctatcg tggctggcca cgacgggcgt tccttgcgca gctgtgctcg 4560

acgttgtcac tgaagcggga agggactggc tgctattggg cgaagtgccg gggcaggatc 4620

tcctgtcatc tcaccttgct cctgccgaga aagtatccat catggctgat gcaatgcggc 4680

ggctgcatac gcttgatccg gctacctgcc cattcgacca ccaagcgaaa catcgcatcg 4740

agcgagcacg tactcggatg gaagccggtc ttgtcgatca ggatgatctg gacgaagagc 4800

atcaggggct cgcgccagcc gaactgttcg ccaggctcaa ggcgcgcatg cccgacggcg 4860

atgatctcgt cgtgacccat ggcgatgcct gcttgccgaa tatcatggtg gaaaatggcc 4920

gcttttctgg attcatcgac tgtggccggc tgggtgtggc ggaccgctat caggacatag 4980

cgttggctac ccgtgatatt gctgaagagc ttggcggcga atgggctgac cgcttcctcg 5040

tgctttacgg tatcgccgct cccgattcgc agcgcatcgc cttctatcgc cttcttgacg 5100

agttcttctg aggggatcaa ttctctagag ctcgctgatc agcctcgact gtgccttcta 5160

gttgccagcc atctgttgtt tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca 5220

ctcccactgt cctttcctaa taaaatgagg aaattgcatc gcattgtctg agtaggtgtc 5280

attctattct ggggggtggg gtggggcagg acagcaaggg ggaggattgg gaagacaata 5340

gcaggcatgc tggggatgcg gtgggctcta tggcttctga ggcggaaaga accagctggg 5400

gctcgactag agcttgcgga acccttaata taacttcgta taatgtatgc tatacgaagt 5460

tattaggtcc ctcgagggga tccctctctc cggtctgcag gcattggcgg gtacatgcgg 5520

atcataacca ccagatggcg ctgttggcct aagctcgagc acagtccaca gcctggaggt 5580

cctgggaaag cctgacctga atctaaaact tctctaaact ccctaatttg attcaaaagc 5640

aaaacagtag aatacttctg cacatcccag cgaggtcaga gtatagtggt tgctgagact 5700

gcgtgggggc ccaaggagac ctggagaaag gaatgcttcc tgctccttct tctggggccc 5760

caggagagcc ttcccagggc cttggagagg tgctgtccag ggactaaccc tgtgctctag 5820

gaaggctgca ggccctgacc agctgggcag gtcctgggtc cctcctggcc ttctaagttc 5880

cccaaacatg agacctctgg gtgtggggtg gcctggggag gtcattttgc ccaggcccta 5940

cctcctgccc attcctaacc ctttttaaaa atctgtgcgt cctcttcttc cttcttctcc 6000

ctcccttccc ttttcgctca ccctctgctg ctggcctgag agccggaggc ccccaggggg 6060

aaggcgactg gtctcctccc cagtctcagg gaagggagac agagaatcca ggaagccaga 6120

actcagcaga cgaagcaccc agggacctag agatgggttg aaaagttgac agctgtccca 6180

cctgcctccc aaggtctcag ggcctaaacc tccaaggcag gaaaggcccc tgtccctccc 6240

tggggtccat agaaagaggg acaagtctgc acggaccatt tgctgtaata ttaacacctt 6300

ggctgtcatt aggtagtctt ggctgttaat tatgtcctgt gataatgtat tattagcacg 6360

ccgaccacat agggtaggga actgcagcta gtaaacaaaa gtttgttcct atatgcggcc 6420

gccataaaag ttttgttact ttatagaaga aattttgagt ttttgttttt tttaataaat 6480

aaataaacat aaataaattg tttgttgaat ttattattag tatgtaagtg taaatataat 6540

aaaacttaat atctattcaa attaataaat aaacctcgat atacagaccg ataaaacaca 6600

tgcgtcaatt ttacacatga ttatctttaa cgtacgtcac aatatgatta tctttctagg 6660

gttaatctag ctgcgtgttc tgcagcgtgt cgagcatctt catctgctcc atcacgctgt 6720

aaaacacatt tgcaccgcga gtctgcccgt cctccacggg ttcaaaaacg tgaatgaacg 6780

aggcgcgctc actggccgtc gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc 6840

aacttaatcg ccttgcagca catccccctt tcgccagctg gcgtaatagc gaagaggccc 6900

gcaccgatcg cccttcccaa cagttgcgca gcctgaatgg cgaatgggac gcgccctgta 6960

gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca 7020

gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcgccggct 7080

ttccccgtca agctctaaat cgggggctcc ctttagggtt ccgatttagt gctttacggc 7140

acctcgaccc caaaaaactt gattagggtg atggttcacg tagtgggcca tcgccctgat 7200

agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga ctcttgttcc 7260

aaactggaac aacactcaac cctatctcgg tctattcttt tgatttataa gggattttgc 7320

cgatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaatttta 7380

acaaaatatt aacgcttaca atttaggtgg cacttttcgg ggaaatgtgc gcggaacccc 7440

tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac aataaccctg 7500

ataaatgctt caataatatt gaaaaaggaa gagtatgagt attcaacatt tccgtgtcgc 7560

ccttattccc ttttttgcgg cattttgcct tcctgttttt gctcacccag aaacgctggt 7620

gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg ggttacatcg aactggatct 7680

caacagcggt aagatccttg agagttttcg ccccgaagaa cgttttccaa tgatgagcac 7740

ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc aagagcaact 7800

cggtcgccgc atacactatt ctcagaatga cttggttgag tactcaccag tcacagaaaa 7860

gcatcttacg gatggcatga cagtaagaga attatgcagt gctgccataa ccatgagtga 7920

taacactgcg gccaacttac ttctgacaac gatcggagga ccgaaggagc taaccgcttt 7980

tttgcacaac atgggggatc atgtaactcg ccttgatcgt tgggaaccgg agctgaatga 8040

agccatacca aacgacgagc gtgacaccac gatgcctgta gcaatggcaa caacgttgcg 8100

caaactatta actggcgaac tacttactct agcttcccgg caacaattaa tagactggat 8160

ggaggcggat aaagttgcag gaccacttct gcgctcggcc cttccggctg gctggtttat 8220

tgctgataaa tctggagccg gtgagcgtgg ttcacgcggt atcattgcag cactggggcc 8280

agatggtaag ccctcccgta tcgtagttat ctacacgacg gggagtcagg caactatgga 8340

tgaacgaaat agacagatcg ctgagatagg tgcctcactg attaagcatt ggtaactgtc 8400

agaccaagtt tactcatata tactttagat tgatttaaaa cttcattttt aatttaaaag 8460

gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac gtgagttttc 8520

gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt 8580

tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt 8640

gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat 8700

accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga actctgtagc 8760

accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa 8820

gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg 8880

ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag 8940

atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa aggcggacag 9000

gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc cagggggaaa 9060

cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt 9120

gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg 9180

gttcctggcc ttttgctggc cttttgctca catgttcttt cctgcgttat cccctgattc 9240

tgtggataac cgtattaccg cctttgagtg agctgatacc gctcgccgca gccgaacgac 9300

cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc ccaatacgca aaccgcctct 9360

ccccgcgcgt tggccgattc attaatgcag ctggcacgac aggtttcccg actggaaagc 9420

gggcagtgag cgcaacgcaa ttaatgtgag ttagctcact cattaggcac cccaggcttt 9480

acactttatg cttccggctc gtatgttgtg tggaattgtg agcggataac aatttcacac 9540

aggaaacagc tatgaccatg attacgccaa gcgcgcccgc cgggtaactc acggggtatc 9600

catgtccatt tctgcggcat ccagccagga tacccgtcct cgctgacgta atatcccagc 9660

gccgcaccgc tgtcattaat ctgcacaccg gcacggcagt tccggctgtc gccggtattg 9720

ttcgggttgc tgatgcgctt cgggctgacc atccggaact gtgtccggaa aagccgcgac 9780

gaactggtat cccaggtggc ctgaacgaac agttcaccgt taaaggcgtg catggccaca 9840

ccttcccgaa tcatcatggt aaacgtgcgt tttcgctcaa cgtcaatgca gcagcagtca 9900

tcctcggcaa actctttcca tgccgcttca acctcgcggg aaaaggcacg ggcttcttcc 9960

tccccgatgc ccagatagcg ccagcttggg cgatgactga gccggaaaaa agacccgacg 10020

atatgatcct gatgcagcta gattaaccct agaaagatag tctgcgtaaa attgacgcat 10080

gcattcttga aatattgctc tctctttcta aatagcgcga atccgtcgct gtgcatttag 10140

gacatctcag tcgccgcttg gagctcccgt gaggcgtgct tgtcaatgcg gtaagtgtca 10200

ctgattttga actataacga ccgcgtgagt caaaatgacg catgattatc ttttacgtga 10260

cttttaagat ttaactcata cgataattat attgttattt catgttctac ttacgtgata 10320

acttattata tatatatttt cttgttatag atatc 10355

<210> 15

<211> 254

<212> PRT

<213> Sus scrofa

<400> 15

Met Pro Val Arg Cys Gln Gln Ser Pro Val Leu Ala Gly Ser Ala Thr

1 5 10 15

Leu Ala Ala Leu Gly Ala Leu Ala Leu Tyr Phe Ala Glu Pro Ser Gly

20 25 30

Tyr Gly Lys Tyr Thr Glu Ser Leu Thr Pro Ala Ala Ile Arg Leu Pro

35 40 45

Ala Arg Ala Ala Trp Phe Leu Gln Glu Leu Pro Ser Phe Val Val Pro

50 55 60

Ala Gly Ile Leu Ala Gly Gln Pro Arg Ser Leu Phe Gly Pro Pro Ala

65 70 75 80

Thr Val Leu Leu Gly Leu Phe Cys Ala His Tyr Phe His Arg Thr Phe

85 90 95

Val Tyr Ser Leu Leu Thr Arg Gly Arg Pro Phe Pro Val Val Phe Leu

100 105 110

Phe Arg Gly Phe Val Phe Cys Met Gly Asn Gly Leu Leu Gln Gly Tyr

115 120 125

Tyr Leu Val Tyr Cys Ala Glu Tyr Pro Ala Glu Trp Tyr Thr Asp Ile

130 135 140

Arg Phe Ser Leu Gly Val Phe Leu Phe Ile Leu Gly Met Gly Ile Asn

145 150 155 160

Ile His Ser Asp Tyr Ile Leu Arg Gln Leu Arg Lys Pro Gly Glu Val

165 170 175

Ile Tyr Lys Ile Pro Gln Gly Gly Leu Phe Thr Tyr Val Ser Gly Ala

180 185 190

Asn Phe Leu Gly Glu Ile Ile Glu Trp Ile Gly Tyr Ala Leu Ala Thr

195 200 205

Trp Ser Leu Pro Ala Leu Ala Phe Ala Phe Phe Ser Leu Cys Phe Leu

210 215 220

Gly Leu Arg Ala Phe His His His Arg Phe Tyr Val Lys Met Phe Glu

225 230 235 240

Asp Tyr Pro Lys Ser Arg Lys Ala Leu Ile Pro Phe Ile Phe

245 250

<210> 16

<211> 1101

<212> DNA

<213> Sus scrofa

<400> 16

aataaatgca ctgttgggcc tatgctcaag atgggtagtg ttaattggtg gtggaactta 60

tctgatttca tgacttgctg gctacctaaa acaggtgagg agaaagccaa tgggactggg 120

actggatgag caagtacaac aaacaaaatg ggcttaaagt atgagtgaga gttatctgac 180

cgtaaggatg caagtgaggg ggcctaaggt ttggagatta atatttaatc tcagatgcta 240

tactttggtg gtgtagcaaa agtctacaaa tgggatgact gtaaaactca gtagatccgt 300

gctttttaac ctatctccct tcatcaggaa attgcgacac aaagatcttt agtaataaca 360

cgcagtctca atgcataaaa tcaggcttag gtgttgcctg gactcatttc ccatctccac 420

cccactataa ttattttgtg acacaaactc aagactgtgg gaatatagag aaattgggct 480

cgtcctcgta cacctgctca atcccctgca ggacaacgcc caagaatcag gttaagccag 540

ggcaaaagaa tcccgcccat aatcgagaag gagcaaactg acatggaggc gatgacgaga 600

tcgcggggga gggagggatt tttctaggcc cagggcggtc cttaggaaaa ggaggcagca 660

gagaactccc ataaaggtat tgcggcactc ccctccccct gcggagaagg gtgcggcctt 720

ctctccgcct cctccactgc agctccctca ggattgcagc tcgcgcgggt ttttggagaa 780

catgcgcctc ccacccacaa gccagcagga ccgacccccc actccttcct ccacccccca 840

cccccacggg tccgagagca ggtagagagc tagtctcgtc cttcaggcgg cggacgccca 900

gggcggagcc gcagtcacca ccacccagaa gcctcggccc ggcagcccgc ccccgcctcc 960

tgcgcgcgct tcctgccacg ttgcgcaggg gcgaggggcc agacactgcg gcgctggcct 1020

cggggagggc cgtaccaaag accgcctccc tgccgactcg cgtagtggtt tcgctcattt 1080

gggacccaag ccaataacaa g 1101

<210> 17

<211> 1056

<212> DNA

<213> Sus scrofa

<400> 17

tgctctctct cctgccccct tcacctgcgt gccctcctca ttctccctct gtgccacctc 60

tggccttgca ctgtaggctc tctcttgggg atgtttctct ttctccacac acttctcttt 120

cactctgtcc tcttgctttg tgtgggcctg cagcgttacc cttttttctg ggcacactca 180

gagcaccctc ctctttctgg ttctgggcca cctgtctgtc ctcgggtcat cttgctctct 240

ctgcctggat gccctcctgt ggctttgggc agcttctccc tccttcagag tgcaccgcca 300

gttctcctag gcccggtcac ttccccttcc caggggacct agagccctgc taggtcctct 360

ctctccacaa cctgggcccc caaacctttc caaaacacct tgctttctgc ctccattggt 420

cttgtgttcc agagccagag tcactatatg tcccagaacc aggattccct ctggttctga 480

gggcttttat cgcatcccct gcctggctgc agtgggtctt tggggacagg ccacagaaga 540

gcctctactc ctccctctgt ccccgaggct gtctccctcc cagtcttccc agctcaggcc 600

agtccccagg cctctcttcc ctgccagagc ccgtcaggtt cggttacttt ggggcccaga 660

gaggaccctg tgaaggaagc gtgggtaggg gcacgggaat ggggaggatg cctgaagagg 720

cccccttagc cagaagagga gcagaagagg agcaggtacc cagaagagga gcagttcagg 780

gaaatagaag agtcccgagc tctttttttt tttttttttt atttcttttc ttttcttttc 840

tttttatggc agcatccgtg gtatatggag gttcccagcc taggggtcag atcatacctg 900

caactgccag cctacaccac agccacagca ctcaggatcc gagctgcatc tgcggcttac 960

gccacaggtc acagcaacgc tggatcctta acccactgaa tgaggccagg gattgaacct 1020

gcaacctcat gcacactatg ctggggtctt aatcgg 1056

<210> 18

<211> 1108

<212> DNA

<213> Sus scrofa

<400> 18

acttcctcct gcccttaccc tttatctggc tcttagctcc taaaaactgc attattagct 60

tcctcttttg cctctactct tactcaacca aaattgtttt aagatctgtg gatctagctt 120

ctgctgtgct attcttagga acacttttat ttcctcttag ctccatctca ccagttattg 180

gctaatggct ttgcttggta cctacatctg tacatttctt tcgtactagc ttctagactg 240

aaaaaggact gttggttcaa catgaaaggg aaggaggtaa aagaggacac acaggaaaga 300

tggattggga ttcaggtctc tgctgttgtt acttgagatt gctttctaga ttctacttgt 360

ggaaacaaaa agcctttgcg agaattctaa actggagtat ttctgtaatt gaggagtctt 420

gctcagcaaa tcccacttag gggactaatg aagtaccagg aagagacaga ccatgctcaa 480

tccacaaagc caggttttac tgaaatgtga cctactttct tatgttcctg gaagtttaga 540

tcagggtggg cagctctggg ttttataggc tacactgtta acactcaggc tgttttctac 600

cgtttagtca aaatatagtc accttgcctg cttcacctgt ccatcagaga atggcctcat 660

taattgactc tctagtatga agtcaaagta gctttggtgg ccctaaatgg acaagtatca 720

agagactggg tgaattgagg agcttgagac tgtcacctca gatcgaaaag actgaaaaat 780

cacctcagat caaaaagact gaaaaatctt cagtctggaa aggggactca aaaccataat 840

tagagtattc tggtagaatc cttttctcca ctgttattca tacagttaag gtgaataact 900

aaaagtaatt gtgagctgag gagtaagata caacacacaa ggaatcagtt aacagagtct 960

cgagtgaaat tataaatgga aagaattatg acttgaatca taactctgag gccccatttt 1020

ccctaacaac ttttgtccca ataaacgtgg gtatttgttt gggagaaact atcatataca 1080

tgattaccca gtaaacagac tgtttact 1108

<210> 19

<211> 1089

<212> DNA

<213> Sus scrofa

<400> 19

actttgtacc tattttgtat gtgtataata atttgagatg tttttaatta ttttgattgc 60

tggaataaag catgtggaaa tgacccaaac caatcttgca ctggcctcct gatttccttc 120

cttggagacg gagggagggg gagacctggg ggagggcgct tggggggggg tgggctctct 180

tctttctgcg ctcccccccc ccacctccaa caccttgacg acccctcctg cttccgcttg 240

cctttctcag gctttaacac tttctcctcg ccctctcagc atgcgcatgc gcgtgcctct 300

acctcccccg cacatcctgg cctgcccacc ctgaatgtcc tggcccagcg atgccaccaa 360

ctctctcgct ccgtccacgg ctggggaggg gggcactctg cagggttggg gggcactggg 420

aggctgggtt gggtgaggga ggggtgcctg ggcccccacc ccccagcaag ttctctccct 480

aggcgaactg gagggtcgtc tggcctcttg agccttgttg ctggctctga gctctaccaa 540

gagagtgacc agcaggaccg caccatcagt ggttgctgag actgcgtggg ggcccaagga 600

gacctggaga aaggaatgct tcctgctcct tcttctgggg ccccaggaga gccttcccag 660

ggccttggag agttgctgtc cagggactaa ccctgtgctc taggaaggct gcaggccctg 720

accagctggg caggtcctgg gtccctcctg gccttctaag ttccccaaac atgagacctc 780

tgggtgtggg gtggcctggg gaggtcattt tgcccaggcc ctacctcctg cccattccta 840

acccttttta aaaatctgtg cgtcctcttc ttccttcttc tccctccctt cccttttcgc 900

tcaccctctg ctgctggcct gagagccgga ggcccccagg gggaaggcga ctggtctcct 960

ccccagtctc agggaaggga gacagagaat ccaggaagcc agaactcagc agacgaagca 1020

cccagggacc tagagatggg ttgaaaagtt gacagctgtc ccacctgcct cccaaggtct 1080

cagggccta 1089

Claims

1. A method of making a recombinant porcine cell comprising the steps of: integrating a DNA molecule named as a DNA molecule A into the genome DNA of the pig cell to obtain a recombinant pig cell; the DNA molecule A expresses pig II type 5 alpha-reductase.

2. The method of claim 1, wherein: the DNA molecule A is integrated into the COL1A1 gene locus of the genomic DNA of the pig cells.

3. The method of claim 1 or 2, wherein: the "integration of the DNA molecule designated DNA molecule A into the genomic DNA of the pig cells" is carried out in the following manner: introducing a DNA molecule designated as DNA molecule B into a pig cell or introducing a recombinant plasmid having the DNA molecule B into a pig cell; and in the DNA molecule B, the DNA molecule A is provided, an upstream homology arm is arranged at the upstream of the DNA molecule A, and a downstream homology arm is arranged at the downstream of the DNA molecule A, and the upstream homology arm and the downstream homology arm are used for integrating the DNA molecule A into the genome DNA of the pig cells.

4. The method of claim 3, wherein: in the method, a recombinant plasmid with the DNA molecule B and two auxiliary plasmids are introduced into a pig cell together; the two helper plasmids are sgRNA plasmid and Cas9 plasmid;

transcribing the sgRNA plasmid to obtain a specific sgRNA; the specific sgRNA is sgRNA _COL1A1-g3 ；sgRNA _COL1A1-g3 The target sequence binding region of (3) is as shown in SEQ ID NO:13, nucleotides 1 to 20;

the Cas9 plasmid expresses Cas9 protein.

5. A kit comprising the DNA molecule of claim 3; the application of the kit is as follows (a) or (b): (a) Preparing a recombinant pig cell over-expressing a pig type II 5 alpha-reductase gene; (b) preparing the alopecia model pig.

6. A kit comprising a recombinant plasmid having the DNA molecule b of claim 3; the application of the kit is as follows (a) or (b): (a) Preparing a recombinant pig cell over-expressing a pig type II 5 alpha-reductase gene; (b) preparing the alopecia model pig.

7. The kit of claim 5 or 6, wherein: the kit further comprises a sgRNA plasmid and a Cas9 plasmid; the sgRNA plasmid is the sgRNA plasmid of claim 4; the Cas9 plasmid is the Cas9 plasmid described in claim 4.

8. The use of the DNA molecule B as claimed in claim 3 for the preparation of a kit; the application of the kit is as follows (a) or (b): (a) Preparing a recombinant pig cell over-expressing a pig type II 5 alpha-reductase gene; (b) preparing the alopecia model pig.

9. Use of a recombinant plasmid having the DNA molecule B of claim 3 in the preparation of a kit; the application of the kit is as follows (a) or (b): (a) Preparing a recombinant pig cell over-expressing a pig type II 5 alpha-reductase gene; (b) preparing the alopecia model pig.

10. Use of a recombinant plasmid having the DNA molecule b of claim 3, a sgRNA plasmid and a Cas9 plasmid in the preparation of a kit; the sgRNA plasmid is the sgRNA plasmid of claim 4; the Cas9 plasmid is the Cas9 plasmid described in claim 4; the application of the kit is as follows (a) or (b): (a) Preparing a recombinant pig cell over-expressing a pig type II 5 alpha-reductase gene; (b) preparing the alopecia model pig.

11. The use of the DNA molecule B of claim 3, the recombinant plasmid having the DNA molecule B of claim 3, the kit of claim 5, the kit of claim 6 or the kit of claim 7, which is (a) or (b) below: (a) Preparing a recombinant pig cell over-expressing a pig type II 5 alpha-reductase gene; (b) preparing the alopecia model pig.

12. A recombinant porcine cell produced by the method of any one of claims 1 to 4.

13. Use of the recombinant porcine cells of claim 12 for the preparation of a hair loss model pig.